ID: 969454604

View in Genome Browser
Species Human (GRCh38)
Location 4:7294241-7294263
Sequence CTGTGGGCAGATTTGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 701}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969454589_969454604 19 Left 969454589 4:7294199-7294221 CCATGATGAGGCAGTGCCGGGGC 0: 1
1: 0
2: 4
3: 10
4: 168
Right 969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG 0: 1
1: 0
2: 7
3: 49
4: 701
969454595_969454604 3 Left 969454595 4:7294215-7294237 CCGGGGCGTAGGGGAGAGGAGGG 0: 1
1: 0
2: 6
3: 51
4: 545
Right 969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG 0: 1
1: 0
2: 7
3: 49
4: 701
969454587_969454604 20 Left 969454587 4:7294198-7294220 CCCATGATGAGGCAGTGCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG 0: 1
1: 0
2: 7
3: 49
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969454604 Original CRISPR CTGTGGGCAGATTTGGGGTG GGG Intronic
900225031 1:1528983-1529005 CTGTGGGCAGGGCTGGTGTGAGG + Intronic
900428552 1:2591634-2591656 CTGTGGGCATGTTGGGGGCGTGG + Intronic
901628153 1:10635106-10635128 CAGGGGGCAGTTTTGGGGTCTGG + Intergenic
902612779 1:17607055-17607077 GTGAAGTCAGATTTGGGGTGAGG + Intronic
903480736 1:23651512-23651534 CTGTGGGCAGAGGTGGGATCAGG - Intergenic
903645610 1:24894133-24894155 CTGTGGGCATATTTGGGTAGGGG + Intergenic
905380336 1:37557260-37557282 CAGAGGGCAGATTTAGGATGGGG + Intronic
905442393 1:38003953-38003975 CAGTGGGCATGTTGGGGGTGGGG - Intronic
905528846 1:38660596-38660618 CTGTGGGCAGAAATGGAATGAGG + Intergenic
908390830 1:63682219-63682241 CTGTGTGGAGAATGGGGGTGAGG - Intergenic
908788976 1:67762180-67762202 CTGTGGACAGCCTTGGGTTGGGG - Intronic
908893760 1:68875935-68875957 CTGGGGGCTGTTGTGGGGTGGGG - Intergenic
908972186 1:69850048-69850070 ATGTTGGGTGATTTGGGGTGGGG + Intronic
909467403 1:75988322-75988344 CTGTGCACAGCTTTGGGATGTGG - Intergenic
910656049 1:89619279-89619301 CTGTGTTTAAATTTGGGGTGGGG + Intergenic
910949394 1:92629820-92629842 CTGGGGCCTGTTTTGGGGTGGGG - Intronic
912951860 1:114125756-114125778 CCATGGGGAGATTTTGGGTGGGG + Intronic
913205880 1:116538346-116538368 CTGAGGGCTGCTATGGGGTGGGG - Intronic
913388662 1:118286737-118286759 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
915275177 1:154783587-154783609 CTCTGGACAGGCTTGGGGTGGGG + Intronic
915311312 1:155007228-155007250 GTGTGGGCATCTTTTGGGTGGGG - Intronic
915690225 1:157681396-157681418 CTGGGGACTGTTTTGGGGTGGGG - Intronic
916299074 1:163253804-163253826 CTGGGGACAGTTGTGGGGTGTGG - Intronic
916978428 1:170107632-170107654 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
917015530 1:170527718-170527740 GTGTTGGCAGATTTGGTGTCTGG + Intergenic
918083804 1:181228213-181228235 CTGTGGGCAGATTTTCCATGAGG + Intergenic
918204814 1:182299388-182299410 CTGGGGGCACATTTAGGTTGGGG - Intergenic
918416184 1:184310894-184310916 GGGTGGGTAGATATGGGGTGAGG - Intergenic
918583252 1:186157594-186157616 CTGGGGACTGTTTTGGGGTGGGG - Intronic
919686239 1:200486433-200486455 ACGTGGGTAGATTTGGGGTAAGG - Intergenic
919800964 1:201354399-201354421 CCGTGGGCTGACTTGGGGTGAGG - Intergenic
920280329 1:204838638-204838660 CTGTGGGGTGAGGTGGGGTGGGG + Intronic
921856704 1:219994212-219994234 ATGTGTGCAGCTTTGGGATGTGG - Intronic
922232114 1:223696556-223696578 CTATGGGCTGATTTGGGCTGTGG - Intergenic
922464945 1:225840113-225840135 CTGTGGGCAGCATTGGGGTGGGG - Intronic
923595484 1:235358069-235358091 CTGAAGTCAGAGTTGGGGTGGGG - Intergenic
924311531 1:242748723-242748745 CTGGGGGCTGTTGTGGGGTGGGG - Intergenic
1063052833 10:2471628-2471650 ACGTGGGCAGAATTGGGGAGAGG - Intergenic
1064344187 10:14515944-14515966 CTGGGGGCTGTTTTGGGGTGGGG + Intergenic
1065364395 10:24921353-24921375 CTGTGTGTTGTTTTGGGGTGTGG - Intronic
1066062162 10:31733796-31733818 CTGTGGGCAAATTTTGAGGGAGG - Intergenic
1068002700 10:51354791-51354813 CTATGGGAAGGCTTGGGGTGGGG + Intronic
1068328458 10:55528380-55528402 CTGGGGCCTGTTTTGGGGTGTGG - Intronic
1068485161 10:57648590-57648612 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1068876455 10:62001611-62001633 ATGTGAACAGAGTTGGGGTGAGG + Intronic
1068893519 10:62173971-62173993 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1069160293 10:65084310-65084332 CTGTGGGCAGCCTTGTGGTGGGG + Intergenic
1069354401 10:67567008-67567030 CTGGGGACTGTTTTGGGGTGGGG + Intronic
1069367740 10:67711737-67711759 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1069565083 10:69458668-69458690 CTGTGGCCAGACTGGGGGAGGGG - Intronic
1069881957 10:71598705-71598727 CTTTGGAAAGATTTGGGTTGTGG + Intronic
1069986995 10:72291249-72291271 CTGTGGGCAGCTGGGGAGTGTGG + Intergenic
1070405425 10:76090302-76090324 CTGTGGCTAGGTTTGGGTTGGGG + Intronic
1070406919 10:76105402-76105424 ATGTGGGCTTATTTGGGGGGTGG + Intronic
1070986941 10:80697245-80697267 CTGTGATGAGATTTTGGGTGGGG - Intergenic
1072038588 10:91586667-91586689 GTGTGAACAGATTTGGGGTAAGG + Intergenic
1072179397 10:92966441-92966463 CTGGGGACTGATGTGGGGTGGGG - Intronic
1072375973 10:94816732-94816754 CTGGGGACTGATGTGGGGTGGGG - Intronic
1072376711 10:94824810-94824832 CTGGGGACTGATGTGGGGTGGGG - Intronic
1072619565 10:97070721-97070743 GTATTGGCAGATTTGGCGTGTGG - Intronic
1072769593 10:98126431-98126453 CTGTGGGCAGCATGGGAGTGGGG - Intergenic
1073023850 10:100471286-100471308 CTGTAGGCAGAGGTGGGGAGGGG - Intronic
1073267930 10:102239788-102239810 CTGTGGTTAGAATTGGGGTCAGG + Intronic
1074019956 10:109572347-109572369 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1074360655 10:112822082-112822104 CTGGGGGCAGATTTTGGGTTTGG + Intergenic
1074497832 10:113995534-113995556 CTGTGGGCAGATTAGCTGAGGGG - Intergenic
1074993347 10:118732182-118732204 CTGTGAGCTGATATGGGGTTGGG + Intronic
1075732633 10:124645460-124645482 CTGTGGGTGGAATGGGGGTGGGG - Intronic
1076446210 10:130516024-130516046 CTGAGAGCAGGCTTGGGGTGTGG + Intergenic
1076603245 10:131673096-131673118 ATGTGGGTTGATATGGGGTGAGG - Intergenic
1077376924 11:2209518-2209540 CTGTGGGCCGACAGGGGGTGAGG - Intergenic
1077396760 11:2327774-2327796 CTGGGGCCCGTTTTGGGGTGGGG - Intergenic
1077858102 11:6149495-6149517 CTGTGGAGAGAATTTGGGTGTGG + Intergenic
1077911192 11:6572185-6572207 GTGTGGGTACAGTTGGGGTGGGG + Intronic
1078794206 11:14575413-14575435 CTGTGGCCTGAGGTGGGGTGGGG - Intronic
1078852778 11:15179550-15179572 CTGTGGGAGGAGTGGGGGTGAGG - Intronic
1080218231 11:29869883-29869905 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1080222801 11:29925600-29925622 GTGTGGGTAGACTGGGGGTGTGG - Intergenic
1080235100 11:30059051-30059073 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1080242253 11:30140047-30140069 CTGGGGCCTGTTTTGGGGTGGGG - Intergenic
1080457864 11:32431772-32431794 GTGAGGGCAGATGTGGGGTGAGG - Intronic
1080727690 11:34914758-34914780 CTTTGGGCAGCTTAGGGGGGTGG + Intronic
1081820651 11:45990806-45990828 TAGTGGGGAGATGTGGGGTGGGG - Intronic
1081984624 11:47292683-47292705 CTAAGAGCAAATTTGGGGTGGGG - Intronic
1082111911 11:48286329-48286351 CTGTGGCCTGTTGTGGGGTGGGG - Intergenic
1082123041 11:48400356-48400378 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1082224789 11:49691824-49691846 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1082245205 11:49913417-49913439 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1082298594 11:50475700-50475722 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1082304071 11:50548893-50548915 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1082557458 11:54579568-54579590 CTGGGGACAGTTTTGGGGTGTGG + Intergenic
1082910888 11:58373061-58373083 CTGTGGCCTGTTGTGGGGTGGGG + Intergenic
1082940140 11:58696437-58696459 CTGGGGACAGTTGTGGGGTGGGG - Intronic
1083366530 11:62144906-62144928 CTGTGGGCAGCTTTTGGGGCTGG + Intronic
1083511432 11:63212654-63212676 CTGTGGTCTGTTGTGGGGTGGGG + Intronic
1083514675 11:63245643-63245665 CTGGGGCCAGTTGTGGGGTGGGG - Intronic
1083532921 11:63441149-63441171 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1083894043 11:65611403-65611425 CTGTCTGCAGGATTGGGGTGGGG - Intronic
1084081991 11:66833448-66833470 ATTTGGACATATTTGGGGTGGGG + Intronic
1084088984 11:66867916-66867938 CTGGGGGCAGAACTGGGGTCAGG + Intronic
1084332620 11:68438729-68438751 GTCTGGGCAGCTTTGGGGAGTGG + Intronic
1084445454 11:69200895-69200917 CTGAGGGCAGAACTGGGCTGGGG - Intergenic
1084477871 11:69399052-69399074 CTGTGGGCACGTGAGGGGTGGGG - Intergenic
1084486296 11:69450257-69450279 CTGAGAGCAGAGATGGGGTGGGG - Intergenic
1084493644 11:69491497-69491519 CTATGGGAAGCTGTGGGGTGAGG + Intergenic
1084705565 11:70814376-70814398 CTGCTGGCAGAGTAGGGGTGAGG - Intronic
1084785974 11:71441831-71441853 CTGGGGGCAGAGTTGGGATGCGG + Intronic
1084889327 11:72228948-72228970 CTCTGGGCTGAGGTGGGGTGGGG - Intronic
1085316561 11:75548618-75548640 GTCTGGGCAGAGTTGGGGTTAGG + Intergenic
1085407880 11:76274760-76274782 CTGTGGACATCTTTCGGGTGGGG - Intergenic
1085924613 11:81001159-81001181 CTGTAGGTAGAGTTGGGCTGTGG + Intergenic
1086886031 11:92206625-92206647 CTGAGGGCAGATTTGGGGAGGGG + Intergenic
1087359670 11:97142418-97142440 CTGGGGCCTGTTTTGGGGTGGGG - Intergenic
1087722106 11:101678569-101678591 CTGGGGACTGTTTTGGGGTGGGG - Intronic
1088098255 11:106124711-106124733 CTGGGGACAGTTGTGGGGTGTGG + Intergenic
1088293517 11:108266472-108266494 CTGTGGACTGTTGTGGGGTGGGG + Intronic
1089103781 11:115985303-115985325 ATCAGGGCAGATTTGGGGTGTGG - Intergenic
1089917449 11:122171982-122172004 CTGGGGGCTGTTGTGGGGTGGGG - Intergenic
1090053355 11:123400549-123400571 ATGTGGGCAGATTTGATGTCTGG + Intergenic
1090349080 11:126095741-126095763 CTGGAGACAGATCTGGGGTGAGG + Intergenic
1091211421 11:133864461-133864483 CTGTGGGCAGAACTGTGCTGGGG - Intergenic
1091429284 12:419128-419150 CTATGAGCAGATTTGGGCAGAGG + Intronic
1091586904 12:1821833-1821855 ATGTGGACAGCTTGGGGGTGGGG - Intronic
1092496740 12:9003857-9003879 CTGGGGACAGTTGTGGGGTGGGG - Intronic
1094270541 12:28609498-28609520 CTGTGAGGAAATTTGGGGTCAGG + Intergenic
1094343741 12:29442459-29442481 CTGTGGACTGTTGTGGGGTGGGG + Intronic
1095067273 12:37792881-37792903 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1095104314 12:38213159-38213181 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1095580566 12:43792377-43792399 TTGTTGGCTGAATTGGGGTGGGG + Intergenic
1095608366 12:44097702-44097724 CTGTGGACTGTTGTGGGGTGGGG + Intronic
1095839354 12:46675432-46675454 ATGAGGGCAGATTGGGGATGAGG + Intergenic
1096029797 12:48403324-48403346 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1096134649 12:49189156-49189178 CTCTGGGCAGATTGGGGGTCTGG - Exonic
1096308374 12:50498811-50498833 TTTTGGCCAGATTTGGGGGGAGG + Intergenic
1096360211 12:50978479-50978501 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1096616998 12:52839003-52839025 CTGTGGGCTGGCTTGGGCTGTGG + Exonic
1096781142 12:53992791-53992813 CTGCGGGCGGAGTTGGGGGGGGG + Intronic
1096802829 12:54122797-54122819 CTCTGGGCAGGGTTGGGGTGGGG - Intergenic
1097187704 12:57204525-57204547 GTGTGGTGAGATTTGGGGCGGGG + Exonic
1098191638 12:67955289-67955311 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1098917790 12:76275372-76275394 CTATGGGCAAATTTGGAGTCTGG - Intergenic
1100398622 12:94207372-94207394 CTGGGGACAAATTGGGGGTGAGG - Intronic
1101978918 12:109388320-109388342 CTTTTGGCAGATTTTGGGCGTGG + Intronic
1102749849 12:115282947-115282969 CTCTGAACAGATTTGGGGTTTGG - Intergenic
1102812898 12:115839728-115839750 ATGAGGGCAGATTTGGTGTCTGG + Intergenic
1103716618 12:122948940-122948962 CTGTGGGCGGGGTTGGGGGGTGG + Intronic
1105211822 13:18261534-18261556 GTGTGGGCAGGTGTGGGGGGTGG - Intergenic
1105803677 13:23935872-23935894 CTGTGCCCAGTTTTGGGATGTGG + Intergenic
1105905588 13:24806802-24806824 CTGGGGACTGTTTTGGGGTGGGG - Intronic
1106955406 13:34932926-34932948 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1107295945 13:38907615-38907637 ATGTGCCCAGATTTGGGATGTGG - Intergenic
1107394842 13:40004611-40004633 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1108550594 13:51539828-51539850 CTCTGATCAGATTTGGGGAGCGG - Intergenic
1108585121 13:51864344-51864366 GTGTGGGAGGATTTGGAGTGTGG - Intronic
1110174853 13:72543843-72543865 CTGTGGGTTCAGTTGGGGTGGGG + Intergenic
1110274462 13:73628250-73628272 CTGGGGCCTGTTTTGGGGTGGGG - Intergenic
1110645602 13:77879950-77879972 CTGTGGACTGTTGTGGGGTGAGG - Intergenic
1110950658 13:81485880-81485902 GTGTGGGCAGATTTAGTGTCTGG - Intergenic
1111325851 13:86695071-86695093 CTGTGTGCAGCTTAGGGGTTTGG - Intergenic
1111662746 13:91231641-91231663 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1113026851 13:105949798-105949820 GTGTGTGCAGAGTAGGGGTGGGG + Intergenic
1113446230 13:110369775-110369797 CAATGGGGAGCTTTGGGGTGAGG - Intronic
1113512981 13:110870491-110870513 CTGTGGGCAGCCTGGGGATGAGG - Intergenic
1113544636 13:111138791-111138813 CTATGGCCAGACTTGGGGTGGGG - Intronic
1113868727 13:113545563-113545585 CTGGGGGCGGAGTGGGGGTGGGG - Intronic
1114004060 14:18292980-18293002 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
1114395440 14:22354843-22354865 CTGTGGCCTGTTGTGGGGTGGGG + Intergenic
1114738121 14:25063845-25063867 GTGTGGGCAGATTTAGTGTCTGG - Intergenic
1114994618 14:28332396-28332418 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1115404132 14:32996534-32996556 CTGTGTGCAGCCTTGGGATGTGG + Intronic
1115438678 14:33406729-33406751 CTGTGCTCAAATCTGGGGTGGGG + Intronic
1115762670 14:36590847-36590869 GTGTGGGCAGTCTTGTGGTGGGG - Intergenic
1115815812 14:37163128-37163150 CTGGGGACAGTTGTGGGGTGGGG + Intronic
1118148063 14:63162166-63162188 GTGCAGGCAGATTTGGGGTCTGG - Intergenic
1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG + Intergenic
1119036923 14:71238059-71238081 CTGGGGGCAGAGTTGGGTGGGGG + Intergenic
1119406188 14:74401221-74401243 CAGTGGGCAGGGCTGGGGTGAGG - Intergenic
1119745146 14:77038532-77038554 AGGTGGGGAGATGTGGGGTGGGG + Intergenic
1119920001 14:78438005-78438027 CTGGGGGTAGATGTGGGGTGTGG + Intronic
1120042901 14:79773615-79773637 CTGGGGACTGTTTTGGGGTGGGG + Intronic
1120063305 14:80010626-80010648 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1120065304 14:80033534-80033556 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1121413721 14:93764432-93764454 CTGTGGACAGCTTTGGGGGCGGG - Intronic
1121626017 14:95385903-95385925 CTGTGGTCAGTTGAGGGGTGCGG - Intergenic
1121813679 14:96913099-96913121 CTGTGGGCAGATGGGGGGAAAGG + Intronic
1122168797 14:99853523-99853545 CTGTGGTCATGGTTGGGGTGGGG + Intronic
1122175648 14:99916696-99916718 CTGTGGGCATATTTGAGGAGTGG - Intronic
1122319698 14:100846352-100846374 CTGGGGGCAGATCTGAGATGAGG - Intergenic
1122580322 14:102767732-102767754 CTGTGGGCAGCCCTGGGGAGAGG + Intergenic
1122689429 14:103524743-103524765 CTGGAGGCAGACTTGGGGGGAGG + Intergenic
1122716848 14:103701090-103701112 CTCTAGGCAGACTTGGGGTGGGG + Intronic
1123114911 14:105890271-105890293 CTGTGTGCAGATGGGGGGTGGGG + Intergenic
1123120541 14:105914404-105914426 CTGGCGGTAGGTTTGGGGTGAGG - Intergenic
1124598988 15:31115883-31115905 GTGTAGGCAGATTTGGGGCCTGG + Intronic
1124855951 15:33389064-33389086 CTGGGGACTGTTTTGGGGTGGGG + Intronic
1125193038 15:37015567-37015589 GGGAGGGCAGATTTGAGGTGGGG + Intronic
1126265564 15:46749442-46749464 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1126459147 15:48896657-48896679 TTTTGGGGAGCTTTGGGGTGAGG - Intronic
1126532285 15:49724667-49724689 GTGTGGGCAGTTGGGGGGTGGGG - Intergenic
1126815315 15:52448127-52448149 CTGAGAGCAGCTGTGGGGTGGGG + Intronic
1127083040 15:55399145-55399167 GTGAGGGCAGAGTAGGGGTGGGG + Intronic
1127741553 15:61912796-61912818 CTGGGGACTGTTTTGGGGTGGGG - Intronic
1128185391 15:65640017-65640039 CTCTGCACAGATTTGGGATGGGG + Intronic
1128226277 15:66003617-66003639 GGGTGGGCAGAGGTGGGGTGAGG - Intronic
1128246198 15:66134465-66134487 GAGTGGGCAGATTGCGGGTGGGG - Intronic
1128405460 15:67332989-67333011 CTGCTGGCAGATTTGGTGTCTGG + Intronic
1128728960 15:70007696-70007718 TTGGGGGCAGATTTGGTGAGGGG - Intergenic
1129429243 15:75486463-75486485 GTGCTGGCAGATTTGGGGTCTGG - Intronic
1129505975 15:76081768-76081790 TGGTGGGCAGATTTGCAGTGTGG - Intronic
1129572676 15:76705385-76705407 CTGGGGACTGTTTTGGGGTGGGG + Intronic
1129623849 15:77176089-77176111 CTGTGGACTGTTGTGGGGTGGGG + Intronic
1130192724 15:81751749-81751771 CTGGTGGGAGGTTTGGGGTGGGG - Intergenic
1130698094 15:86151140-86151162 CTGGGGACAGTTGTGGGGTGGGG + Intronic
1131118442 15:89808601-89808623 CTGGGGGCAGGTGTGGGGTGGGG - Intronic
1131265298 15:90912020-90912042 CTGTGGGCACAGGAGGGGTGAGG - Intronic
1131271979 15:90953132-90953154 CTGTGGCCAGATGTGAGGAGTGG - Intronic
1131542807 15:93288915-93288937 CTGTGGACAGCTTGGGGGTGGGG + Intergenic
1132255234 15:100371125-100371147 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1132598008 16:762007-762029 CTGTGGGCCACTGTGGGGTGGGG - Intronic
1133358630 16:5155902-5155924 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1133980706 16:10631334-10631356 CTGTGGGAAGCCATGGGGTGGGG + Intronic
1133984958 16:10661401-10661423 CTGTGCTGAGATCTGGGGTGGGG - Intronic
1134012252 16:10863613-10863635 CTGGGGGAAGTGTTGGGGTGGGG - Intergenic
1134745536 16:16585272-16585294 TTGTGGGCTGCTGTGGGGTGGGG + Intergenic
1134749577 16:16615260-16615282 ATGTGGACATATTTGGGGAGGGG + Intergenic
1134995893 16:18738364-18738386 ATGTGGACATATTTGGGGAGGGG - Intergenic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1135886218 16:26310791-26310813 TTATGGGTAGATTTGTGGTGAGG - Intergenic
1136523357 16:30811993-30812015 CTCTGGGGAGATCTGGGGTGCGG - Intergenic
1136620236 16:31423760-31423782 ATATGGTCAGGTTTGGGGTGGGG - Intronic
1136914817 16:34177597-34177619 CTGGGGACAGTTGTGGGGTGAGG - Intergenic
1137044431 16:35642592-35642614 CAGTGAGCAGGTGTGGGGTGAGG + Intergenic
1137074901 16:35949672-35949694 CTGGGGGCTGCTGTGGGGTGGGG + Intergenic
1138766353 16:59609932-59609954 GTGTGGCCAGATTTGGCCTGGGG - Intergenic
1138999177 16:62488661-62488683 CTGGGGACCGTTTTGGGGTGGGG - Intergenic
1139470446 16:67175301-67175323 CTAAGGGCAGATTAGGGCTGAGG - Exonic
1139663976 16:68443197-68443219 AGGTGGGCAGGTTTGGGGTTTGG - Intronic
1140149332 16:72345975-72345997 CTGGGGGCTGTTGTGGGGTGGGG + Intergenic
1140518957 16:75566061-75566083 CTGAGGGCTGTTTGGGGGTGTGG - Intergenic
1140869943 16:79096935-79096957 CTGTGGGCATATTGGGGAGGGGG + Intronic
1141396364 16:83708594-83708616 ATGTGGACAGCTTTGGGGAGTGG - Intronic
1141670439 16:85488905-85488927 CGGGGGTCAGATTTGGGATGAGG + Intergenic
1141679448 16:85535773-85535795 CTGCAGGCAGAGTAGGGGTGAGG - Intergenic
1141846241 16:86610919-86610941 CTGAGGGCTGCTCTGGGGTGGGG + Intergenic
1142136051 16:88452600-88452622 CTTGGGCCAGACTTGGGGTGTGG - Intergenic
1142184566 16:88688414-88688436 CTGCGAGCACCTTTGGGGTGGGG + Intergenic
1142255167 16:89010389-89010411 CTGTCTGTAGAGTTGGGGTGAGG + Intergenic
1142287407 16:89177052-89177074 CTGTGGCCAGGGTTGTGGTGGGG - Intronic
1142393106 16:89815832-89815854 CTGCGGGCAGATTTAGGTTCGGG - Intronic
1142860291 17:2756628-2756650 GTGTGGGATGATTTGGGATGGGG - Intergenic
1143379798 17:6488881-6488903 CAGTGCCCAGATTTGGGGTGGGG + Intronic
1143388565 17:6546560-6546582 CTGTGGTCAGGTTCGTGGTGTGG - Intronic
1143527048 17:7479107-7479129 CGTGGGGCAGATTGGGGGTGGGG - Intronic
1144439219 17:15266343-15266365 CTGTGGGCAGAACAGGGGAGAGG - Intergenic
1144670507 17:17130171-17130193 CTGTGGGCTGAGCTGGGCTGAGG + Intronic
1146052225 17:29563174-29563196 CTGTGGACAGATCTGGCCTGCGG - Intronic
1146359488 17:32162117-32162139 CTGTTGGAGGTTTTGGGGTGGGG + Intronic
1146471507 17:33128587-33128609 CTGTGGGGAGTTTTGGAGTGGGG + Intronic
1147247433 17:39131708-39131730 CTGGGAGCAGAGTTGGGGGGTGG - Intronic
1147424093 17:40337505-40337527 CAGCGGGCAGATTTGGGGGTGGG - Intronic
1148219394 17:45851155-45851177 ATGTGTGCAGGTGTGGGGTGTGG - Intergenic
1149071481 17:52549132-52549154 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1149566667 17:57645188-57645210 CTGTGGGCAGGGTTGGGGCCAGG + Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1150602282 17:66661285-66661307 TGGAGGGCAGATATGGGGTGGGG + Intronic
1151231937 17:72691089-72691111 GTGAGGGCAGACTAGGGGTGGGG + Intronic
1151599893 17:75099806-75099828 GGGAGGGCAGATCTGGGGTGGGG + Intronic
1151878780 17:76882128-76882150 CTGTGGGCAGAGTGTGGGTATGG - Intronic
1152139062 17:78525757-78525779 TTCTGGAAAGATTTGGGGTGAGG - Intronic
1152460294 17:80438874-80438896 CTGTGGCCAGAGCAGGGGTGGGG - Intergenic
1152609863 17:81310188-81310210 TTGTGGGCAGCTTCCGGGTGCGG - Intergenic
1152995175 18:399797-399819 CTGAGGGCAGATATGTGGTGAGG + Intronic
1153763219 18:8351555-8351577 CTGTGGCCAGATTTAGGGAAAGG - Intronic
1155658958 18:28225247-28225269 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
1157181501 18:45502188-45502210 ATATGGGAAGATTAGGGGTGGGG + Intronic
1157304943 18:46509884-46509906 CAGAGGCCAGGTTTGGGGTGAGG + Intronic
1158055866 18:53279484-53279506 CTGTGGCCTGTTGTGGGGTGGGG + Intronic
1158196881 18:54897326-54897348 TAGTGGGCAGTTTGGGGGTGGGG - Intergenic
1158444937 18:57511419-57511441 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1158698864 18:59728533-59728555 CAGTGGGCACTTTTGTGGTGTGG - Intergenic
1158771318 18:60520979-60521001 CTGGGGCCTGTTTTGGGGTGGGG - Intergenic
1159028591 18:63208798-63208820 CTGTAGGCAGCTCTGGGTTGGGG + Intronic
1159419939 18:68205345-68205367 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1159932122 18:74323863-74323885 ATGTGTGCATATTTGGGATGTGG - Intronic
1160394921 18:78564076-78564098 GGGTGTGCAGATGTGGGGTGTGG - Intergenic
1160569053 18:79804152-79804174 AGGTGGCCAGATTTAGGGTGGGG - Intergenic
1160989971 19:1856537-1856559 CTTGGGGGAGACTTGGGGTGTGG - Intronic
1161027694 19:2044234-2044256 CTGTGGCCACATGTGAGGTGGGG - Intronic
1161092440 19:2368522-2368544 CTGTGGGGAGGTTTGGGCAGAGG + Intergenic
1161917418 19:7239298-7239320 CTGGGAGCTGTTTTGGGGTGGGG - Intronic
1161943315 19:7419258-7419280 GTGTGGGCACACCTGGGGTGCGG - Intronic
1161943346 19:7419346-7419368 GTGTGGGCGCATCTGGGGTGCGG - Intronic
1163093837 19:15041310-15041332 CTGGGGCCAGTTGTGGGGTGGGG - Intergenic
1163180729 19:15599263-15599285 CTGGGGGCTGTTGTGGGGTGGGG + Intergenic
1163332710 19:16651361-16651383 CAGTGGGGAGATTTGGCCTGTGG + Intronic
1163634707 19:18432619-18432641 GGGTGGGCAGGCTTGGGGTGGGG + Intronic
1163726596 19:18926483-18926505 CCGTGAGCAGATTTAGGCTGGGG + Intronic
1163860091 19:19738216-19738238 CTGTGGGCTGAGTTTGGGCGGGG + Intergenic
1164154753 19:22585843-22585865 TTGTGGGCAGATTTTGTGTCTGG + Intergenic
1164317931 19:24111106-24111128 CTGTGGACTGTTGTGGGGTGGGG - Intronic
1164346658 19:27271228-27271250 GTGTGGACAGTTGTGGGGTGCGG + Intergenic
1164347162 19:27280708-27280730 GTGTGGACAGTTGTGGGGTGCGG - Intergenic
1164994910 19:32713894-32713916 CTGTGGGCAGAGTGGGTGGGTGG + Intergenic
1165184670 19:34007454-34007476 CTGTGGGTAGCTCTGGGCTGAGG - Intergenic
1165382952 19:35494173-35494195 GTTCTGGCAGATTTGGGGTGGGG - Intronic
1165833312 19:38740222-38740244 GTGGGGGCAGATCTGGGGTGAGG + Intronic
1165947525 19:39453268-39453290 CTGAGGTCAGATTTAGGGTGAGG + Intronic
1165948425 19:39458923-39458945 CTGTGGGGAGATTTGGGAGTAGG + Intronic
1166436334 19:42769252-42769274 CTGGGGACAGTTGTGGGGTGGGG - Intronic
1166729932 19:45053187-45053209 CTGTGGGGGGACGTGGGGTGTGG + Intronic
1166731564 19:45061971-45061993 CTTTGGACAGATCTGAGGTGGGG + Intronic
1166917388 19:46204612-46204634 GAGTGGGCAGCTTTGGGATGTGG + Intergenic
1167358511 19:49017931-49017953 CTGGGGGCGGGTCTGGGGTGGGG + Intergenic
1167617194 19:50541822-50541844 CTGAGGGAGGATTTGCGGTGGGG + Intronic
1168137620 19:54361727-54361749 CTGTGAGCAGATCAGGGCTGGGG - Intronic
1168147714 19:54429226-54429248 CTGTGATGGGATTTGGGGTGTGG + Intronic
1168160449 19:54507351-54507373 CTGTGAGCAGATCAGGGCTGGGG + Intronic
925083222 2:1086464-1086486 ATGAGGGCAGATGTGGGGTTGGG - Intronic
925235653 2:2275057-2275079 CAGTGTGCTGGTTTGGGGTGGGG + Intronic
925404086 2:3594900-3594922 CTGAGGCCGGCTTTGGGGTGGGG - Intronic
925447056 2:3936024-3936046 CTGGGGCCTGATGTGGGGTGGGG - Intergenic
925769752 2:7270321-7270343 CTGTGGGTTGATTTGCGGGGAGG - Intergenic
925851084 2:8082772-8082794 CTGTGGCCAGAGTTGGGGTGGGG + Intergenic
926229603 2:10992577-10992599 TAGTGGGCAGATTTGGGATTTGG - Intergenic
926423950 2:12724576-12724598 CTGTTGGAAGATTTAGAGTGTGG + Intronic
926803301 2:16681700-16681722 CTGGGGGCTGTTGTGGGGTGGGG - Intergenic
927208462 2:20624555-20624577 CTGTGGGCAGATGTGGGCCCTGG - Intronic
927284446 2:21341889-21341911 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
928088612 2:28360624-28360646 CTGTGGGAGGAATTGGGCTGAGG - Intergenic
928111313 2:28511372-28511394 CTGTGGGCAGATTTGACTTATGG + Intronic
928170814 2:29001959-29001981 CTGTGGGGTGAGATGGGGTGGGG + Intronic
928923290 2:36548962-36548984 CTGTAGAGATATTTGGGGTGGGG + Exonic
929586899 2:43121972-43121994 CTGTGGGCAGCTTTGGAATGCGG - Intergenic
929859059 2:45660126-45660148 CTGTTGGTAGATATGGGGTTTGG + Intronic
930556550 2:52903092-52903114 CTGTGGCCACCTTGGGGGTGGGG + Intergenic
930755232 2:54966668-54966690 GTCTGGGTAGGTTTGGGGTGGGG + Intronic
931052380 2:58428702-58428724 GGGTGGGGAGAGTTGGGGTGGGG + Intergenic
931978425 2:67668348-67668370 TTGAGGGCAGATTTTGGATGTGG - Intergenic
932244693 2:70186940-70186962 CTGGGGACAGTTGTGGGGTGGGG + Intronic
932354612 2:71058662-71058684 CTGAGGGCAGATCTTGGGTAAGG + Intergenic
932970029 2:76529322-76529344 CTGTGGGCAATTTTGGGATCTGG + Intergenic
933903287 2:86864464-86864486 CTGTGGGCAGTTAGTGGGTGGGG + Intergenic
935272541 2:101447443-101447465 GTGCGGGCAGATTTGGTGTCTGG + Intronic
935493286 2:103746842-103746864 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
935701719 2:105818265-105818287 CTGGGGCCTGTTTTGGGGTGGGG + Intronic
936143469 2:109961606-109961628 ATGTGTGCAGCTTTGGGATGAGG + Intergenic
936180155 2:110259569-110259591 ATGTGTGCAGCTTTGGGATGAGG + Intergenic
936201218 2:110409860-110409882 ATGTGTGCAGCTTTGGGATGAGG - Intronic
936558401 2:113515586-113515608 CTGTGGGCAGAACTGGGCCGTGG + Intergenic
936612312 2:114013129-114013151 CTGGGGACTGTTTTGGGGTGAGG - Intergenic
937996511 2:127698509-127698531 CTGTGAAGATATTTGGGGTGAGG + Intergenic
938211037 2:129465777-129465799 CTGGGGGCAGGTTTGGTGTCTGG - Intergenic
938307534 2:130265622-130265644 CTCTGGGGGGATGTGGGGTGGGG + Intergenic
938447798 2:131391220-131391242 CTCTGGGGGGATGTGGGGTGGGG - Intergenic
940289741 2:152066981-152067003 CTGGGGACTGTTTTGGGGTGGGG + Intronic
940484619 2:154281811-154281833 GTGGGGGCAGAGTGGGGGTGCGG - Intronic
940794403 2:158061762-158061784 CTGTGTGCAGGTTTGTGGTCTGG + Intronic
941075038 2:160997651-160997673 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941603506 2:167566338-167566360 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
941898312 2:170653131-170653153 CTCTGGACAGATTTAGGGTTAGG - Exonic
944470348 2:200046033-200046055 CTTTGTGCAGATTTGGGATATGG - Intergenic
944879929 2:204002342-204002364 ATGTGGGTAGGTTTGGGGTGAGG + Intergenic
944892886 2:204135758-204135780 CAGTGGGCAAAGTTGGGGAGTGG + Intergenic
945456318 2:210056058-210056080 CTCTGTGCAGCCTTGGGGTGTGG + Intronic
946139588 2:217678204-217678226 CTGAGGGCTGTTGTGGGGTGGGG + Intronic
946386154 2:219385707-219385729 CTGTGGGGAGACGTGGGTTGTGG + Intronic
946419113 2:219554898-219554920 CGGTGGACAGATTTGGCGGGGGG + Intronic
946713187 2:222526857-222526879 CTGTTGGGAGGTTGGGGGTGAGG + Intronic
946944713 2:224808836-224808858 CTGTGGGGAGATGTGGGGTGAGG + Intronic
947315720 2:228855754-228855776 CTGGGGACAGTTGTGGGGTGGGG + Intronic
947442658 2:230136706-230136728 TTCTGGGCAGAATGGGGGTGAGG + Intergenic
947527798 2:230889957-230889979 ATGTGGGCAGGTCTGGGATGGGG - Intergenic
947634450 2:231673019-231673041 CTGAGGGCAGATCTGGAGGGAGG + Intergenic
947886711 2:233577994-233578016 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
948085584 2:235244129-235244151 CAGTGGGCAGGTGTGGGGTCTGG - Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948985600 2:241520785-241520807 CTGTGGGAGGAAGTGGGGTGAGG - Intergenic
1169403345 20:5302552-5302574 CTGTGGCCAGATCTGGCCTGTGG - Exonic
1170040502 20:12035063-12035085 CTGTGGGTAGAGTGGGGTTGGGG + Intergenic
1170246901 20:14231292-14231314 CTGGGGCCTGTTTTGGGGTGGGG - Intronic
1170247360 20:14237697-14237719 CTGGGGCCTGTTTTGGGGTGGGG - Intronic
1171083250 20:22210309-22210331 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1171267830 20:23786975-23786997 CTGGGGCCAGTTATGGGGTGCGG - Intergenic
1171736162 20:28788468-28788490 CTGGGGACAGATGTGGGGTGGGG - Intergenic
1171791658 20:29531750-29531772 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1172177471 20:32980938-32980960 CTGTGGGAAGAGTTGAGGGGGGG + Intergenic
1172308549 20:33899395-33899417 CTGTTGGGAGATTCGAGGTGAGG + Intergenic
1173719014 20:45237051-45237073 ATGTGGGCTGAGTGGGGGTGGGG - Intergenic
1174080966 20:47970527-47970549 CTGAGGACAGGTTGGGGGTGTGG - Intergenic
1174366963 20:50062313-50062335 CTGTAGGAAGATTTGGTGAGAGG - Intergenic
1174675055 20:52345519-52345541 ATATGGTCATATTTGGGGTGGGG + Intergenic
1176323210 21:5354598-5354620 CTGGGGACTGATGTGGGGTGGGG + Intergenic
1176480864 21:7286218-7286240 CTGGGGACTGATGTGGGGTGGGG + Intergenic
1176638460 21:9271892-9271914 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1176712067 21:10159165-10159187 CTGGGGGCTGTTGTGGGGTGGGG + Intergenic
1179398374 21:41061730-41061752 TCGTGGGAAGATTTTGGGTGGGG - Intergenic
1179479259 21:41667227-41667249 CTGGGGGTGGATTTGGGGTGGGG + Intergenic
1179978209 21:44882778-44882800 CTTTGGGCAGAATTGGAGTTAGG - Intergenic
1180370514 22:12031518-12031540 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1180422502 22:12879389-12879411 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1180428574 22:15223779-15223801 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
1180511178 22:16092134-16092156 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1180814626 22:18781799-18781821 GTGTGGGCAGGTGTGGGGGGTGG - Intergenic
1180954975 22:19737517-19737539 CTGTGGCCATATTGGGGGCGGGG - Intergenic
1181200815 22:21216135-21216157 GTGTGGGCAGGTGTGGGGGGTGG - Intronic
1182785564 22:32904761-32904783 CTGTGGGAAGCTTTCAGGTGGGG + Intronic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG + Exonic
1184287030 22:43477579-43477601 CTGTGGGCAGATTTAGGACCTGG + Intronic
1184368103 22:44065240-44065262 CTGAGGGCAGCTTCTGGGTGGGG + Intronic
1184513340 22:44945703-44945725 CTGTTGGCAGAATTGGGGGGGGG + Intronic
1185134677 22:49062937-49062959 CTGTGTGCAGATGTCGGGTCTGG + Intergenic
1185299819 22:50073410-50073432 CTGTGAGGGGATCTGGGGTGTGG + Intronic
949712456 3:6887384-6887406 CTGTGGACTGTTGTGGGGTGGGG - Intronic
949912882 3:8927897-8927919 CTGGGGCCTGTTTTGGGGTGGGG + Intronic
950100478 3:10353519-10353541 CTGAGGGAAGATGTGGGGTAGGG + Intronic
950495542 3:13331894-13331916 CCCTGGGCAGGTCTGGGGTGGGG + Intronic
950932369 3:16803235-16803257 CAGTGGAAAGATGTGGGGTGTGG + Intronic
951503140 3:23413033-23413055 CCGGGGACAGTTTTGGGGTGGGG + Intronic
951513247 3:23528165-23528187 CTGTGACCAAATGTGGGGTGAGG - Intronic
951812345 3:26714765-26714787 GTGTGGGCAAATGTGGGATGAGG - Intergenic
951867536 3:27324751-27324773 CTGTTGGAGGATTTGGGCTGAGG - Intronic
952273044 3:31851429-31851451 CTGTGGGCAGATGCGGGGAGAGG - Intronic
953413990 3:42705224-42705246 CTGTGGGCTGGCTGGGGGTGGGG + Intronic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
954496937 3:50973292-50973314 CTGGGGACTGTTTTGGGGTGGGG - Intronic
954713324 3:52515521-52515543 CTCTGGACAGGCTTGGGGTGGGG - Intronic
956464287 3:69503522-69503544 CTGTGGCCTGTTGTGGGGTGGGG + Intronic
956471764 3:69574509-69574531 CTGTGGCCTGTTGTGGGGTGGGG - Intergenic
956569264 3:70675821-70675843 CTGGGGCCTGTTTTGGGGTGAGG - Intergenic
957171730 3:76745987-76746009 CTGGGGACTGTTTTGGGGTGGGG - Intronic
957553602 3:81737906-81737928 CTGGGGACTGTTTTGGGGTGGGG - Intronic
957565972 3:81884105-81884127 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
957942556 3:87023054-87023076 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
958074112 3:88654801-88654823 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
958141183 3:89564468-89564490 GTGGTGGCAGATATGGGGTGAGG + Intergenic
959284601 3:104391423-104391445 CTGTGTGCAGCTTTGGGTTTTGG - Intergenic
961347565 3:126274055-126274077 CTGTGGGCATATTTTGGGAGTGG + Intergenic
961559957 3:127721866-127721888 CTGTAGGTAGATTTGGCCTGTGG + Intronic
961772886 3:129263170-129263192 CTGTTGGCAGGGTTGGTGTGAGG + Intronic
961826474 3:129601790-129601812 CTCTGGACAGATTTGGGGGCTGG - Intronic
961979042 3:131057041-131057063 CTGGGGACAGTTGTGGGGTGGGG - Intronic
964123392 3:153209916-153209938 CTGTGGACATATTTGGCGTGTGG - Intergenic
964664828 3:159160686-159160708 CTGGGGACAGTTGTGGGGTGGGG - Intronic
964875367 3:161361104-161361126 CTGAGAGAAGATTTGGGGGGAGG + Intronic
965135670 3:164764236-164764258 CTGGGGCCTGATGTGGGGTGGGG - Intergenic
965516958 3:169631615-169631637 CTGGGGACAGTTGTGGGGTGGGG - Intronic
966258382 3:177945974-177945996 ATGAGCCCAGATTTGGGGTGTGG - Intergenic
967301675 3:188020603-188020625 CTGGGGACTGATGTGGGGTGGGG - Intergenic
967618350 3:191601097-191601119 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1202748436 3_GL000221v1_random:133129-133151 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
968506907 4:974925-974947 CTGAGGGCAGGCTCGGGGTGGGG - Intronic
968624167 4:1619055-1619077 ATGTGGGCTGCTTTGGGGTGGGG - Intronic
969220722 4:5756775-5756797 CCGTGTGCAGGTCTGGGGTGGGG + Intronic
969221527 4:5762055-5762077 CTGGGGACTGATGTGGGGTGGGG - Intronic
969317513 4:6390965-6390987 CTGTGGTCAGAGGTTGGGTGGGG + Intronic
969340236 4:6535774-6535796 CTGTGGGCCTGTATGGGGTGGGG - Intronic
969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG + Intronic
969484035 4:7461823-7461845 AGGTGGGCAGATGTGGGGTGGGG - Intronic
970045875 4:11852546-11852568 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
970562250 4:17293755-17293777 CTGTTCGTAGATCTGGGGTGGGG + Intergenic
970811918 4:20104507-20104529 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
971442267 4:26699850-26699872 CTGGGGCCTGTTTTGGGGTGGGG + Intronic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
972743120 4:41908243-41908265 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
972818352 4:42670284-42670306 GAGTGGGCAGATATGGAGTGAGG - Intergenic
973098471 4:46231537-46231559 CTGGGGCCTGTTTTGGGGTGGGG - Intergenic
973257897 4:48131168-48131190 CTGATGGGAGATTTGGAGTGGGG - Intronic
973707102 4:53591808-53591830 TTGTGGGCAGATATGGGGAAAGG - Intronic
974199081 4:58615340-58615362 GTGAGGGCAGATTTGGTGTCTGG - Intergenic
974299560 4:60046203-60046225 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
974541565 4:63245133-63245155 CTGTGGCCTGTTGTGGGGTGGGG - Intergenic
974613058 4:64241369-64241391 CTGTGGCCTGTTGTGGGGTGGGG + Intergenic
974917854 4:68200029-68200051 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
974918138 4:68202920-68202942 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
976223630 4:82778211-82778233 CTGTTGGGGGATTGGGGGTGAGG + Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
976806873 4:89057918-89057940 CTGTTGGGAGGTTGGGGGTGAGG - Intronic
977778916 4:100957191-100957213 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
977795450 4:101159342-101159364 CAGTGGGCAGGTATGGGGTAAGG - Intronic
978038766 4:104031533-104031555 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
978042390 4:104084091-104084113 TTGTGTGCAGATTTGGGGGATGG + Intergenic
978186866 4:105866076-105866098 CTGGGGCCTGATGTGGGGTGGGG + Intronic
978494565 4:109345545-109345567 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
979592742 4:122498891-122498913 CTGGGGACTGATGTGGGGTGGGG + Intergenic
980489990 4:133511820-133511842 CTGTTGGGGGATGTGGGGTGAGG + Intergenic
980726475 4:136767998-136768020 ATGTGAGCATCTTTGGGGTGTGG + Intergenic
981080298 4:140633408-140633430 CTGTGGTGAGGTGTGGGGTGAGG + Intronic
981550522 4:145937513-145937535 CGGCGGGCGGATGTGGGGTGCGG - Intronic
982522481 4:156436333-156436355 CTGCTGGCAGATTTGAAGTGAGG + Intergenic
982813295 4:159853987-159854009 CTGTCGGCAGGTCGGGGGTGGGG + Intergenic
983251588 4:165351909-165351931 CTGTGGGCTGAGTGGGAGTGGGG - Intergenic
983934569 4:173492396-173492418 CTGTGGGTAGTTTTGGGGTGGGG - Intergenic
984358874 4:178702037-178702059 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
984384409 4:179036216-179036238 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
984680440 4:182602179-182602201 CTGTTGGCAGCTTTGCGGGGAGG + Intronic
984837826 4:184039108-184039130 CTCTGGGAAGATTCGGGCTGTGG - Intergenic
985047569 4:185955854-185955876 CTGGGGGAAGACCTGGGGTGGGG - Intronic
1202753348 4_GL000008v2_random:30305-30327 CTGGGGACAGTTGTGGGGTGCGG + Intergenic
985555387 5:555525-555547 CTGGGGGCAGAGTTGGGCAGCGG - Intergenic
985724183 5:1507042-1507064 AGGTGGGCAGATGTGGGGAGCGG + Intronic
986627842 5:9739310-9739332 CAGAGGGCAGATGAGGGGTGGGG - Intergenic
986866555 5:11995948-11995970 CTGTGGGAAGATGGGGGCTGGGG + Intergenic
987448475 5:18051881-18051903 TTGGGAGCAGATTTGGGATGTGG + Intergenic
987663588 5:20907646-20907668 TTGTGGGCAGAATTGAGGTTTGG + Intergenic
988281117 5:29148484-29148506 CTGGGGCCTGTTTTGGGGTGGGG - Intergenic
988639017 5:33020405-33020427 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
989076900 5:37573534-37573556 CTGGGGGCTGTTGTGGGGTGGGG - Intronic
989446327 5:41534075-41534097 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
989835391 5:45982213-45982235 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
989868563 5:46553345-46553367 CTGGGGACAGTTCTGGGGTGGGG - Intergenic
990332580 5:54742325-54742347 CTGGGGCCAGATTTGGCATGGGG + Intergenic
990854470 5:60248443-60248465 CTGTTGGCAGGTTTGGGCAGAGG + Intronic
990889386 5:60632288-60632310 CTGGCAGCCGATTTGGGGTGAGG - Intronic
990962925 5:61413923-61413945 CTGAGGGCAGGAGTGGGGTGGGG + Intronic
991169044 5:63599639-63599661 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
991542440 5:67744888-67744910 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
993249805 5:85505835-85505857 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
993320295 5:86462070-86462092 CAGTGGGAAGATCTGGGGTCAGG + Intergenic
993473582 5:88336000-88336022 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
993578199 5:89627512-89627534 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
993885246 5:93408480-93408502 CTGCTTGCACATTTGGGGTGTGG - Intergenic
994966886 5:106684194-106684216 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
995433564 5:112109729-112109751 ATACTGGCAGATTTGGGGTGGGG - Intergenic
995771979 5:115680527-115680549 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
996104726 5:119486411-119486433 CTGGGGGAAGAAATGGGGTGAGG - Intronic
997372453 5:133370632-133370654 CTTTGGGCAGTCTTGGGGTTTGG + Intronic
998289248 5:140897337-140897359 CTGGGGACAGTTGTGGGGTGGGG - Intronic
999556363 5:152746797-152746819 CTGGGGGCTGTTGTGGGGTGGGG + Intergenic
999865032 5:155691722-155691744 CTGCTGGCAGATTTGGTGTCTGG - Intergenic
1000171861 5:158709926-158709948 AGGTGGGGAGTTTTGGGGTGGGG + Intronic
1000251803 5:159502931-159502953 CTGCGGACAGTTGTGGGGTGGGG + Intergenic
1000478719 5:161744619-161744641 CTGTGGGGAGGTTAGGGGAGAGG + Intergenic
1000946058 5:167424312-167424334 GTGTGTGCAGAATAGGGGTGGGG - Intronic
1001032602 5:168273625-168273647 CTGGGGGCAGGTTGGTGGTGCGG + Intergenic
1001281377 5:170388845-170388867 CTGGGGGCTGATTTGGGGCTAGG - Intronic
1001281482 5:170389321-170389343 CTGTGGCCTCTTTTGGGGTGGGG - Exonic
1001350982 5:170964551-170964573 CTGTGGACTGTTGTGGGGTGGGG - Intronic
1002186737 5:177458141-177458163 CTGAGGGCAGAGTTGGGGTCTGG + Exonic
1002384527 5:178856331-178856353 CTGTTGGCATAGTAGGGGTGTGG + Intergenic
1002432769 5:179212763-179212785 CAGTGGGCAGGTGTGGGCTGAGG + Intronic
1003355437 6:5365097-5365119 CTGTGGGCAGATTTGGCCCTTGG + Intronic
1003860685 6:10319434-10319456 ATGTGGGCAGGTTTTCGGTGGGG + Intergenic
1003924243 6:10861941-10861963 CTCTGGGCACATTTGCTGTGGGG + Intronic
1004929261 6:20446028-20446050 ATGTGCACAGCTTTGGGGTGTGG + Intronic
1005243027 6:23853901-23853923 CTGTGGGGCTATTAGGGGTGCGG - Intergenic
1005273511 6:24191611-24191633 CTGTGGGCAGATTTTCTATGAGG - Intronic
1005394487 6:25367384-25367406 CTTGGGGCTGATTTGGGGTTTGG + Intronic
1005684859 6:28244488-28244510 CTGTTTTCAGAATTGGGGTGGGG - Intergenic
1006185993 6:32182083-32182105 CTCTTGGCAGAATTTGGGTGGGG + Intronic
1007596855 6:43056290-43056312 CTGTAGGCAAGTTTGGGATGTGG - Exonic
1008301816 6:49850085-49850107 CTGGGGACAGTTGTGGGGTGGGG + Intronic
1008411682 6:51187819-51187841 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1008638009 6:53431918-53431940 CTGTCAGCAGATTTGGTGTCTGG + Intergenic
1009483511 6:64191482-64191504 CTGGGGACTGTTTTGGGGTGGGG - Intronic
1009639158 6:66308205-66308227 TTATGAACAGATTTGGGGTGGGG - Intergenic
1009703564 6:67215702-67215724 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1009778525 6:68237715-68237737 TTGTGTGCATATTTGGGGTAGGG - Intergenic
1010055791 6:71562377-71562399 CTGGGGGCTGTTGTGGGGTGGGG - Intergenic
1010092719 6:72004023-72004045 CTGGGGACTGTTTTGGGGTGGGG - Intronic
1010312413 6:74402691-74402713 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1010370362 6:75100133-75100155 CTGTGTCCAGCTTTGTGGTGAGG - Intronic
1010592839 6:77730781-77730803 CTGGGGACTGTTTTGGGGTGGGG - Intronic
1010602817 6:77851620-77851642 CTGGGGCCTGTTTTGGGGTGGGG + Intronic
1010681024 6:78799289-78799311 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1010827570 6:80492428-80492450 CTGGGGACCGTTTTGGGGTGGGG - Intergenic
1010852504 6:80795375-80795397 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1011250712 6:85369158-85369180 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1011574925 6:88786993-88787015 GTGTTGGCAGATTCGGTGTGTGG - Intronic
1013849879 6:114501652-114501674 CTGGGGCCAGTTGTGGGGTGGGG - Intergenic
1014641915 6:123922568-123922590 TTTTGGTCAGTTTTGGGGTGGGG + Intronic
1014862609 6:126488241-126488263 CTGGGGCCTGTTTTGGGGTGGGG - Intergenic
1015104384 6:129519179-129519201 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1015815016 6:137200537-137200559 CTTTGTCCAGCTTTGGGGTGGGG - Intronic
1016245530 6:141975528-141975550 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1016378743 6:143451005-143451027 GTGTGGGCTGACTAGGGGTGAGG - Exonic
1017760186 6:157562496-157562518 CTCTAGGCAGATTTGGGGTGGGG + Intronic
1017837050 6:158188020-158188042 CAGTTGGCAGATGGGGGGTGGGG + Intronic
1018035406 6:159877281-159877303 CAGTGGGCTGGTTTGGGGTCTGG + Intergenic
1018971264 6:168531059-168531081 CTGTGGGAGGATTTGTGGTTGGG - Intronic
1019121029 6:169803632-169803654 CTGTGGAGAGATCTGTGGTGTGG - Intergenic
1020539515 7:9442357-9442379 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1020922738 7:14284848-14284870 CTGGGGACTGTTTTGGGGTGGGG + Intronic
1021235231 7:18135456-18135478 CTGGGGACAGTTGTGGGGTGGGG - Intronic
1021565238 7:22010228-22010250 TGGTGGGCAGATTTGGGCTGCGG + Intergenic
1021620696 7:22549133-22549155 CCATGCTCAGATTTGGGGTGGGG - Intronic
1021952412 7:25788160-25788182 CTGTGGGCTGGTCTGGGGTCTGG - Intergenic
1022403581 7:30065021-30065043 AAGTGGGCAGAATTGGGGTTGGG - Intronic
1022493537 7:30838623-30838645 GTGGGGGCAGATTTGGCCTGTGG + Intronic
1023084137 7:36553123-36553145 CTGGGGACAGTTGTGGGGTGGGG - Intronic
1023680900 7:42686046-42686068 CTGTGTGCATGTGTGGGGTGGGG + Intergenic
1023702332 7:42905036-42905058 CTGGGGGCGGGTGTGGGGTGTGG - Intergenic
1024181467 7:46899670-46899692 ATGTGGGCATCTTTGGGGGGAGG - Intergenic
1024714432 7:52059292-52059314 CTTTGGGCAAATTTGGGTTCAGG + Intergenic
1025789576 7:64676685-64676707 CTGTGGACACATATGGGGGGAGG - Intronic
1026169311 7:67939448-67939470 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1028119905 7:87045595-87045617 CTGGGGGCTGTTGTGGGGTGGGG + Intronic
1028627139 7:92889647-92889669 CTCTGTGCAGCTCTGGGGTGGGG + Intergenic
1028750008 7:94372462-94372484 CTGTAGGCAGCTTTGGGAAGTGG - Intergenic
1028810245 7:95078134-95078156 CTGGGGACTGATGTGGGGTGGGG - Intronic
1029206146 7:98870272-98870294 CCGGGGGTGGATTTGGGGTGGGG - Intronic
1029507826 7:100973108-100973130 CTGTGGGCTGAGTAGGGCTGGGG + Intronic
1029724134 7:102390995-102391017 CTGAGGTCAGATTTGAGGTCCGG - Intronic
1030753153 7:113257851-113257873 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1030792729 7:113748747-113748769 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1030794067 7:113765636-113765658 CTGAGGGCAGAGGTGGGGTGGGG - Intergenic
1031049956 7:116934923-116934945 CTGTGAGCAGTAGTGGGGTGGGG + Intergenic
1031469960 7:122156974-122156996 TTGTGGGCGGAGTTGGGGGGTGG + Intergenic
1031964066 7:128014679-128014701 CTTTGGGCAGATCTGTGGAGGGG + Intronic
1032096417 7:128940508-128940530 CTGTCTGCAAGTTTGGGGTGCGG + Intronic
1032520189 7:132538005-132538027 ATGTGAGCAGGTTTGGGGTCGGG - Intronic
1032703650 7:134403840-134403862 ATGTGGGAACATCTGGGGTGAGG + Intergenic
1032854040 7:135819378-135819400 CTTTGGGCAGGTTTTGAGTGGGG - Intergenic
1033323163 7:140358391-140358413 CTGTGGGCAGATTCTGAGTGTGG - Intronic
1033585476 7:142771589-142771611 CACTGGGCAGATTTGAGCTGAGG + Intergenic
1033940095 7:146642312-146642334 CTGTGGACTGTTGTGGGGTGGGG - Intronic
1034316246 7:150136121-150136143 GTGGGTGCAGATTTGGGGTTTGG + Intergenic
1034699108 7:153081436-153081458 CTTTGGGAATATTTGGGGGGAGG - Intergenic
1036109966 8:5887556-5887578 CTGTGGGCTGTTGAGGGGTGGGG + Intergenic
1037662238 8:20937903-20937925 CTGGGGACTGATGTGGGGTGGGG - Intergenic
1038006454 8:23434564-23434586 CTGTGGGCAGCCTTGGGGCAGGG + Intronic
1039009592 8:33078208-33078230 CTGTGGCCTGTTGTGGGGTGCGG - Intergenic
1039030509 8:33304071-33304093 CTGTGGGGTGTTTGGGGGTGAGG + Intergenic
1039920686 8:41892240-41892262 CACAGGGGAGATTTGGGGTGGGG - Intronic
1039936901 8:42052620-42052642 CGGTGGGAAGAGTTGGGGAGAGG + Intergenic
1040090241 8:43391229-43391251 CTGTGGACTGTTGTGGGGTGTGG - Intergenic
1041220936 8:55650318-55650340 CTGTGGCCTGTTGTGGGGTGGGG - Intergenic
1041398933 8:57420430-57420452 CTGGGGGCTGTTGTGGGGTGGGG + Intergenic
1041619979 8:59955493-59955515 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1041644606 8:60238754-60238776 ATGTGGGGAGAGTTAGGGTGGGG - Intronic
1041709876 8:60884712-60884734 CTGGGGACTGATGTGGGGTGGGG + Intergenic
1041813157 8:61935021-61935043 GTGTGGGAAGATATGGGCTGTGG - Intergenic
1041882183 8:62764358-62764380 CTGTGGCCAGTGTTGGGGAGAGG + Intronic
1042022803 8:64387843-64387865 CTGTGGGCATATTTTGGGATAGG - Intergenic
1042333398 8:67606169-67606191 CTGGGGACTGTTTTGGGGTGGGG + Intronic
1042621828 8:70715266-70715288 CTGTGGGCATTTTGGGGATGTGG - Intronic
1043163966 8:76880126-76880148 GTGTGGGCATATTTGGTGTCTGG - Intergenic
1043431430 8:80199069-80199091 CTGAGAGCTGATGTGGGGTGCGG + Intronic
1043952096 8:86320669-86320691 TTGAGGGCAGAATTTGGGTGGGG + Intronic
1044156253 8:88851317-88851339 GTGTGCACAGCTTTGGGGTGTGG - Intergenic
1044189809 8:89301832-89301854 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1044349599 8:91148236-91148258 CTGGGGCCTGATGTGGGGTGGGG - Intronic
1044403556 8:91799397-91799419 CTGAGGACAGTTGTGGGGTGAGG + Intergenic
1044454831 8:92381574-92381596 CTGGGGCCTGATGTGGGGTGGGG - Intergenic
1044694704 8:94911119-94911141 GTGAGAGCAGATTTGGGCTGGGG + Intronic
1045389296 8:101699747-101699769 CTGGGGCCAGTTGTGGGGTGGGG + Intronic
1045884742 8:107082265-107082287 GGCTGGGCAAATTTGGGGTGAGG - Intergenic
1046851414 8:118977587-118977609 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1047491679 8:125379957-125379979 CAGGGGGCAGATTTGGCCTGTGG + Intergenic
1047576248 8:126158969-126158991 CTGTGGGAAGAGTTGGGCGGTGG - Intergenic
1047869131 8:129062940-129062962 ATGTGGACAGATTTGGAATGTGG + Intergenic
1048829128 8:138459050-138459072 CTGTGGGCTGATTTGGGGGTGGG - Intronic
1049160628 8:141095551-141095573 CTGTGGCCAGAGCCGGGGTGCGG + Intergenic
1049830670 8:144699342-144699364 CTCTGGGGAGCTGTGGGGTGGGG + Intergenic
1049894463 9:100681-100703 CTGTGGGCAGAACTGGGGCGTGG - Intergenic
1050665153 9:7927516-7927538 CTGCTGGCAGATTTGGTGTCTGG + Intergenic
1050839723 9:10133169-10133191 GTGTGGGCAGATTTTGGGGATGG + Intronic
1050870374 9:10560395-10560417 CTGGGGACAGTTGTGGGGTGGGG + Intronic
1051895147 9:21978759-21978781 CTAAGGGCAGACATGGGGTGGGG + Intronic
1053379108 9:37634877-37634899 CTGTTGGGGGATTGGGGGTGAGG - Intronic
1053649062 9:40144885-40144907 CTGGGGGCTGTTGTGGGGTGGGG + Intergenic
1053685603 9:40518150-40518172 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1053735673 9:41100673-41100695 TTGTGGGCAGAACTGGGGCGTGG - Intergenic
1053756681 9:41319006-41319028 CTGGGGGCTGTTGTGGGGTGGGG - Intergenic
1053935561 9:43146445-43146467 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1053936895 9:43167769-43167791 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
1054535519 9:66231288-66231310 CTGGGGGCTGTTGTGGGGTGGGG - Intergenic
1054692707 9:68330727-68330749 CTGTGGGCAGAACTGGGGCGTGG + Intronic
1055005232 9:71498392-71498414 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1055364175 9:75526217-75526239 CTGTGTGTTGATTTGGGTTGAGG - Intergenic
1055860259 9:80741817-80741839 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1056030886 9:82552209-82552231 GTGTGGGCAGGGTGGGGGTGGGG - Intergenic
1056555836 9:87686425-87686447 CTGAAGCCAGAGTTGGGGTGGGG + Intronic
1056718707 9:89055244-89055266 CTCTGGGCTTATTTGGGGAGAGG - Intronic
1056967640 9:91178414-91178436 GTGTGGGCAGCACTGGGGTGTGG + Intergenic
1057433886 9:95021675-95021697 CAGGGGGCAGGTTTGGGCTGGGG + Intronic
1058720751 9:107761245-107761267 ATGTGGGCAAGTTTGGAGTGAGG - Intergenic
1059437595 9:114285887-114285909 CTTAGGGCAGATTTGGTGTTAGG - Intronic
1059754654 9:117281544-117281566 CTGTGAGCACATTTGCAGTGAGG - Intronic
1060042550 9:120311803-120311825 TTAGGGGCAGATTTGGGGTGTGG + Intergenic
1060155158 9:121314395-121314417 ATGTGGGGAGGTTGGGGGTGTGG + Intronic
1060264323 9:122101746-122101768 TTGGGGGCAGAATCGGGGTGAGG + Intergenic
1060841152 9:126793974-126793996 CTGTGGCCTGATTGTGGGTGCGG + Intergenic
1060847598 9:126849609-126849631 CTGTGATCAGAGTTGGGGGGTGG + Intergenic
1060896019 9:127218140-127218162 CTGTTGGCAGCTTTTGGGGGTGG + Intronic
1061929331 9:133824388-133824410 CTGAGGGCCGTTTTGGGCTGGGG - Intronic
1062099082 9:134718704-134718726 AGGTGGGCAGCTCTGGGGTGGGG + Intronic
1062310545 9:135933546-135933568 CTGTGGGCTGAGTGGGGGCGTGG - Intronic
1062525566 9:136976802-136976824 CGGGGGGCAGACTTGGGGTGGGG + Intergenic
1203402628 Un_KI270519v1:126854-126876 CTGGGGACAGTTATGGGGTGGGG - Intergenic
1203408621 Un_KI270538v1:71749-71771 CTGGGGACAGTTCTGGGGTGGGG + Intergenic
1203717074 Un_KI270742v1:163219-163241 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1203534139 Un_KI270743v1:15014-15036 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1186107640 X:6225364-6225386 GTGGGGGCAGATTTGGAGAGTGG - Intronic
1187117362 X:16366044-16366066 CTGGGGGCCGTTGTGGGGTGGGG + Intergenic
1187282335 X:17867191-17867213 ATGTGGGCAGAGTGGGGTTGGGG + Intergenic
1187301919 X:18059112-18059134 ATGTGGGCAGAGTGGGGTTGGGG + Intergenic
1187778939 X:22795386-22795408 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1187859110 X:23664817-23664839 CAGTGGGCAGAACTAGGGTGAGG + Intronic
1188143816 X:26585872-26585894 GTGTTGGCAGATTTTGGATGGGG + Intergenic
1188691663 X:33136714-33136736 ATGTTGGCAGATTTGGTGTCTGG - Intronic
1188714447 X:33443842-33443864 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1188988864 X:36792542-36792564 CTGTAGCTATATTTGGGGTGGGG - Intergenic
1189255556 X:39635967-39635989 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1190067076 X:47248811-47248833 ATGTGGGCAAATTTGTGGTTTGG + Intergenic
1190300260 X:49053351-49053373 CTGGGGGACGACTTGGGGTGAGG + Intergenic
1190519135 X:51259454-51259476 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1190788222 X:53674319-53674341 ATGTGTGCATATTTGGGGAGAGG - Intronic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1191214735 X:57922730-57922752 CAGTGGGAAGATCTGGGGTCGGG + Intergenic
1191609108 X:63092407-63092429 CTGGGGACAGATGTGGTGTGGGG - Intergenic
1192136715 X:68608281-68608303 CTGTGGCCTGTTGTGGGGTGGGG + Intergenic
1192224925 X:69221620-69221642 CTGGGGGCAGGATGGGGGTGGGG - Intergenic
1192280212 X:69676982-69677004 CTGGGGCCAGTTGTGGGGTGGGG - Intronic
1192293504 X:69822850-69822872 CTGGGGCCAGTTGTGGGGTGGGG - Intronic
1192337271 X:70232459-70232481 CTGTGAGCAGGGTTGGGGTGTGG - Intergenic
1192659963 X:73031837-73031859 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1192663369 X:73065648-73065670 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1192909913 X:75592340-75592362 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1192933443 X:75833428-75833450 CTGGGGACTGTTTTGGGGTGTGG - Intergenic
1192941535 X:75918045-75918067 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
1192976701 X:76293843-76293865 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1193213798 X:78839192-78839214 CTGTGGGCAAATTGTGCGTGAGG - Intergenic
1193302383 X:79904865-79904887 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1193339165 X:80325413-80325435 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1193393672 X:80959021-80959043 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1193500203 X:82265357-82265379 CTGGGGCCTGTTTTGGGGTGGGG + Intergenic
1193904090 X:87221867-87221889 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1194232075 X:91336666-91336688 CTGTGGACTGTTGTGGGGTGGGG + Intergenic
1194507041 X:94745776-94745798 CTGTGTGCAGGTTGGGGGTTGGG + Intergenic
1195086905 X:101421586-101421608 GTGTGGGCAGGTTTGGTGTCTGG + Intronic
1195255252 X:103083409-103083431 CAGTGGCAAGATTTGGGATGAGG - Exonic
1195499476 X:105578035-105578057 CTGTGGACTGTTGTGGGGTGGGG - Intronic
1195604721 X:106792359-106792381 CTGTGGGTAGGGGTGGGGTGGGG + Intronic
1195661480 X:107383487-107383509 ATGTGGGAAGTGTTGGGGTGGGG + Intergenic
1196269256 X:113692087-113692109 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1196786706 X:119427246-119427268 CTGTGTGGTGATTGGGGGTGGGG - Intronic
1197530159 X:127613320-127613342 CTGGGGGCTGTTGTGGGGTGGGG + Intergenic
1197973388 X:132138584-132138606 CTGGGGACAGTTGTGGGGTGGGG + Intergenic
1198161067 X:134008956-134008978 CTGTGTGGAGAGGTGGGGTGAGG - Intergenic
1198387641 X:136144821-136144843 CTTTGGGCTGGTATGGGGTGGGG + Intergenic
1198423271 X:136489573-136489595 CAGTGGACAGATTTAGGGCGAGG - Intronic
1198484646 X:137074877-137074899 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1198488372 X:137111555-137111577 CTGGGGACAGTTGTGGGGTGGGG - Intergenic
1198544627 X:137678086-137678108 CTGGGGACTGTTTTGGGGTGGGG + Intergenic
1198987372 X:142470873-142470895 ATGTGGTCAGATTTGGTGTGAGG - Intergenic
1199606559 X:149583877-149583899 GTGTGGGCAGATGTTGGTTGGGG - Intronic
1199632564 X:149785491-149785513 GTGTGGGCAGATGTTGGTTGGGG + Intronic
1201244402 Y:11988767-11988789 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1201489701 Y:14526171-14526193 GTGAGGGCAGATTTGGAGAGTGG + Intronic
1201545077 Y:15153145-15153167 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
1201593834 Y:15644865-15644887 CTGGGGACTGTTTTGGGGTGGGG - Intergenic
1201600401 Y:15722475-15722497 CTGCGGACTGTTTTGGGGTGGGG - Intergenic
1201606020 Y:15786341-15786363 CTGTGGACTGTTGTGGGGTGGGG - Intergenic
1201621806 Y:15967416-15967438 CTGGGGACAGTTCTGGGGTGGGG - Intergenic
1202334531 Y:23793425-23793447 CTGGGAACAGTTTTGGGGTGGGG - Intergenic
1202536237 Y:25876634-25876656 CTGGGAACAGTTTTGGGGTGGGG + Intergenic