ID: 969459659

View in Genome Browser
Species Human (GRCh38)
Location 4:7322242-7322264
Sequence CTGCTCCCACTCTCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 1, 2: 5, 3: 43, 4: 434}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969459659_969459669 1 Left 969459659 4:7322242-7322264 CCCAGGCCTGAGAGTGGGAGCAG 0: 1
1: 1
2: 5
3: 43
4: 434
Right 969459669 4:7322266-7322288 GGGGGCGGTGAGGATGAAGGAGG 0: 1
1: 0
2: 6
3: 86
4: 1023
969459659_969459670 11 Left 969459659 4:7322242-7322264 CCCAGGCCTGAGAGTGGGAGCAG 0: 1
1: 1
2: 5
3: 43
4: 434
Right 969459670 4:7322276-7322298 AGGATGAAGGAGGAGCCTCGTGG 0: 1
1: 1
2: 5
3: 23
4: 355
969459659_969459671 14 Left 969459659 4:7322242-7322264 CCCAGGCCTGAGAGTGGGAGCAG 0: 1
1: 1
2: 5
3: 43
4: 434
Right 969459671 4:7322279-7322301 ATGAAGGAGGAGCCTCGTGGTGG 0: 1
1: 0
2: 3
3: 17
4: 221
969459659_969459668 -2 Left 969459659 4:7322242-7322264 CCCAGGCCTGAGAGTGGGAGCAG 0: 1
1: 1
2: 5
3: 43
4: 434
Right 969459668 4:7322263-7322285 AGAGGGGGCGGTGAGGATGAAGG 0: 1
1: 0
2: 3
3: 65
4: 643
969459659_969459667 -9 Left 969459659 4:7322242-7322264 CCCAGGCCTGAGAGTGGGAGCAG 0: 1
1: 1
2: 5
3: 43
4: 434
Right 969459667 4:7322256-7322278 TGGGAGCAGAGGGGGCGGTGAGG 0: 1
1: 0
2: 9
3: 102
4: 913

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969459659 Original CRISPR CTGCTCCCACTCTCAGGCCT GGG (reversed) Intronic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900246914 1:1640602-1640624 CTGCCAGCACTCTTAGGCCTCGG - Intronic
900258136 1:1707734-1707756 CTGCCAGCACTCTTAGGCCTCGG - Intronic
900462985 1:2810233-2810255 CCGCAGCCAGTCTCAGGCCTGGG - Intergenic
900507740 1:3038167-3038189 CTGCTCCCACCTCCTGGCCTCGG - Intergenic
901483005 1:9539247-9539269 CTGCCTCCACGCTCCGGCCTAGG + Intergenic
901490361 1:9593483-9593505 CTCCTGTCACTCTCAGCCCTGGG - Intronic
901500314 1:9648884-9648906 CTGGTCTCACACTCAGGCCTCGG - Intergenic
901562474 1:10083661-10083683 CTGCTGCAGCCCTCAGGCCTTGG - Intronic
901797381 1:11688157-11688179 CTGCCCCCTCTCCCAGGCCCAGG + Intronic
902183521 1:14708019-14708041 CTGCTCAAACTCACAGACCTGGG - Intronic
902672402 1:17983856-17983878 CTGCTTCCTGTCTCTGGCCTTGG - Intergenic
902743378 1:18456190-18456212 CTGTTCCCACTCCCAGCCCCAGG + Intergenic
903354017 1:22735542-22735564 CTGTTCCTGCTCTCAGGCCTGGG - Intronic
904521796 1:31101429-31101451 CGGCTCCTACCCTCAGGCCTGGG + Intergenic
904597249 1:31654658-31654680 CTCCACACACTCACAGGCCTGGG - Intronic
905247863 1:36627209-36627231 CTCCTTCCCCTCCCAGGCCTCGG - Intergenic
905889699 1:41511325-41511347 CCCCTCCCACTTCCAGGCCTCGG - Intronic
905971089 1:42142989-42143011 CTGCACCCACTCCCATGCCTTGG + Intergenic
906069357 1:43006260-43006282 CTGCTCCCCCTCTCTATCCTGGG + Intergenic
906106780 1:43299524-43299546 CTCCTCCCAGCCTCAGGCCCAGG + Intergenic
906238958 1:44229727-44229749 CCGCTCCCGCTTCCAGGCCTTGG - Intronic
907451985 1:54551389-54551411 CTGCTGCCACGCTCGGGGCTGGG + Intronic
907515369 1:54990339-54990361 CTGCTCCCAATCACAGACCAGGG - Intronic
908808853 1:67958620-67958642 CTGCTCCATCTGTCAGGCCAGGG + Intergenic
909713617 1:78680336-78680358 CTGCCCCCACTCACAGTCCAGGG + Intergenic
910795545 1:91094131-91094153 CTGCTCCCACTCTCAGCCCAAGG + Intergenic
912453722 1:109783845-109783867 CTGTGCCCACTCCCAGGCTTGGG - Intergenic
913115841 1:115696136-115696158 CTGCTCCCACTCTGCTGGCTTGG + Exonic
914900707 1:151709690-151709712 CTCCTCCCACCCCCAGGCCCAGG - Intronic
915326437 1:155083328-155083350 CTGTTCCTCCCCTCAGGCCTTGG - Intronic
915979929 1:160413986-160414008 CTGCTCCCTTGCTCAGGCCGGGG + Intronic
918033475 1:180841199-180841221 TTCCTCCCATTCTGAGGCCTAGG - Intronic
920185016 1:204154028-204154050 CTTCTCCCACTCTCACTCCTTGG - Intergenic
924382588 1:243478088-243478110 CTTCTCCCGCCCCCAGGCCTCGG + Intronic
1063602770 10:7497217-7497239 CTGTCTGCACTCTCAGGCCTGGG + Intergenic
1065163952 10:22954992-22955014 GAGCTCCTATTCTCAGGCCTTGG - Intronic
1065807004 10:29403211-29403233 CTCCTCCCACCCTCAACCCTTGG - Intergenic
1065876295 10:30000235-30000257 CACCTTCCACTCACAGGCCTGGG + Intergenic
1067107760 10:43377066-43377088 CAGCTCCCAATCTGAGGCCAGGG + Intergenic
1067262620 10:44707459-44707481 GTGTCCCCACTCTAAGGCCTGGG + Intergenic
1067459337 10:46445897-46445919 CTGGCCCCACACTCAGGACTGGG - Intergenic
1067627857 10:47938733-47938755 CTGGCCCCACACTCAGGACTGGG + Intergenic
1067746961 10:48943249-48943271 TGGGTCCCACCCTCAGGCCTCGG - Intronic
1067763572 10:49069059-49069081 CTGCTCACACTCTCACCCCATGG + Intronic
1068009537 10:51430920-51430942 CTGCTCCCATTCTCTGCCCGAGG - Intronic
1068076091 10:52256734-52256756 ATGGTTGCACTCTCAGGCCTTGG - Intronic
1068120290 10:52777632-52777654 ATGTTCCCAGTTTCAGGCCTGGG - Intergenic
1069469985 10:68679138-68679160 CTGCACTCACACTCCGGCCTGGG + Intronic
1070775993 10:79110104-79110126 ATGCTGCCACCCTCTGGCCTTGG + Intronic
1070874061 10:79784709-79784731 CTGTTCCCTCTCTCAGTCCCTGG + Intergenic
1071253158 10:83841654-83841676 ATGCTCATACTCTCTGGCCTTGG - Intergenic
1071640993 10:87306848-87306870 CTGTTCCCTCTCTCAGTCCCTGG + Intergenic
1071654243 10:87431088-87431110 CTGTTCCCTCTCTCAGTCCCTGG - Intergenic
1072687791 10:97549102-97549124 CTGCCCGCACACTGAGGCCTTGG + Intronic
1072861131 10:99006772-99006794 CTGGTACCAGTCTCAGGCCTGGG + Intronic
1072896687 10:99373325-99373347 CTGCTCACACTCTCTTCCCTTGG + Intronic
1073214953 10:101830970-101830992 ATGCGCACACTCGCAGGCCTGGG + Intronic
1073491182 10:103854712-103854734 CTGCCCCCAGCCCCAGGCCTAGG + Intronic
1075409449 10:122216552-122216574 CTGTGCCCACCCTCAGGTCTGGG - Intronic
1077149356 11:1062562-1062584 CAGCTTCCACTCCCAGGGCTGGG - Intergenic
1077321792 11:1946171-1946193 CTGTTCCCACCTGCAGGCCTGGG + Intergenic
1077461755 11:2714306-2714328 CTGCTGCCTCTCACGGGCCTGGG - Intronic
1078131068 11:8614640-8614662 CTGCTCCCTCTCTCACTCCATGG - Exonic
1078439338 11:11351185-11351207 CAGCTCCCTCTCTCACCCCTTGG - Intronic
1078599290 11:12716141-12716163 CTGCTCCCCCTCCCATCCCTCGG - Intronic
1079244574 11:18743170-18743192 CTGCTCCCCATCCCAGACCTGGG - Intronic
1079296769 11:19241463-19241485 CCGCTGCCCCTCTCAGGCCCGGG + Exonic
1080336728 11:31206245-31206267 CTCCTCCCACTCTCAGCAATGGG - Intronic
1080400535 11:31931236-31931258 CTGCTTCCACTCTCAGCTTTAGG + Intronic
1081621287 11:44620406-44620428 CTGCTCACACCCTCTGCCCTGGG - Intergenic
1085267557 11:75246286-75246308 CTACTCACACCCTCAGACCTGGG + Intergenic
1085521991 11:77144463-77144485 CAGCCCCCACTCTCAGGGCCTGG - Intronic
1085552924 11:77391899-77391921 CTGGTCCCACTTTCAGGTTTGGG - Intronic
1085653424 11:78289868-78289890 CTGTTCCCATGCCCAGGCCTTGG - Intronic
1088210842 11:107454054-107454076 CTGGACCCACCCTCAGGCCTGGG + Intronic
1088841449 11:113630659-113630681 CCACTCACACTCTCAGCCCTGGG - Intergenic
1089384560 11:118059313-118059335 CTGCCCCCACCCCCATGCCTGGG - Intergenic
1090189803 11:124760375-124760397 CGGCTCCCTCACTCTGGCCTCGG - Intronic
1090247512 11:125226947-125226969 TTGCTCTCTCTGTCAGGCCTTGG + Intronic
1090356707 11:126145508-126145530 CTGCACCCACCCTAAGGACTGGG + Intergenic
1090584479 11:128195620-128195642 CTGCTCCCACACTGAGACCCAGG - Intergenic
1202804809 11_KI270721v1_random:1484-1506 CTGTTCCCACCTGCAGGCCTGGG + Intergenic
1091545743 12:1500424-1500446 CTCCTCCCACTGTCCCGCCTGGG + Intergenic
1093172410 12:15874953-15874975 ATGCACCCACACTCAGCCCTTGG - Intronic
1095396228 12:41765428-41765450 CTGCTGCCAACTTCAGGCCTGGG + Intergenic
1095890883 12:47234673-47234695 CTGCTAGCACTCTCATCCCTGGG + Intronic
1096043261 12:48539441-48539463 CTGCCACCACTCTTAAGCCTTGG + Intergenic
1096252376 12:50041361-50041383 CTCCTCACTCTGTCAGGCCTGGG - Intergenic
1096523279 12:52195974-52195996 GTCCTCCCACTCCCAGGACTTGG - Intergenic
1096601712 12:52734459-52734481 CATCTCCCACACTGAGGCCTGGG + Intergenic
1096667007 12:53172631-53172653 CTCCTTCCACTCACAGACCTAGG + Exonic
1096763940 12:53867725-53867747 CTCCTCCCATCCTCAGCCCTGGG - Intergenic
1096770300 12:53931810-53931832 CTTCTCCTACTCCAAGGCCTTGG - Intergenic
1097178956 12:57160015-57160037 CTCCTCCCACCCCAAGGCCTGGG - Intronic
1097289119 12:57899109-57899131 GTGCTCCCACTCCCAGCCCCAGG + Intergenic
1100464059 12:94829626-94829648 CTTCTCCCACCCCCAGTCCTGGG - Intergenic
1101210954 12:102534783-102534805 GTTGTCCCACCCTCAGGCCTAGG - Intergenic
1101591859 12:106131897-106131919 CCCCTCCTACTCTGAGGCCTGGG + Intronic
1101893051 12:108732411-108732433 GTGCTCCGACTTTCAGGCCTGGG - Intergenic
1102221248 12:111196017-111196039 CTGATCCCACTCCCAGCCCCAGG + Intronic
1102846953 12:116195241-116195263 CTGCTGCCAATCTAAGACCTTGG + Intronic
1103880275 12:124160619-124160641 GTGTTCCAACTCTCAGCCCTAGG - Intronic
1103945248 12:124522684-124522706 CTGCTGCCACTTTGAGGTCTTGG - Intronic
1104181847 12:126389344-126389366 TTGCTACCACTCTAAGGACTTGG + Intergenic
1104307968 12:127627025-127627047 ATGCACCTACTCTCAGGCCAAGG - Intergenic
1104675099 12:130707143-130707165 CTCTTCCTGCTCTCAGGCCTGGG - Intronic
1105004093 12:132710552-132710574 CTGCACCCAGCCTCCGGCCTCGG + Intergenic
1106571985 13:30935224-30935246 CTGCTGCCATTCACAGCCCTGGG - Intronic
1106593088 13:31114603-31114625 CTCCTCCTAGTCTCAGTCCTGGG + Intergenic
1107668159 13:42714564-42714586 TTCCTCCCACTTTCAGGCCCTGG + Intergenic
1108363808 13:49691202-49691224 CCGCTCCCACTCTCTGGGATGGG + Intronic
1108531162 13:51328666-51328688 CTCCTGCATCTCTCAGGCCTGGG - Intergenic
1110138821 13:72102077-72102099 CTCCTGCCACCCTTAGGCCTAGG + Intergenic
1111396148 13:87672116-87672138 CTCCTCGCACCCTCCGGCCTGGG - Intergenic
1112236014 13:97637421-97637443 AAGATGCCACTCTCAGGCCTAGG + Intergenic
1113017003 13:105838734-105838756 CTGCTCCCACTGCCAGGTGTGGG - Intergenic
1113204368 13:107898248-107898270 CTGCCCCAATTCTCAGGTCTTGG - Intergenic
1113398793 13:109973098-109973120 CTGCTCCCCCTCCCTGTCCTGGG + Intergenic
1115202910 14:30873451-30873473 CTTCTCCCACTCCTAGTCCTAGG - Intergenic
1115963711 14:38863828-38863850 CTGCTCTCAGTCCCAGGTCTGGG + Intergenic
1116186348 14:41605510-41605532 CTGCTCCCCCTCTCTGCCCCTGG - Intergenic
1117463979 14:55974151-55974173 CTGGTCTCAACCTCAGGCCTGGG + Intergenic
1118436133 14:65772313-65772335 CTGCTCCTCCTCTGTGGCCTGGG + Intergenic
1118547287 14:66905721-66905743 CCGCTCCCTCTCTCATACCTTGG + Intronic
1119634660 14:76264180-76264202 CTGCTGCCACTGTTTGGCCTGGG - Intergenic
1120865772 14:89294120-89294142 CTGTTTCTACTCCCAGGCCTGGG + Intronic
1121269827 14:92630765-92630787 CTACTCACAAACTCAGGCCTGGG - Intronic
1121507987 14:94490940-94490962 CTGCTTCCAGGCTCAGACCTTGG + Intronic
1121815545 14:96925482-96925504 CTGCTCCCACTTTCCAGCCCGGG - Intronic
1122703275 14:103604652-103604674 CAGCTCCCACTCCCAGTCCCTGG + Intronic
1123574891 15:21656538-21656560 CTGCTGCCACCCCCAGGGCTAGG + Intergenic
1123611506 15:22099027-22099049 CTGCTGCCACCCCCAGGGCTAGG + Intergenic
1125752132 15:42036412-42036434 CCGCTCCCACTTTCAGACCCGGG - Intronic
1126380214 15:48038841-48038863 CAGCTTCCAATCTCATGCCTAGG - Intergenic
1128114218 15:65095206-65095228 CTGCTCCCTGTCTATGGCCTTGG + Intronic
1128650602 15:69409958-69409980 CTGCCCCTACTCCCAGGCCTTGG - Intergenic
1129231701 15:74200653-74200675 CTGCTCCCACTTTGAGGGCAGGG + Intronic
1129244532 15:74271464-74271486 CTGCTCCCGCTTTCTGTCCTGGG - Intronic
1129456834 15:75680569-75680591 CAGCTCCCACTCCCACTCCTGGG - Intronic
1129902783 15:79164539-79164561 CTGCTCCCAGGCCCAGGCCTGGG + Intergenic
1130897301 15:88181452-88181474 CTGCTCCCACTCCTGAGCCTGGG + Intronic
1130921323 15:88347539-88347561 CTGCCCCCACCCTCAGCCCATGG + Intergenic
1131065508 15:89432881-89432903 CTGCTCCCTCTCTCTGGCCTAGG + Intergenic
1131437462 15:92434783-92434805 CTGCTCCCTCTCTCAGCCCTTGG + Intronic
1131558976 15:93423093-93423115 GTTCTTCCACTCTCAGGGCTGGG + Intergenic
1131943803 15:97597147-97597169 CTGCTCCAACTCTAAAGCCAGGG + Intergenic
1202983759 15_KI270727v1_random:390782-390804 CTGCTGCCACCCCCAGGGCTAGG + Intergenic
1132582833 16:693407-693429 CTGTAGCCACCCTCAGGCCTGGG - Exonic
1132881317 16:2162907-2162929 CAGGTCCCACTTTCAGGACTTGG - Intronic
1133474236 16:6104571-6104593 CTGTTCCCACCCTCAGCCCCAGG + Intronic
1135150612 16:20002208-20002230 CTCTTCCCACCCTCAGCCCTAGG + Intergenic
1135784360 16:25335392-25335414 ATGCTTCCACCCTCAGGCATTGG - Intergenic
1136366506 16:29811590-29811612 CTGCTCCCAGTCCTAGGGCTCGG - Intronic
1137568472 16:49549252-49549274 CTGTTCCCACCCTCAGTCTTTGG - Intronic
1137610071 16:49811997-49812019 CTGCTCCCTGTCACAGGCCTAGG - Intronic
1137692302 16:50437478-50437500 GTGTTCTCACTCTCTGGCCTAGG + Intergenic
1138394290 16:56692118-56692140 GGCCTGCCACTCTCAGGCCTGGG + Intronic
1138415141 16:56867285-56867307 CAGCTCTGACTCTCAGGCCCTGG + Intronic
1138985725 16:62326189-62326211 CTGCTGCCAGTCTCTGGCCCTGG + Intergenic
1139589457 16:67925562-67925584 CTGCGCCCACCCACAGCCCTTGG + Intronic
1140931443 16:79631931-79631953 CTGCTCCTACCCTAAGGACTAGG + Intergenic
1141100330 16:81193080-81193102 CCTCCCCAACTCTCAGGCCTTGG + Intergenic
1141412556 16:83845399-83845421 CACCCGCCACTCTCAGGCCTGGG + Intergenic
1141739915 16:85884277-85884299 CTGCTCCTCCTCTCAGTCCTGGG + Intergenic
1141883961 16:86879160-86879182 CTGCTCGGCCTCTCGGGCCTCGG - Intergenic
1142672780 17:1494925-1494947 CTGCCCCCACTCTGAGGTCCCGG + Exonic
1143359664 17:6358599-6358621 CTGCTCCCACACCTATGCCTGGG + Intergenic
1143877543 17:10003478-10003500 CTGCTCCCACTCTGAAAGCTTGG - Intronic
1144673308 17:17145247-17145269 CTGTTCTCACTCTCACTCCTTGG + Intronic
1145051020 17:19660819-19660841 CTGCTCCCACTGTCAGCCCCAGG + Intronic
1145305227 17:21670391-21670413 CTGCTTCTACTCCCAGTCCTTGG + Intergenic
1145867342 17:28249789-28249811 CTGATCCTACTCTCAGACCCAGG - Intergenic
1146571130 17:33954236-33954258 CTCCTCCCCATCTCAGGGCTGGG - Intronic
1147158098 17:38555078-38555100 CAGGTGCCACACTCAGGCCTTGG + Intronic
1147260914 17:39209567-39209589 CTTCTTCCACTCCCAGGGCTGGG + Intergenic
1147408740 17:40233704-40233726 AAACTCCCAATCTCAGGCCTCGG - Intronic
1147564293 17:41527289-41527311 CTCCTCCCACTCTCCCGCCCTGG - Intronic
1147632204 17:41939323-41939345 GTGCCCCCACCCTCAGTCCTGGG - Intronic
1148115575 17:45172791-45172813 CTGCCCCCACTCTCCTTCCTGGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148371005 17:47100015-47100037 CAGCTCCCACTTGCAGACCTGGG - Intergenic
1148706026 17:49633359-49633381 ATGCTCCGACTATCAAGCCTCGG + Intronic
1148723291 17:49770484-49770506 CTGCTCCCACCTCCAGTCCTAGG - Intronic
1148766981 17:50045267-50045289 CTGGCCCCACTCCCAGGCCATGG + Intergenic
1151428459 17:74046785-74046807 CTCCTCCCACTCCCAGCCCCTGG + Intergenic
1151620592 17:75242685-75242707 CTCCTCCCACTCTCAGCCACCGG + Intronic
1151665953 17:75545233-75545255 ATTGTCCCACTCCCAGGCCTGGG + Intronic
1152775873 17:82201687-82201709 CTCTTCCCACTCCCTGGCCTGGG + Exonic
1152828179 17:82480494-82480516 CTGCTGCCTCCCTCAGGACTGGG - Intronic
1153051765 18:907506-907528 CTGCTCCCACCCCCAGTCCTGGG + Intronic
1153204719 18:2685612-2685634 TTGCTCCCACTCTTAGCCCCTGG + Intronic
1153838047 18:8981904-8981926 CTGGTCCCCCTCCCAGGCCTAGG - Intergenic
1154344406 18:13530421-13530443 CTGCTCCCTATCTAAAGCCTCGG - Intronic
1156316263 18:35971996-35972018 CTCCTCTCCCTCCCAGGCCTTGG - Intergenic
1156820186 18:41363044-41363066 CTCCTCCCACTCCCAACCCTCGG + Intergenic
1157238037 18:45982344-45982366 CTGTTCCCACTCTCCAGCGTTGG + Intergenic
1158592850 18:58792046-58792068 GTGCTGCCACTCTCCAGCCTGGG + Intergenic
1159670095 18:71212387-71212409 CTGCGCCCGCACTCAGCCCTTGG + Intergenic
1160131799 18:76231818-76231840 CTGCTCACCCTCTGTGGCCTCGG + Intergenic
1160710310 19:548412-548434 CCGCTGCCCCTCACAGGCCTTGG - Intronic
1160718656 19:588287-588309 CTTCTCCCACTGCCAGGCATGGG + Intergenic
1160796557 19:948354-948376 CTGCTGCCTCTGTCAGTCCTGGG + Intronic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1161231314 19:3176471-3176493 CTGCCCCCACCCTGAGGCCAAGG + Intronic
1161316008 19:3618032-3618054 CTGCCCTCCCTCTCAGGCCTTGG - Intronic
1161952899 19:7477530-7477552 CTCCTCCCACTCACAGGCAGGGG - Intronic
1162142811 19:8595074-8595096 CTCCTCACAGTCTCAGCCCTAGG - Intronic
1163577969 19:18121767-18121789 CTGCTCCCACACTCACCCGTTGG - Exonic
1164146802 19:22517620-22517642 CTGCGCCCTCTCTCAAGCCTGGG + Intronic
1165610571 19:37148489-37148511 CTTTTCCCACTCCCAGCCCTTGG - Exonic
1165775423 19:38401803-38401825 CTCCTCTCCCTCTTAGGCCTTGG - Intergenic
1165793634 19:38506455-38506477 CTGCATCCACTCCCAGGCCATGG + Exonic
1166304736 19:41931261-41931283 ATGCTCCCTCTCTGAGTCCTAGG + Intergenic
1166852195 19:45766320-45766342 CATCTCCCTCCCTCAGGCCTAGG - Intronic
1166938814 19:46350768-46350790 CTGCTCACACACTCTGACCTTGG - Intronic
1166963722 19:46515257-46515279 CTTATCCCCCTCTCAGCCCTAGG + Intronic
1168712887 19:58511894-58511916 CTGCTCCTGCTCTGGGGCCTGGG - Exonic
925439506 2:3872190-3872212 CTGGTCCCGGTCTCTGGCCTGGG + Intergenic
925579932 2:5400110-5400132 GTCCTCCTATTCTCAGGCCTTGG - Intergenic
926474180 2:13302057-13302079 CTGTTCCTGCTCTGAGGCCTAGG - Intergenic
926693591 2:15754598-15754620 CACCACCCACTCTCAGGCCATGG - Intergenic
927246313 2:20959575-20959597 CTGGTGCCACTCTCACCCCTAGG - Intergenic
927267157 2:21163353-21163375 CTGCTCCCACTTCCCGTCCTGGG + Intergenic
927847482 2:26479115-26479137 CTGTTCCCATTCTCAGCCCCAGG - Intronic
927975651 2:27336219-27336241 CTGCTCCAGCTCTGGGGCCTTGG - Exonic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
928633074 2:33214249-33214271 TTGTTCCCAGTCTTAGGCCTGGG + Intronic
928681019 2:33702030-33702052 CTGCTACCACTCTCCAGCCTAGG + Intergenic
929209992 2:39345372-39345394 GTGCTACCACACTCTGGCCTGGG + Intronic
929557055 2:42932141-42932163 ATGCTCCCTCACTCAGGCCCCGG + Intergenic
929764103 2:44829957-44829979 CTGGCCCCACTCTGAGGGCTTGG - Intergenic
929882379 2:45848351-45848373 CTGCTGCCACACTCCAGCCTGGG - Intronic
931521878 2:63106586-63106608 CTGCTGCTACTCCCAGGCCAAGG - Intergenic
931920088 2:67005761-67005783 CTCCTACCACCCTCAGGCCTTGG + Intergenic
932667763 2:73710721-73710743 CTCCTCCCACTCTCCACCCTGGG - Intergenic
932848027 2:75154896-75154918 CTGCTCCCTACCTCAGTCCTGGG + Intronic
932863882 2:75321532-75321554 CTGATCCCACCCCAAGGCCTGGG - Intergenic
933480790 2:82854653-82854675 CCTTTCCCACTCTCAGTCCTAGG - Intergenic
933606314 2:84388091-84388113 CTGCCACCATTCTCAGGTCTTGG - Intergenic
935206890 2:100903898-100903920 CTCCTACCACACGCAGGCCTGGG - Intronic
935640333 2:105284088-105284110 CTGCTCCCACTCTAAGACATAGG + Intronic
935708917 2:105880486-105880508 CTGCCCCCACCCTCACCCCTGGG - Intronic
936251119 2:110869196-110869218 GTGCTCTCACTCTCAACCCTGGG + Intronic
937422496 2:121769989-121770011 CTGCTCCTACTGCCAGCCCTAGG + Intergenic
938091751 2:128438972-128438994 CTGCTCCAACTCTGAGCCCCTGG + Intergenic
938241733 2:129747625-129747647 CTGCTCTCAGTCCCAGGTCTGGG - Intergenic
938371497 2:130771439-130771461 TTGCTCCCAACCACAGGCCTTGG - Intergenic
941488217 2:166108787-166108809 CTATTCCCACTCCCAGTCCTAGG - Intronic
942145947 2:173026278-173026300 CTTCTCTCACACTCAGGCCTGGG - Intronic
945930216 2:215847378-215847400 ATGCTCAAAGTCTCAGGCCTAGG - Intergenic
946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG + Intronic
946371806 2:219285749-219285771 CTGCCCTCACCCTCAGGACTAGG + Exonic
947166748 2:227270203-227270225 CTGTTCCCACTCTCAGCCCTAGG - Intronic
947665871 2:231904995-231905017 CTGCACCAACTCTCTGGCTTAGG - Intergenic
947716249 2:232340322-232340344 CTGCTCTCAGTCTCAGAGCTGGG - Intronic
948412211 2:237772707-237772729 CTTCTCCTACTCTCAGCTCTGGG + Intronic
948552907 2:238786532-238786554 CAGCTCCCACTGCCAGGCTTCGG - Intergenic
949027531 2:241773583-241773605 CTGCTCCCAGGCTGAGGCCCCGG + Intergenic
1169076090 20:2760535-2760557 CGGCCCCCACCCCCAGGCCTAGG + Intergenic
1170746359 20:19102683-19102705 CTGGGCTCACTCTCAGGTCTGGG + Intergenic
1171413834 20:24964174-24964196 CAGCTCCCACTCCCAGCCCAGGG + Intronic
1171522745 20:25787864-25787886 CTGCTTCTACTCCCAGTCCTTGG + Intronic
1171530487 20:25849833-25849855 CTGCTTCTACTCCCAGTCCTTGG + Intronic
1171554082 20:26068019-26068041 CTGCTTCTACTCCCAGTCCTTGG - Intergenic
1172623771 20:36335999-36336021 CTGCTCCCACCCTGTGGCCAGGG + Intronic
1173280659 20:41624194-41624216 CCACTCCCACCCCCAGGCCTGGG + Intergenic
1173334501 20:42101748-42101770 GTGTTCCCACGCTCAGGCCAAGG + Intronic
1173555940 20:43965742-43965764 TTGCTCCCACTCTTGGTCCTGGG - Intronic
1174407475 20:50311539-50311561 CTGCACCCTCCCTCAGGCCGTGG + Intergenic
1174524680 20:51161455-51161477 CTTCTCCCACTCTCAGACACTGG + Intergenic
1175402143 20:58707001-58707023 CTTCCCCAGCTCTCAGGCCTGGG - Intronic
1175846788 20:62064028-62064050 CTGCTGCCACTCACAGCCCCAGG + Intronic
1175939882 20:62532989-62533011 CAGCCCCCACCTTCAGGCCTGGG - Intergenic
1179480077 21:41671417-41671439 CTGCTCACAGTTCCAGGCCTGGG - Intergenic
1179780160 21:43694477-43694499 CTTCTCCAGCTCTCAGGCCCAGG - Exonic
1180078145 21:45473553-45473575 CTGCCCGCCCTCCCAGGCCTTGG + Intronic
1180241473 21:46509876-46509898 CTGGTCCTACTCGCAGACCTTGG + Intronic
1180840869 22:18958266-18958288 CTGCGCCCACGCTCAGGGCCAGG - Intergenic
1180948256 22:19708575-19708597 CTGCTCCCACTTGCAGGGCGTGG - Intergenic
1181060621 22:20280508-20280530 CTGCGCCCACGCTCAGGGCCAGG + Intronic
1181366409 22:22380433-22380455 CTGCCCCCTCTCTCAGGTCCAGG - Intergenic
1181521764 22:23452411-23452433 CTGCTCCCTCTCCTGGGCCTAGG - Intergenic
1181546081 22:23603403-23603425 CTACCCCCACTCTCCGCCCTGGG + Intergenic
1181560790 22:23698347-23698369 CTTCTCCCACCCTCAGCCCATGG - Intronic
1181711678 22:24695398-24695420 CTGCTGCCCCTCCCAGGCCCAGG - Intergenic
1181751078 22:24989617-24989639 CTCCTCCCACACTCTTGCCTTGG - Intronic
1182387792 22:29960952-29960974 CTGCTCCCACTCTCTTCCCTAGG + Intronic
1182544967 22:31069767-31069789 CTGCACCCTCGCTCAGGGCTGGG + Intronic
1183493296 22:38128018-38128040 CTGCACACAGTCTCAGGCCTGGG - Intronic
1183860725 22:40668031-40668053 CCACTGCCGCTCTCAGGCCTGGG - Intergenic
1183974336 22:41502089-41502111 CTGACCCCACACTCAAGCCTGGG + Intronic
1184284926 22:43465170-43465192 CTGAGCCGACTCTCAGGCCAGGG + Intronic
1184783540 22:46660850-46660872 CTGCACCTGCTCACAGGCCTTGG + Intronic
1184797296 22:46739542-46739564 CAGCTGCCGCTCTGAGGCCTGGG + Intergenic
1184858320 22:47158579-47158601 CTCCTCCCACACACAGGACTGGG - Intronic
1185161816 22:49234587-49234609 CTGTTCCCTCCCTCAGGCCTGGG + Intergenic
950311549 3:11962906-11962928 CCACTCCCACTCTCAGGTGTGGG - Intergenic
950366677 3:12490755-12490777 CTGCTCCCACTCCCGGCCCAAGG + Intronic
950478336 3:13228045-13228067 CGCCTCCTGCTCTCAGGCCTGGG + Intergenic
950487183 3:13280837-13280859 ATGCTCTCCCTCACAGGCCTTGG + Intergenic
950532233 3:13558840-13558862 CTTATCCCACCCTCAGGGCTTGG + Intronic
950682443 3:14594409-14594431 CTGCTCCCAGCCTCTGCCCTCGG - Intergenic
950962938 3:17124108-17124130 CTCCTCCCTCTCTCAGCCCCAGG - Intergenic
954244933 3:49323720-49323742 CTTTTCCCTCTGTCAGGCCTTGG - Intronic
954417432 3:50400223-50400245 CTGCCCCTACTGTCAGCCCTGGG - Intronic
955983576 3:64550833-64550855 CCTCTGCCACTCTCAGGCCATGG + Intronic
956901790 3:73724224-73724246 AATCTCCCACTCTCAGTCCTAGG + Intergenic
958612838 3:96449626-96449648 CTCATGCCAGTCTCAGGCCTAGG - Intergenic
959860813 3:111212786-111212808 CTGGGCCCAATCTCAGGCCTTGG + Intronic
960552649 3:118993840-118993862 TTGCACCCTCTCTCAGTCCTTGG - Intronic
961735251 3:128997469-128997491 CTGTTCCAACTCCCAGTCCTAGG + Intronic
961786365 3:129349608-129349630 CGCCTCCTGCTCTCAGGCCTGGG - Intergenic
962433856 3:135346704-135346726 CAGTTCCCACTGTGAGGCCTGGG - Intergenic
965608734 3:170522622-170522644 CTCCTCCCACTCCCAGCCCCTGG - Intronic
965912792 3:173801941-173801963 CTACTTCCACTTTCAGGCTTTGG + Intronic
966620326 3:181956249-181956271 ATGTTCCCACTCACAGGCCATGG + Intergenic
967159035 3:186718481-186718503 CAGATACCACTCTCTGGCCTGGG + Intronic
967933218 3:194705752-194705774 CTTCTCCCACCCTGAAGCCTAGG - Intergenic
968428382 4:537779-537801 CGGCTCCCCATCTCAGGCCTTGG - Intronic
968756293 4:2418027-2418049 CTGCTCCTCCTCTCGGGCCGGGG - Intronic
968885596 4:3329459-3329481 CTTCTCCCACTGCCTGGCCTGGG - Intronic
969459659 4:7322242-7322264 CTGCTCCCACTCTCAGGCCTGGG - Intronic
970291666 4:14579497-14579519 CTGCTCTGATTCTCAGGCTTTGG - Intergenic
970291670 4:14579546-14579568 CTGCTCTGATTCTCAGGCTTTGG - Intergenic
970436128 4:16037165-16037187 CTGCCCCTACTCTCATTCCTTGG + Intronic
970473068 4:16395690-16395712 GTGCTGACCCTCTCAGGCCTGGG + Intergenic
971235376 4:24837192-24837214 TTCCTCCCACGCACAGGCCTGGG + Intronic
972104444 4:35463832-35463854 CTGCTCCAACTTTCAGGTCTTGG - Intergenic
972316826 4:37934535-37934557 ATGCATCAACTCTCAGGCCTGGG - Intronic
973614439 4:52664602-52664624 CATCTCCCACACTCAGACCTAGG + Intergenic
975118479 4:70704878-70704900 CTGCTCCCCCGCCCAGGCCCGGG + Intronic
976700627 4:87965996-87966018 CTGCTCCCACTTCCAGCCATGGG - Intergenic
979242038 4:118455782-118455804 CTCCTACCACCCCCAGGCCTAGG + Intergenic
979488523 4:121297009-121297031 CTGCTCCCATGCCCAGCCCTTGG - Intergenic
982000358 4:151015964-151015986 CCTCTCCCACTCTCGGACCTCGG + Intergenic
982106000 4:152012589-152012611 CTGCTACCAGTCTCTGGCCCTGG - Intergenic
982814791 4:159871347-159871369 CCTCCCCCACTTTCAGGCCTTGG - Intergenic
983719785 4:170835868-170835890 CTGCTCCCAACCCCAGCCCTAGG - Intergenic
985998894 5:3614650-3614672 CTGCAGCGACTCTCACGCCTTGG + Intergenic
986494882 5:8331996-8332018 TTGCTCCCCCTCTAAGACCTTGG - Intergenic
986602341 5:9485231-9485253 CTTCTCCCACCCCCAGGCCCTGG + Intronic
986729452 5:10624507-10624529 GTGCACCCACCCTCTGGCCTGGG + Intronic
988373241 5:30400141-30400163 CTGCTTTCAGTCTCAGGCTTTGG + Intergenic
988666779 5:33337685-33337707 CTGCTCACCCTCACAGGCATGGG - Intergenic
989743411 5:44798797-44798819 CTGCTACCAGTCTGTGGCCTGGG - Intergenic
992526388 5:77615034-77615056 CTGCTCCCACTTTCAGCCTCAGG - Intronic
993112287 5:83672873-83672895 CTGCTACAGCTCTCAGGCTTAGG + Intronic
996870987 5:128193068-128193090 CTGCCACCACACTCAAGCCTAGG + Intergenic
998039892 5:138945271-138945293 CTGTTCCCACTGTCCAGCCTTGG + Intergenic
998668683 5:144329010-144329032 CTGCTCTGAGTCTCAAGCCTGGG - Intronic
999500017 5:152137480-152137502 CTTCTCTCACTCCAAGGCCTTGG + Intergenic
1000043044 5:157499521-157499543 GTGGTCCCACTGTCAGGCCAGGG + Intronic
1000221315 5:159217326-159217348 CTGCCCCCACTCTAAGACATTGG - Intergenic
1000244975 5:159441744-159441766 TTGCTCCTTCTCCCAGGCCTGGG - Intergenic
1001674273 5:173499438-173499460 CTGCTCCCTCTCTCTGGTCAGGG - Intergenic
1002202878 5:177540586-177540608 CTGGTCTCGCTCTCAGGCCATGG - Intronic
1002689003 5:181037429-181037451 CTGCTCCCACTCTCAGAGCGGGG + Intergenic
1002780788 6:364193-364215 CTGCCCCTACTCTAAGGACTGGG - Intergenic
1002790390 6:433396-433418 CTCCTCCCACCCTCAGCCCCTGG - Intergenic
1004260360 6:14102431-14102453 CAGCTCTTACTCTCAGGACTGGG + Intergenic
1004920434 6:20370727-20370749 CGGCTCCCAATTTCAGGTCTAGG + Intergenic
1005360340 6:25025173-25025195 CTGCTCCCACCCACAGGTCCTGG + Intronic
1007293276 6:40802682-40802704 CTCCACCCACTCTCTGCCCTTGG - Intergenic
1007624366 6:43235104-43235126 CTGCTCCCACCCCCAGCCTTAGG - Intergenic
1007952226 6:45882507-45882529 CTTTTCCCACTCTGAGGCTTTGG + Intergenic
1008178766 6:48301747-48301769 CTGCTACCACACTCCAGCCTGGG + Intergenic
1010868027 6:81004654-81004676 CGGCTCCCACTCTCTCTCCTGGG + Intergenic
1012048122 6:94304357-94304379 CTGCTCCCATCCTCAGTCCCAGG - Intergenic
1013255526 6:108380693-108380715 CTGCTCTCAGTCTCAGATCTGGG + Intronic
1013480714 6:110550512-110550534 CTGGGCCCACTCTCAGGTTTGGG - Intergenic
1013813592 6:114071317-114071339 TTGCTCTCCCTCCCAGGCCTTGG + Intronic
1013916651 6:115347466-115347488 CTGCACCTACTCACAGCCCTTGG + Intergenic
1014322110 6:119942873-119942895 CTGCTCTCAGTCCCAGGTCTGGG + Intergenic
1018383940 6:163285615-163285637 CTGCTCCAGCTCTCTGGGCTGGG - Intronic
1018805709 6:167258141-167258163 CTGCTCCCCCTCTGAGGGTTGGG - Intergenic
1018903676 6:168063417-168063439 CTGATCCCACTCTTAGCCATGGG + Intronic
1018903694 6:168063467-168063489 CTGGTCCCACTCTTAGCCATGGG + Intronic
1018990038 6:168667590-168667612 CAGCTGCCACCCTCAGGCCTGGG + Exonic
1019330481 7:458358-458380 CTGCCCCCACTGTCTGGGCTTGG - Intergenic
1019589575 7:1824070-1824092 CTGCTCCCTCTCCTGGGCCTAGG + Intronic
1019628752 7:2035352-2035374 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628764 7:2035407-2035429 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628776 7:2035462-2035484 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628788 7:2035517-2035539 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628800 7:2035572-2035594 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628812 7:2035627-2035649 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628825 7:2035682-2035704 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628837 7:2035737-2035759 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628849 7:2035792-2035814 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628861 7:2035847-2035869 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628873 7:2035902-2035924 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628885 7:2035957-2035979 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628897 7:2036012-2036034 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628909 7:2036067-2036089 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628921 7:2036122-2036144 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628934 7:2036177-2036199 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628946 7:2036232-2036254 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019628958 7:2036287-2036309 GTGCTCCCGCGCTCATGCCTGGG - Intronic
1019929891 7:4216358-4216380 CTGCTCCCACTCTCACCCGGAGG + Intronic
1021653654 7:22854365-22854387 CTGCCCCCACGCCGAGGCCTCGG + Intergenic
1022108078 7:27210938-27210960 CTCCTGCCTCTGTCAGGCCTGGG + Intergenic
1022620945 7:31984123-31984145 CTGCTACCAGTCTGTGGCCTTGG - Intronic
1023688346 7:42760262-42760284 CAGCTCCCACTCTTAGGACATGG - Intergenic
1023750260 7:43365326-43365348 CCCCACCCACTCTGAGGCCTGGG + Intronic
1023889380 7:44381600-44381622 CTGCTGCCTCTCTCAGTCCTAGG - Exonic
1024229667 7:47354539-47354561 CTGCTCCCAGCCTGAGGCCCAGG + Intronic
1025283224 7:57643065-57643087 CTGCTTCTACTCCCAGTCCTTGG + Intergenic
1026433380 7:70370336-70370358 CTGCCCCAGCTCTCAGCCCTAGG + Intronic
1027546954 7:79539323-79539345 TTTCTCCCACCCCCAGGCCTGGG - Intergenic
1028280379 7:88918746-88918768 CCAATCCCACTCTTAGGCCTTGG - Intronic
1028304437 7:89246010-89246032 CTGCTCTCGGTCTCAGGTCTGGG - Intronic
1028488569 7:91386367-91386389 CTGCTCCTTCTCTGAGGCATGGG - Intergenic
1029473075 7:100766769-100766791 CTGCTGCCCCTCCCAGGCCCTGG - Intronic
1029489537 7:100862806-100862828 CTGCTGCGAATCTCCGGCCTCGG + Exonic
1029692037 7:102188947-102188969 CTGCTCCCTCTCAGGGGCCTAGG - Intronic
1030074100 7:105721668-105721690 CTGGTCCTCCTCTCAGGTCTAGG - Intronic
1030148780 7:106382255-106382277 CTCCTCCTCCTCCCAGGCCTGGG - Intergenic
1031507991 7:122610537-122610559 CTGCTCCCACTCTCAGTTCCAGG - Intronic
1031977364 7:128102564-128102586 CTGCCTCCAAACTCAGGCCTTGG - Intergenic
1032062471 7:128736572-128736594 CTGCTCTCACTCGATGGCCTCGG + Intergenic
1033351981 7:140569387-140569409 CTGCTCCCACAGTCAGGCCAGGG + Intronic
1033354609 7:140589482-140589504 TTTCTCCCACTCTCAGGGCCAGG + Intronic
1034292834 7:149946191-149946213 GTGCAGCCGCTCTCAGGCCTGGG + Intergenic
1034431139 7:151041720-151041742 CTCCTCCCACTCCCACTCCTGGG + Intronic
1034813234 7:154150681-154150703 GTGCAGCCGCTCTCAGGCCTGGG - Intronic
1035297816 7:157877003-157877025 CTGGTGCCACACTCAGGCCTGGG - Intronic
1035861980 8:3039062-3039084 TTGCTCCCACTCTGCTGCCTGGG - Intronic
1037589919 8:20303869-20303891 CGGCTCCCACTCACTGGCCGAGG + Exonic
1038429274 8:27486621-27486643 CTGCTCCCACTGTAAGGGCTGGG + Intergenic
1038538536 8:28372270-28372292 CTGTTTCCTCTCTCAGACCTGGG - Intronic
1039791941 8:40883178-40883200 CAGTTCCCACCCTCAGTCCTGGG + Intronic
1040998934 8:53430528-53430550 CTTCTCCCATTCTCAGGCTTGGG + Intergenic
1041573070 8:59359560-59359582 CTGCTCCCAATATCATGGCTTGG - Intergenic
1042573315 8:70191112-70191134 CTTCTCCCACTCTCACTCCAAGG + Intronic
1042701932 8:71625098-71625120 ATGTTCTCACTCCCAGGCCTAGG - Intergenic
1044525241 8:93243563-93243585 CTGTTCCCACTCCCAGACCTAGG - Intergenic
1045109610 8:98927804-98927826 CAGCTCCCACTCTGTGGCCTAGG - Intronic
1046280973 8:112031488-112031510 CTGCTCCAGCTCTCCTGCCTAGG + Intergenic
1046858121 8:119058420-119058442 CTGCTCCCACTCTCAGCCCCAGG + Intronic
1047466007 8:125115057-125115079 ATGCTCCAACTCTCAGAGCTTGG + Intronic
1047784632 8:128141994-128142016 CTGTTCCATCTATCAGGCCTCGG - Intergenic
1049662031 8:143823796-143823818 CTGCACCCACTCTGGAGCCTGGG + Intronic
1049973793 9:842815-842837 CTGATCCCGCTCTCAGGGCAGGG + Intronic
1050377225 9:4985461-4985483 CAGCTCCCACTCACATCCCTCGG - Exonic
1051284438 9:15481639-15481661 CTGCTACCACACTCCAGCCTGGG + Intronic
1052785078 9:32820727-32820749 CAGCTCCCACACTCAACCCTCGG + Intergenic
1052786165 9:32830614-32830636 CTGCTCACACCTTCAGGCCACGG - Intergenic
1053403350 9:37848553-37848575 CTGTTCCCACTCTCAGCTCCAGG - Intronic
1054710041 9:68502157-68502179 CTGATCCCACTCTGTGTCCTTGG + Intronic
1056467723 9:86874589-86874611 CTGCTCCCACCCTCAACTCTAGG + Intergenic
1057352545 9:94311690-94311712 CCACTCCCACTCCCAGCCCTTGG - Intergenic
1057564102 9:96153155-96153177 GTGCTGCCACTCTCTAGCCTTGG - Intergenic
1059534761 9:115070355-115070377 CTGCTCCCACCCTCGGGCTTTGG - Intronic
1059665682 9:116444527-116444549 TTGCTCCCACTCGCAGGCTCAGG + Intronic
1059679057 9:116568673-116568695 CTGGTCCCTCTCTGAGGCCCAGG + Intronic
1061268902 9:129525154-129525176 CTGCTCCCACCGTCTGGCCCAGG - Intergenic
1061792977 9:133068251-133068273 GAGCTCCCTCTCTCAGGGCTGGG - Intronic
1061795581 9:133084035-133084057 GAGCTCCCTCTCTCAGGGCTGGG - Intronic
1062284916 9:135768577-135768599 CTCCACCCACGCTCAGGCCCTGG + Intronic
1062466238 9:136682858-136682880 CTGCTCCCACACTCAGGCTCTGG + Intronic
1062497006 9:136836642-136836664 CTGACCCAACTCTCAGGCCCAGG - Intronic
1062551495 9:137089538-137089560 CTGCTCCCTCTCCCAGCCCTGGG - Intronic
1062561409 9:137143761-137143783 CTGCTCCCTCTTTGTGGCCTGGG - Intronic
1062684253 9:137802080-137802102 CTGCTGCCACTCTCAGGCTGGGG - Intronic
1186300635 X:8196507-8196529 CTGCTTCCACACTCAGTGCTAGG - Intergenic
1186309808 X:8305477-8305499 CTGGCCTCACTCTCAGTCCTGGG - Intergenic
1186756355 X:12675607-12675629 CTGTTGCCACACTCAGTCCTAGG + Intronic
1187400365 X:18954254-18954276 CTGCTCCAGCTCGTAGGCCTTGG + Exonic
1189444351 X:41066924-41066946 CTGCTGCCACTCTAAGGGCTTGG - Intergenic
1189591560 X:42517871-42517893 CAGCTGCCACCCTCAGGCCCTGG + Intergenic
1190713706 X:53087334-53087356 CCACTCCCACCCTCAGGGCTGGG - Intronic
1194157044 X:90404202-90404224 CTGCTCTCAGTCCCAGGTCTGGG - Intergenic
1195840586 X:109172187-109172209 GTGCTCCCACTTCCAGCCCTGGG + Intergenic
1198821477 X:140652684-140652706 CTGCTCCCATACTTAGGCATGGG - Intergenic
1198962823 X:142200936-142200958 CTGCTCCTATTCTGAGCCCTAGG - Intergenic
1199642972 X:149881561-149881583 CTGCCCCTACTGTCAGCCCTGGG + Intronic
1199643118 X:149882155-149882177 CTGCTCCCACTCTCAGGTCTGGG + Intronic
1199947529 X:152680650-152680672 CTGCCCCTACTGTCAGTCCTGGG + Intergenic
1199962150 X:152787804-152787826 CTGCCCCTACTGTCAGTCCTGGG - Intergenic
1200123014 X:153800179-153800201 CTCTTCCCACCCCCAGGCCTTGG + Intergenic
1200926947 Y:8663219-8663241 CTGCTCACACTCTATGCCCTAGG - Intergenic
1201429226 Y:13888147-13888169 ATGCGCCCACACTCAGCCCTTGG - Intergenic