ID: 969451632

View in Genome Browser
Species Human (GRCh38)
Location 4:7277124-7277146
Sequence GGCTGTGTATGGAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969451620_969451632 11 Left 969451620 4:7277090-7277112 CCACGTCCTGTGAGGGTCTCTCC 0: 1
1: 0
2: 0
3: 8
4: 146
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data
969451625_969451632 -10 Left 969451625 4:7277111-7277133 CCTGGGCTCCTTTGGCTGTGTAT 0: 1
1: 0
2: 0
3: 13
4: 181
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data
969451615_969451632 18 Left 969451615 4:7277083-7277105 CCTGCCCCCACGTCCTGTGAGGG 0: 1
1: 0
2: 1
3: 28
4: 249
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data
969451619_969451632 12 Left 969451619 4:7277089-7277111 CCCACGTCCTGTGAGGGTCTCTC 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data
969451617_969451632 14 Left 969451617 4:7277087-7277109 CCCCCACGTCCTGTGAGGGTCTC 0: 1
1: 0
2: 3
3: 14
4: 140
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data
969451623_969451632 5 Left 969451623 4:7277096-7277118 CCTGTGAGGGTCTCTCCTGGGCT 0: 1
1: 0
2: 2
3: 26
4: 229
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data
969451613_969451632 19 Left 969451613 4:7277082-7277104 CCCTGCCCCCACGTCCTGTGAGG 0: 1
1: 0
2: 0
3: 28
4: 229
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data
969451618_969451632 13 Left 969451618 4:7277088-7277110 CCCCACGTCCTGTGAGGGTCTCT 0: 1
1: 0
2: 2
3: 9
4: 136
Right 969451632 4:7277124-7277146 GGCTGTGTATGGAGGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969451632 Original CRISPR GGCTGTGTATGGAGGGTGGG TGG Intronic
No off target data available for this crispr