ID: 969450490

View in Genome Browser
Species Human (GRCh38)
Location 4:7270169-7270191
Sequence TAAAATCCACATCATGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969450490_969450497 10 Left 969450490 4:7270169-7270191 CCGTGCCCATGATGTGGATTTTA 0: 1
1: 0
2: 1
3: 18
4: 233
Right 969450497 4:7270202-7270224 AGAGGCATATGTGATGCTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 173
969450490_969450495 8 Left 969450490 4:7270169-7270191 CCGTGCCCATGATGTGGATTTTA 0: 1
1: 0
2: 1
3: 18
4: 233
Right 969450495 4:7270200-7270222 CCAGAGGCATATGTGATGCTTGG 0: 1
1: 0
2: 2
3: 23
4: 131
969450490_969450499 28 Left 969450490 4:7270169-7270191 CCGTGCCCATGATGTGGATTTTA 0: 1
1: 0
2: 1
3: 18
4: 233
Right 969450499 4:7270220-7270242 TGGGGATGCTACCTGTGAACGGG 0: 1
1: 0
2: 0
3: 12
4: 100
969450490_969450500 29 Left 969450490 4:7270169-7270191 CCGTGCCCATGATGTGGATTTTA 0: 1
1: 0
2: 1
3: 18
4: 233
Right 969450500 4:7270221-7270243 GGGGATGCTACCTGTGAACGGGG No data
969450490_969450496 9 Left 969450490 4:7270169-7270191 CCGTGCCCATGATGTGGATTTTA 0: 1
1: 0
2: 1
3: 18
4: 233
Right 969450496 4:7270201-7270223 CAGAGGCATATGTGATGCTTGGG 0: 1
1: 0
2: 1
3: 19
4: 150
969450490_969450493 -8 Left 969450490 4:7270169-7270191 CCGTGCCCATGATGTGGATTTTA 0: 1
1: 0
2: 1
3: 18
4: 233
Right 969450493 4:7270184-7270206 GGATTTTAAATCTCATCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 156
969450490_969450498 27 Left 969450490 4:7270169-7270191 CCGTGCCCATGATGTGGATTTTA 0: 1
1: 0
2: 1
3: 18
4: 233
Right 969450498 4:7270219-7270241 TTGGGGATGCTACCTGTGAACGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969450490 Original CRISPR TAAAATCCACATCATGGGCA CGG (reversed) Intronic
900387007 1:2415267-2415289 TAAAATCCACAGCCTTGGCCAGG - Intergenic
900962682 1:5935284-5935306 TAAATTCCAGATCATGGGCCAGG + Intronic
903108733 1:21109259-21109281 AAAAATAAACATCATGAGCAGGG - Intronic
904076934 1:27850278-27850300 TCAAGTCCACATCAGGGGCAAGG - Exonic
904141960 1:28360685-28360707 TAAAATCACCATAATGGGCCTGG - Intergenic
906756784 1:48325224-48325246 TCAAGTCCACAACAGGGGCAAGG + Intronic
908712490 1:67032383-67032405 TAATAATCACATCATGGGCTGGG + Intronic
910136279 1:83974179-83974201 ATAAATCCATTTCATGGGCACGG + Intronic
910982705 1:92974781-92974803 TAAAAACCAAATTATGGGCTGGG - Intergenic
912106842 1:106288837-106288859 TAAAATGCACATGATGGGCTGGG - Intergenic
914803941 1:150979029-150979051 TAAAATGTACAACATGGGGAAGG + Intergenic
917435946 1:175021427-175021449 AAATACCCACAACATGGGCATGG - Intronic
917812366 1:178671724-178671746 TATTATCCAAAGCATGGGCAGGG - Intergenic
920578227 1:207079011-207079033 GAACATCCACATCATTAGCAAGG - Intronic
922806086 1:228390639-228390661 TAAAATCCACTACAAGGGAAAGG + Intergenic
923449621 1:234104515-234104537 TAAGAGCCACATCAATGGCATGG + Intronic
923673716 1:236063593-236063615 TAAAATCCACAAGATGACCAAGG - Intronic
924732854 1:246727873-246727895 AAAAATCCACATCCTGGCCATGG - Intronic
1066378806 10:34884045-34884067 TAAAATCAACATCTGGGGCTGGG + Intergenic
1068997527 10:63224766-63224788 AAAAATCCACTTAATGGGCCGGG + Intronic
1070038688 10:72753577-72753599 TGAAAACCACATAATGGGCCGGG + Intronic
1070045031 10:72824502-72824524 AAAAATAGACATCATGGGCCGGG - Intronic
1070340353 10:75492716-75492738 TGTAACCCACACCATGGGCAGGG - Intronic
1071312666 10:84357997-84358019 TAAATTCCACCTAATGGGAAAGG - Intronic
1074677441 10:115868057-115868079 TAAAAGTCACATCATGGGCTGGG - Intronic
1075584230 10:123645553-123645575 TGAAATACTCATGATGGGCAGGG + Intergenic
1076894979 10:133306495-133306517 TAAAAACTACATGCTGGGCACGG + Intronic
1078121685 11:8516888-8516910 TAGACTCCACATCTGGGGCAGGG + Intronic
1078129972 11:8605365-8605387 TAAAAACCTCATTATGGGCCGGG + Intergenic
1079800914 11:24867505-24867527 TAAAATAAACATCAATGGCAAGG - Intronic
1079861374 11:25676272-25676294 TAAAATACACATCATGCTCATGG + Intergenic
1079940543 11:26674696-26674718 AAAAATCCACATTTTGGGCCAGG - Intronic
1080475621 11:32588093-32588115 TAGAAACCACATCATAGGCCAGG + Intronic
1082190157 11:49233315-49233337 GAAAAACAACATGATGGGCATGG - Intergenic
1083155100 11:60817895-60817917 TATAATCCACATTTTCGGCAAGG - Intergenic
1083183188 11:61001494-61001516 TAAAAGACACATCATCGGCCAGG - Intronic
1084688067 11:70708913-70708935 TAAAATACACAAGAAGGGCAGGG + Intronic
1085202258 11:74708767-74708789 TGAAATCAACATCATGGGAGGGG + Intronic
1086272740 11:85087541-85087563 CAAAAACCAGATCATGGGCCGGG + Intronic
1086869459 11:92018926-92018948 AAAAATCCAGATCATGGAGAAGG - Intergenic
1087858240 11:103119688-103119710 TAAAATGTACAACATGGGCTGGG - Intronic
1088394635 11:109352892-109352914 TAGAATCCACATTATGTCCAAGG + Intergenic
1088754239 11:112872528-112872550 TAAAAGCCCCCTCATGGGCAGGG - Intergenic
1090197679 11:124830947-124830969 CAAAAACCACATCAAGGGTATGG + Intergenic
1090860444 11:130647986-130648008 TAAAAGAAACACCATGGGCATGG + Intergenic
1091011325 11:132003539-132003561 AAAAATGCAAATCATGGGCCAGG - Intronic
1091391215 12:127223-127245 TAAAAACCTCATCAGGGGCCAGG + Intronic
1093568143 12:20633258-20633280 TAAAAGCCTCATTATGGGCCAGG - Intronic
1093828147 12:23720832-23720854 TAAAGTCAACATGATGGGCTCGG + Intronic
1097684439 12:62678235-62678257 AAAAATGCAAATCCTGGGCATGG - Intronic
1100394846 12:94176074-94176096 AAAAATCCACATCGTGCCCAAGG + Intronic
1101282694 12:103275792-103275814 TAAAATCCATTTCATTGGCTGGG + Intronic
1101302890 12:103499578-103499600 CAAAATCCACATTCTTGGCATGG - Intergenic
1102143999 12:110640612-110640634 GAAAAGCCACACCATGGGCTGGG - Intronic
1103066937 12:117906748-117906770 TAAAATACACATCACTGGCCGGG + Intronic
1103344218 12:120238500-120238522 TAAAATCCAAACCAGGGGCGAGG - Intronic
1104616635 12:130275835-130275857 TTTAATCCACACCATGAGCAAGG - Intergenic
1104754170 12:131258507-131258529 TAAAATTCCCATCAAGGCCAAGG - Intergenic
1106287600 13:28331252-28331274 TAAACTCCAAATCCTGTGCATGG + Intronic
1107500512 13:40969505-40969527 TAAAATGCATATCACGTGCAGGG + Intronic
1107915853 13:45149875-45149897 AAAACTCCACATCAAGTGCATGG + Intronic
1109089324 13:58019603-58019625 TAAAATCCACATTTTGTTCAAGG + Intergenic
1109995148 13:70113213-70113235 TAAAAATCACATCATAGGCCAGG - Intergenic
1110226630 13:73126267-73126289 TAAAATTCACATAATAGGCCAGG - Intergenic
1110398146 13:75057049-75057071 AAAATTCTACATCATGGGCCGGG + Intergenic
1112004284 13:95241067-95241089 TAAAAACCACCTCATTGGCCAGG + Intronic
1117299517 14:54410674-54410696 TAAAATCTCCAGCATGGCCATGG - Intronic
1117415542 14:55491957-55491979 TAAAAGCCACATCCAGGCCAGGG - Intergenic
1120477014 14:85001401-85001423 TAAAGTCAACATCAAGTGCAGGG - Intergenic
1122203064 14:100134143-100134165 TAAACTCCACAGCATGTGCAAGG - Intronic
1122471574 14:101970776-101970798 TAAAATCCCAAACATGGGCTGGG - Intronic
1123179606 14:106457040-106457062 TAAAATGCTCATCATAGTCAAGG - Intergenic
1123442375 15:20301679-20301701 TCAGATCCACGGCATGGGCAGGG - Intergenic
1123666465 15:22612406-22612428 TAAAAACCAGACCATGGGCTTGG - Intergenic
1123689672 15:22827441-22827463 CAAAGTCCCCAGCATGGGCAGGG - Exonic
1124563720 15:30797095-30797117 TAAAAACCAGACCATGGGCTTGG + Intergenic
1124818160 15:33017767-33017789 TAAAATCCATATGATGGGCTGGG + Intronic
1125758855 15:42083784-42083806 GGAAGACCACATCATGGGCAGGG + Intronic
1126547824 15:49891818-49891840 TAAAAACAACATCTTGGGCCGGG + Intronic
1127087739 15:55440344-55440366 TAAAATCACCATCATTGGCCAGG - Intronic
1127476418 15:59337944-59337966 TATTAGCCACATCATGGACAGGG - Intronic
1128288722 15:66460594-66460616 TAAAATCCACTTCCTGAACATGG - Intronic
1131833941 15:96371748-96371770 TAAAATCCATATCACAGGCCAGG + Intergenic
1133169382 16:3971771-3971793 TAACATCCCCATTATGTGCAGGG + Intronic
1133889973 16:9869542-9869564 CAAAATCCACATCATTTTCAGGG - Intronic
1134623179 16:15705275-15705297 TAAAATCCACCTCAGAGGCCAGG - Intronic
1136695074 16:32072021-32072043 TAAAATGCTCATCATGATCAAGG + Intergenic
1136718200 16:32301560-32301582 GAAAATCCACTTCAGGGCCAGGG + Intergenic
1136795574 16:33015280-33015302 TAAAATGCTCATCATGATCAAGG + Intergenic
1136836574 16:33507830-33507852 GAAAATCCACTTCAGGGCCAGGG + Intergenic
1136874348 16:33839096-33839118 TAAAATGCTCATCATGATCAAGG - Intergenic
1137562603 16:49512518-49512540 TGAGCTCCACAGCATGGGCATGG + Intronic
1138227291 16:55307622-55307644 TCATATCCATATCATGGGAAGGG + Intergenic
1138803402 16:60062661-60062683 CAAGATCCACATCATTGGCCTGG - Intergenic
1203008228 16_KI270728v1_random:216205-216227 GAAAATCCACTTCAGGGCCAGGG - Intergenic
1203097829 16_KI270728v1_random:1276944-1276966 TAAAATGCTCATCATGATCAAGG + Intergenic
1143204713 17:5133660-5133682 TTAGATGCACATCCTGGGCATGG + Intronic
1147361289 17:39932237-39932259 TAATATCCACAACATGAGGAGGG - Intergenic
1147517509 17:41135086-41135108 TAAAACCTAGATGATGGGCAGGG + Intergenic
1148704869 17:49620892-49620914 TTAAATCCTCATCATTAGCAAGG - Intronic
1149205749 17:54244595-54244617 TAAAATGAACATAATGGGGAGGG + Intergenic
1149849669 17:60027139-60027161 CAAGGTCCACATCCTGGGCAGGG - Intergenic
1149860499 17:60119385-60119407 CAAGGTCCACATCCTGGGCAGGG + Intergenic
1153713408 18:7822123-7822145 AAAAGTACACATCAGGGGCAAGG - Intronic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1155194510 18:23460490-23460512 TAAAATCCATAAAATGGGGATGG + Intronic
1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG + Intergenic
1155737928 18:29247058-29247080 TAAAATCCAGATTGTGGTCATGG - Intergenic
1158537027 18:58317470-58317492 TAAAAACCACATCTTGGCCAGGG + Intronic
1158671145 18:59475017-59475039 GAAAATGCACAAAATGGGCAGGG - Intronic
1158920937 18:62190281-62190303 TAAAATACAGAACATCGGCAGGG + Intronic
1160060328 18:75524044-75524066 TAAAATGGGCCTCATGGGCAAGG - Intergenic
1160970282 19:1764854-1764876 TACAACCCACATCTGGGGCAGGG + Intronic
1162443717 19:10709299-10709321 TAAAATCCAGAACATTGGCCGGG + Intronic
1163706067 19:18814115-18814137 TAAAATCCACTTTGTTGGCAGGG - Intergenic
1164099118 19:22038837-22038859 AAAAATCCAGATCAGGGGCCAGG + Intergenic
1166933164 19:46313955-46313977 TATAAACCACAACATGGGCCGGG - Intronic
1166933336 19:46315360-46315382 TATAAACCACAACATGGGCTGGG - Intronic
1167073092 19:47231621-47231643 GCAAATCCACACCATGGACAGGG + Intronic
925739925 2:6996361-6996383 TAAAATGCACATCAGTGGGAGGG + Intronic
927531639 2:23810713-23810735 TAAAATCCACTTTAAGGGCCAGG + Intronic
929315031 2:40466692-40466714 TAATATGCACAGCATGGGCCTGG - Intronic
935799162 2:106675534-106675556 AAAAATCCACATCATGAAAATGG - Intergenic
938966998 2:136397508-136397530 TAAAAGCCACATCTTGTTCAGGG - Intergenic
941049688 2:160718686-160718708 AAAAATCCACAGCCTGGGCGTGG - Intergenic
943163646 2:184287375-184287397 CAAAATCCACATCGTGGGGGAGG + Intergenic
943223339 2:185138464-185138486 TAAAATTCAAATCAGGAGCATGG - Intergenic
946611593 2:221464158-221464180 TTAAATCCAGATCCTGGGGAGGG - Intronic
947911226 2:233802269-233802291 TGACATCCACATCCTGGCCATGG - Exonic
948319218 2:237056248-237056270 AAAAATCCAGATCACTGGCAGGG + Intergenic
948595024 2:239074225-239074247 TAAAATCCACACCAAAAGCATGG - Intronic
1169651541 20:7873757-7873779 TAAATTCATCATTATGGGCAGGG - Intergenic
1170508831 20:17056200-17056222 TAAATTCCCCACCATGGGCTAGG + Intergenic
1170718344 20:18851734-18851756 TAATATCCACATCAGGGGGTTGG - Intergenic
1171354308 20:24532461-24532483 AAGGAACCACATCATGGGCATGG + Intronic
1172613077 20:36266141-36266163 TATTATCCTTATCATGGGCAAGG - Intronic
1173784228 20:45780942-45780964 TTTAAACCACATCATGGGCCTGG + Intronic
1174526692 20:51177717-51177739 TAAAAGCCACATGATGGCCTGGG - Intergenic
1181076487 22:20381387-20381409 TAAAATCAACATTATAGGCTGGG + Intronic
1181348264 22:22236517-22236539 TAAAAGGCAAATAATGGGCAGGG + Intergenic
949198181 3:1338345-1338367 CTAAATCAAAATCATGGGCATGG - Intronic
950896688 3:16458439-16458461 AAAAATTCACATCATGAGGAGGG - Intronic
954418295 3:50405015-50405037 TAAAAATAACATCATGGGAAGGG - Intronic
955817395 3:62860077-62860099 TAAAAGCCACATGATCGGAAAGG - Intronic
956608763 3:71100563-71100585 TAAAAACCACATGATGTGAAGGG - Intronic
957334403 3:78808496-78808518 TAAAATCCACATTTCAGGCAGGG - Intronic
958417209 3:93888896-93888918 TAAAATCCACATCCTCATCATGG + Intronic
958968183 3:100582096-100582118 TTAAAAACAAATCATGGGCAAGG + Intergenic
959285212 3:104399954-104399976 AAAAATACACATGGTGGGCATGG - Intergenic
962860905 3:139400603-139400625 TAATAATCACATCATGGGCCAGG + Intergenic
964353337 3:155824938-155824960 TAAAATATTTATCATGGGCAGGG + Exonic
964369240 3:155982667-155982689 TAAAAACCCCATGCTGGGCATGG + Intergenic
965368382 3:167827878-167827900 TAAAATCCACATGATTGACCAGG - Intergenic
967320507 3:188190352-188190374 TAAAATCCAAAGAATGGGCCAGG - Intronic
969450490 4:7270169-7270191 TAAAATCCACATCATGGGCACGG - Intronic
970842828 4:20495391-20495413 TCAAATCCAGATCATAGGGAAGG + Intronic
971034681 4:22680276-22680298 TAAAAGCTACAGCATGGGCTTGG + Intergenic
971085417 4:23269370-23269392 TAAAAACCAGAGCATGGGGAGGG + Intergenic
971409045 4:26351168-26351190 TGAAATCCACAGGATGGGCCTGG - Intronic
971653226 4:29306823-29306845 TATTAACCACATCATTGGCAGGG + Intergenic
972358692 4:38306078-38306100 GAAAATACACCTCATGGGCCAGG + Intergenic
973631344 4:52823833-52823855 TAAAATCAAGATGGTGGGCAGGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974004270 4:56540245-56540267 TCAAAGCCATATCATGGGCCAGG + Intronic
974407808 4:61497817-61497839 TAAAATACACATTATGGGCTGGG - Intronic
976179727 4:82387492-82387514 TAAAATCCAATTGATCGGCAGGG - Intergenic
976207293 4:82635322-82635344 TAAAAGCAACATCACGGGCCGGG + Intronic
976247800 4:83021072-83021094 TAAAAAGGACATCATGGGCCAGG - Intergenic
980012320 4:127610678-127610700 ATAAATCCACATCATGGGCCAGG + Intergenic
981265581 4:142779376-142779398 TAAACTCCAAATCATGTGAAGGG - Intronic
982712410 4:158769831-158769853 TAATTTCCACATCATGTGGAAGG + Intronic
986282828 5:6337533-6337555 TAAAATGCACATAATAGGCTGGG + Intergenic
990140644 5:52699361-52699383 AAAAACCTACAACATGGGCAGGG + Intergenic
995874778 5:116778855-116778877 TAAAAGACACATCAGGGGAAGGG - Intergenic
999291064 5:150426700-150426722 TAAAACACACATTATGGGCCAGG - Intergenic
1001555598 5:172634941-172634963 TGAAATGCATGTCATGGGCATGG - Intergenic
1002157618 5:177295251-177295273 GAAAAGCCTCATCACGGGCAGGG + Exonic
1003212909 6:4083005-4083027 TAAAATCTGAATCCTGGGCATGG - Intronic
1003650388 6:7954351-7954373 TAAAATCCAAATCATGAGGCCGG + Intronic
1004454905 6:15783412-15783434 TATATACCTCATCATGGGCACGG + Intergenic
1004474632 6:15959758-15959780 TAAAATGTACAGCATGGGCTGGG - Intergenic
1004623720 6:17354700-17354722 TAAAACCCAAAACATTGGCAGGG - Intergenic
1005925240 6:30439083-30439105 TGAAATTCACATCATCTGCATGG + Intergenic
1006071990 6:31505144-31505166 GAAAAGACTCATCATGGGCATGG - Intronic
1006308401 6:33239386-33239408 TAAAATCCACAGGATGGGCCGGG - Intergenic
1011468796 6:87687245-87687267 TAAAACACACAACTTGGGCAGGG + Intronic
1012006599 6:93720458-93720480 TAAAATCCATACTATGGGCTGGG + Intergenic
1012300128 6:97577006-97577028 TATAATTTACATAATGGGCAGGG + Intergenic
1013436664 6:110116573-110116595 TAAATTCCACCTCTTGGGGAAGG + Intronic
1015243500 6:131052230-131052252 TAAAATCAACATCAGTGGCTGGG - Intronic
1015940980 6:138451593-138451615 TAAAGTCCCCACCAAGGGCAAGG - Intronic
1015973958 6:138770670-138770692 TATAATCGACATCATTGGCCAGG + Intronic
1016370039 6:143364361-143364383 AAAAATCCAGAACAGGGGCAGGG + Intergenic
1017848207 6:158278086-158278108 TAAATTCATCATCATAGGCACGG + Intronic
1019138174 6:169925199-169925221 TAAAATCAACCTCAAGGGAATGG - Intergenic
1020269548 7:6585853-6585875 TAAAATTCACATATTGGGCCAGG + Intronic
1020434186 7:8144836-8144858 TAAAATCCAAGTCATGAGCCTGG + Intronic
1020824120 7:13005645-13005667 TAAAAATCACATCATTGGCCGGG - Intergenic
1021996005 7:26178908-26178930 TAAACTCCACATTCTGGGAAGGG - Intronic
1022177893 7:27889634-27889656 TAAAATTGAGATCATGGGCCAGG + Intronic
1023859322 7:44208017-44208039 TAAAAACCACAGCCTGGGCCGGG - Intronic
1025030411 7:55552177-55552199 TAACATGCACTGCATGGGCAAGG + Intronic
1025780764 7:64599950-64599972 CACAATCCCCATCATGGACAGGG - Intergenic
1026466186 7:70656846-70656868 TAAAATTCAGCTCATGGGGAAGG - Intronic
1026558912 7:71431882-71431904 TAAAATCAACAGGCTGGGCATGG + Intronic
1026832275 7:73617547-73617569 TCAAATCCACAGGATGGGCTGGG + Intronic
1027452709 7:78351209-78351231 TAAAATACGCATTGTGGGCAGGG + Intronic
1027457416 7:78410489-78410511 TAGAATCCACATCCTGGAAAAGG - Intronic
1027987359 7:85310099-85310121 TAAAAAACACATCTTGGGAAAGG + Intergenic
1031958094 7:127963148-127963170 GAAAATGCAAAGCATGGGCAGGG + Intronic
1033826177 7:145192307-145192329 AAAAATTCACTTCATGGGCTGGG + Intergenic
1034671277 7:152860325-152860347 TAAAATCTAACTCTTGGGCATGG + Intergenic
1035444368 7:158929719-158929741 TAAAACCCAAATTCTGGGCAAGG - Intronic
1037545406 8:19915586-19915608 TAGATTCCACATCTAGGGCAGGG - Intronic
1039240880 8:35555530-35555552 TAAAATACAAATTATAGGCAGGG + Intronic
1041100852 8:54395485-54395507 CAAAACACACATTATGGGCACGG + Intergenic
1042438769 8:68799930-68799952 CAAGAACCACAGCATGGGCAAGG + Intronic
1042650831 8:71039097-71039119 TAAAATCAGCATCCTGGGCCAGG - Intergenic
1045103023 8:98864337-98864359 TAAAAAGCACACCATGGGGATGG + Intronic
1045756809 8:105553104-105553126 TAAAAACAACACCATGGGCTGGG - Intronic
1052635805 9:31102530-31102552 TGAAATCAAAATCATGGGGATGG + Intergenic
1053108962 9:35440077-35440099 CACAATCCAAATGATGGGCAGGG - Intergenic
1055131936 9:72785696-72785718 GAGAATTCACATCCTGGGCAGGG + Intronic
1055783853 9:79850480-79850502 TCATATCCACATTATGGTCATGG - Intergenic
1056255120 9:84790864-84790886 TAAAATCCACGTTATAGCCAGGG - Intronic
1057320898 9:94011502-94011524 TAACATCCACTTTATAGGCAAGG - Intergenic
1058437488 9:104976457-104976479 TATAAACAACATTATGGGCAGGG - Intergenic
1058965037 9:110029420-110029442 TAAAATACATGACATGGGCATGG + Intronic
1059253439 9:112907651-112907673 TAGAGTCCACAGGATGGGCAAGG + Intergenic
1059578430 9:115517326-115517348 TGAAATTAACATCATGGGCTAGG - Intergenic
1059860246 9:118452410-118452432 TAAGATCCATATCTTGGGCCGGG + Intergenic
1059945482 9:119404726-119404748 TAAAATCCCCACCATGCCCATGG - Intergenic
1061397317 9:130350239-130350261 TAAAATTCACATAATGGGCTGGG + Intronic
1062134941 9:134921333-134921355 AAAAATCCACATCAGGAGAAGGG + Intergenic
1187438701 X:19296819-19296841 TCAAAACCACAACATGGGCCGGG - Intergenic
1188573735 X:31620708-31620730 TAAAATTCATATCATGGGCCAGG - Intronic
1189984667 X:46543635-46543657 CAAAATGCAAATCATGGGAAAGG - Intronic
1190308484 X:49100576-49100598 TTTAATCCACATCATAGGTAAGG - Intronic
1191914965 X:66191710-66191732 GAAAATCCACCTCATGGGGCTGG - Intronic
1192367750 X:70488524-70488546 GAAAATCCACATCATGGGTTTGG + Intronic
1193460755 X:81788715-81788737 TAAAATCTACATGATGGGCTGGG - Intergenic
1193690318 X:84634040-84634062 GAAAATCCACATCATGGAGAAGG + Intergenic
1193844435 X:86451140-86451162 TAATATTCACAACATAGGCACGG - Intronic
1196849598 X:119924979-119925001 AAAAATCCAAATTATGGGCTGGG - Intergenic
1197236221 X:124067558-124067580 TAAAAAGCACACAATGGGCAGGG - Intronic
1197451319 X:126621901-126621923 CAAAATCCACATTATCTGCATGG - Intergenic
1197692631 X:129520033-129520055 TAAAATCCTAATCTTGAGCAGGG + Intronic
1197978249 X:132188159-132188181 TAAAATCAAGATCCTTGGCAAGG + Intergenic
1198864038 X:141101944-141101966 TAAATTCTACATCATTGACAAGG - Intergenic
1198898651 X:141485471-141485493 TAAATTCTACATCATTGACAAGG + Intergenic
1199835382 X:151585107-151585129 AAAAATGCACATAAAGGGCAAGG + Intronic
1201728387 Y:17180203-17180225 TAAAATCAACACCAAGGGGATGG - Intergenic
1202130858 Y:21607651-21607673 TAAATTCTACATCATTGACAAGG + Intergenic