ID: 969456120

View in Genome Browser
Species Human (GRCh38)
Location 4:7300677-7300699
Sequence GGGCATGGATGCTGGACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969456120_969456125 -8 Left 969456120 4:7300677-7300699 CCCCTGGTCCAGCATCCATGCCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 969456125 4:7300692-7300714 CCATGCCCTTCAACCACCGCAGG No data
969456120_969456130 13 Left 969456120 4:7300677-7300699 CCCCTGGTCCAGCATCCATGCCC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 969456130 4:7300713-7300735 GGCAATGCTGCCATAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969456120 Original CRISPR GGGCATGGATGCTGGACCAG GGG (reversed) Intronic