ID: 969460246

View in Genome Browser
Species Human (GRCh38)
Location 4:7325169-7325191
Sequence GGTGCAGGGCACTGGGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 544}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969460238_969460246 -4 Left 969460238 4:7325150-7325172 CCCCATCTGCAGATGAGGAGGTG 0: 1
1: 0
2: 1
3: 42
4: 365
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460227_969460246 27 Left 969460227 4:7325119-7325141 CCCAGGCCCCCTTGGGTGGGGCG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460226_969460246 28 Left 969460226 4:7325118-7325140 CCCCAGGCCCCCTTGGGTGGGGC 0: 1
1: 0
2: 4
3: 25
4: 280
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460239_969460246 -5 Left 969460239 4:7325151-7325173 CCCATCTGCAGATGAGGAGGTGC 0: 1
1: 0
2: 0
3: 22
4: 206
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460235_969460246 18 Left 969460235 4:7325128-7325150 CCTTGGGTGGGGCGGGTGTTGGC 0: 1
1: 1
2: 3
3: 17
4: 241
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460228_969460246 26 Left 969460228 4:7325120-7325142 CCAGGCCCCCTTGGGTGGGGCGG 0: 1
1: 0
2: 1
3: 30
4: 271
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460233_969460246 19 Left 969460233 4:7325127-7325149 CCCTTGGGTGGGGCGGGTGTTGG 0: 1
1: 0
2: 0
3: 31
4: 202
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460240_969460246 -6 Left 969460240 4:7325152-7325174 CCATCTGCAGATGAGGAGGTGCA 0: 1
1: 0
2: 1
3: 20
4: 264
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460232_969460246 20 Left 969460232 4:7325126-7325148 CCCCTTGGGTGGGGCGGGTGTTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544
969460231_969460246 21 Left 969460231 4:7325125-7325147 CCCCCTTGGGTGGGGCGGGTGTT 0: 1
1: 0
2: 3
3: 225
4: 375
Right 969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG 0: 1
1: 0
2: 5
3: 53
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969460246 Original CRISPR GGTGCAGGGCACTGGGGAGT AGG Intronic
900001753 1:18324-18346 GGTGCAGGCCATTGGAGAGAAGG - Intergenic
900021473 1:188847-188869 GGTGCAGGCCATTGGAGAGAAGG - Intergenic
900464890 1:2820767-2820789 GGTCCAGGGCATTGGGGATCTGG + Intergenic
900599925 1:3498590-3498612 GGGGCAGCGCCCTGGGGTGTAGG - Intronic
900656260 1:3759632-3759654 GGTGCAGGGCACAGAGGTGTTGG + Intronic
900992428 1:6104173-6104195 GGGGCAGGGTCCGGGGGAGTGGG + Exonic
901166397 1:7224772-7224794 GGAGCAGGGCCCTGGGGAGCGGG - Intronic
901192389 1:7420305-7420327 GGAGCAGGGCACTGGGCAGCAGG - Intronic
901639331 1:10685572-10685594 GGAGCATGGCACTGGAGAGAAGG + Intronic
902060127 1:13634992-13635014 GGTGCAAAGCACTGGGGAACAGG - Intergenic
902285517 1:15405953-15405975 TGTGCTGGGCACTGGGCACTGGG - Intergenic
902601570 1:17543185-17543207 GGTCCTGGGCAGTGGTGAGTTGG + Intronic
902659656 1:17892247-17892269 GGTGCAGGACGCTGAGAAGTGGG - Intergenic
902700575 1:18169297-18169319 AGAGCAGGGAACTGGGAAGTGGG + Intronic
902762279 1:18590014-18590036 GGAGGAGGGCTCTGGGGAGCTGG - Intergenic
902763770 1:18601382-18601404 GGTGATGGAAACTGGGGAGTGGG - Intergenic
902925602 1:19693893-19693915 GGTGGGGGGGACTCGGGAGTGGG + Intronic
902943278 1:19815496-19815518 GGTTCAGGGACCTGGGAAGTGGG - Intergenic
903010115 1:20323808-20323830 GGAGCAGGGCACAGGGAAGAGGG + Intronic
903042210 1:20539800-20539822 TGTCCAGGCCACTGTGGAGTTGG + Intergenic
903108151 1:21103277-21103299 GGTGTAGGGGACTGGGTAGATGG - Intronic
903303967 1:22399759-22399781 GGTGCTAGGCACTGGGGAAACGG + Intergenic
903317065 1:22516354-22516376 AGAGCAGAGCAGTGGGGAGTTGG + Intronic
903353258 1:22730813-22730835 GGTGCAGGGCTTTGAGGAGGTGG + Intronic
903371117 1:22836839-22836861 TGTGCTGGGCACTGGGGAAACGG + Intronic
903740659 1:25556598-25556620 GGTGAAGGGCATTGGTGAGCAGG + Intronic
904401847 1:30262102-30262124 GATGATGGGCACTGGGGAGGGGG - Intergenic
905731045 1:40299780-40299802 AGTGGAGGGCAGTGGGGAGGAGG + Intergenic
906952320 1:50344994-50345016 GGAGGAGGGACCTGGGGAGTAGG + Intergenic
907274726 1:53310844-53310866 TGTGATGGGCACTGGGGGGTTGG + Intronic
907297845 1:53466881-53466903 GGGCCAGGGCTCTGAGGAGTGGG + Exonic
907451765 1:54549924-54549946 GGGGCAAGGCACTGGGGAAGAGG + Intronic
908094329 1:60721365-60721387 TGTGCAGGGCAGTGGGGACCTGG - Intergenic
910368282 1:86489224-86489246 GCTCCAGTGAACTGGGGAGTGGG + Intronic
910427998 1:87134711-87134733 GGGGCAGGGCTCTGTGCAGTTGG - Intronic
911121771 1:94303392-94303414 GGTGCTAGGGGCTGGGGAGTGGG + Intergenic
912449645 1:109761129-109761151 GGAGCAGTGCCCTGGGGACTCGG + Intronic
912571834 1:110630456-110630478 TGTGCTGGGCACTGGGGACACGG - Intronic
912795380 1:112689913-112689935 GCTGCTGGGACCTGGGGAGTCGG + Exonic
912948864 1:114106815-114106837 GCTGCAGGGCAAAGGGGACTTGG - Intronic
913347693 1:117824911-117824933 GCTCCAAGGCACTAGGGAGTGGG + Intergenic
913480190 1:119280592-119280614 GGTACAGGGCCCCTGGGAGTTGG - Intergenic
914429214 1:147604692-147604714 GCTGCAGAGCACTGGGGAATGGG + Intronic
914753945 1:150552720-150552742 GAGGCAAGGAACTGGGGAGTTGG - Intronic
915243646 1:154541478-154541500 GATGCAGGGCAGTGGGAAGGGGG + Intronic
916075918 1:161199962-161199984 GGTTTAGGGCAGTTGGGAGTGGG - Intronic
916992213 1:170256194-170256216 GGTGGGGGGCAGTGGGGAGGTGG + Intergenic
917929975 1:179816430-179816452 GGAGCAAGGCACTAGGAAGTGGG - Intergenic
918018929 1:180665434-180665456 GGTCCAGGGCCTTGGGGATTGGG + Intronic
918423508 1:184386861-184386883 GGCGCAGCGCGCTGGGGAGCGGG - Intergenic
919649180 1:200128684-200128706 GGGGCAGGGCAGGGTGGAGTGGG + Intronic
919785318 1:201254812-201254834 GGGGCAGGGAACAGGTGAGTGGG + Intergenic
920389481 1:205590213-205590235 GGAGCAGGGCACTGCGGACATGG + Intronic
922339652 1:224645222-224645244 AGAGCAGGGCAGTGGGGAGGTGG - Intronic
922724957 1:227918373-227918395 GGAGGAGGGCCCTGGGGAGAAGG - Intergenic
923032368 1:230259609-230259631 GGAGCTGGGGACTAGGGAGTGGG + Intronic
923503280 1:234584011-234584033 GGTCCCGGGCACTCGGGGGTGGG + Intergenic
923779435 1:237009112-237009134 GGGGCAGGGGGCTGTGGAGTGGG - Intergenic
923965590 1:239135106-239135128 GGTTTGGGGCACTGGTGAGTAGG - Intergenic
924078668 1:240369129-240369151 GGTGGAGGGAAGTGGGGAGATGG - Intronic
924115000 1:240736395-240736417 GGTGCAGAGGGCTGGAGAGTGGG + Intergenic
924594633 1:245434640-245434662 GGGGCAGGCCACTTGGGAGCAGG + Intronic
1062908398 10:1195304-1195326 GGTGCAGTCCCATGGGGAGTGGG + Intronic
1063160853 10:3417001-3417023 GGTGCAGGGCACAGAGGTGGGGG + Intergenic
1064270031 10:13856614-13856636 GGTCCAGGGCGCGGGGGTGTGGG + Intronic
1064677579 10:17777186-17777208 GGTGGAGGCCACTAGGAAGTTGG + Intronic
1066034368 10:31467331-31467353 GATGCAGGGCACTCGGGGGTGGG - Intronic
1066653493 10:37680402-37680424 GGAGCACAGGACTGGGGAGTAGG - Intergenic
1067456420 10:46422458-46422480 GGTGCACTGCTCTGTGGAGTGGG - Intergenic
1067630780 10:47962181-47962203 GGTGCACTGCTCTGTGGAGTGGG + Intergenic
1067804639 10:49384444-49384466 GGTGCAGGGCCCTGTGGAGGTGG - Intronic
1068560905 10:58513214-58513236 GGAGCCGGGCACTGGGGAGTCGG - Exonic
1069068004 10:63965351-63965373 GATGCTGGGCACTGTGGAGATGG + Intergenic
1069535601 10:69250414-69250436 CATGCAGGGCACTGGTGAGGAGG + Exonic
1069553955 10:69384460-69384482 CATGCAGGGCACTGGGGAAGAGG + Exonic
1069607573 10:69749434-69749456 GGTGCAGGAGACGAGGGAGTGGG + Intergenic
1069946490 10:71989731-71989753 GGTTGAGGGAACTGGGGAATGGG - Intronic
1070555656 10:77525824-77525846 GGTGCAAGACACTGTGGAGAAGG - Intronic
1070675476 10:78408815-78408837 TGTGCAGGGCTCTGGGGCATTGG - Intergenic
1070803920 10:79259391-79259413 GTTGAAGGGTTCTGGGGAGTTGG - Intronic
1070877162 10:79825704-79825726 GGCCCGGGGCGCTGGGGAGTTGG + Intergenic
1070986658 10:80695446-80695468 GTTGCAGGGCTCTGGGCAGGTGG - Intergenic
1071414564 10:85428958-85428980 TGTGCAGAGCACTGGGGATAAGG + Intergenic
1071502386 10:86213079-86213101 GCTGCAGGTCTCTGGGAAGTTGG - Intronic
1071567858 10:86680844-86680866 TGGGCAGGGCAGTGGGGAGAGGG + Intronic
1071643658 10:87341748-87341770 GGTCCGGGGCGCTGGGGATTTGG + Intergenic
1071819514 10:89265205-89265227 GGTGCAGGGGGTTGGGGAGTGGG + Intronic
1072719188 10:97770526-97770548 GGTTCAGGGGACTGAGGGGTGGG + Intronic
1073438473 10:103536916-103536938 GGTTGAGGGCACTGGGAAATGGG - Intronic
1073441581 10:103555563-103555585 GGTGGTGGGCACTGGGGTGGGGG + Intronic
1074181339 10:111067228-111067250 GTTGCCGGGAACTGGGGAGTAGG + Intergenic
1074643307 10:115414232-115414254 GGTGCAGGGCAAGGTGGAGGAGG - Intronic
1074721902 10:116271707-116271729 GGTGCAGGGCCCTGGGCTGGAGG + Intronic
1075083707 10:119400376-119400398 GGTGCAGTGCAGTGGGCATTTGG + Intronic
1075136601 10:119791991-119792013 GAGGCAGAGCACTGGGGAGAGGG + Exonic
1075261897 10:120970362-120970384 GGACCAAGGCACTGGTGAGTGGG + Intergenic
1075279931 10:121130453-121130475 AGCACAGGGCACTGGGGAGCTGG + Intergenic
1075451824 10:122557042-122557064 GGTGTGGGGCAGTGGGGGGTGGG + Intergenic
1075479106 10:122764294-122764316 GGGGAAGGGGACTGGGGACTGGG - Intergenic
1075844473 10:125534338-125534360 CCTGCAGGGCACTGGGCAGGTGG + Intergenic
1076365421 10:129918641-129918663 GGGGCAGGGAGCTGGGGAGGGGG - Intronic
1076510717 10:131012069-131012091 GATGCAGGGAACTGGGGAGCTGG - Intergenic
1076534882 10:131170520-131170542 ATTGAAGGGCACTGGGGAGCTGG - Intronic
1076545784 10:131245002-131245024 TGTGCTGGGCACAGGGGAGTGGG + Intronic
1076853078 10:133102635-133102657 GCTGCTGGGCTCTGGGGGGTGGG + Intronic
1077002027 11:328260-328282 GGGGCAGGCCTCTGGGCAGTGGG + Intergenic
1077080037 11:721104-721126 GGCGCCGGGCCCTGGGGAGGAGG - Exonic
1077084106 11:739544-739566 GGAGGAGGGAAATGGGGAGTCGG - Intergenic
1077177178 11:1196235-1196257 GTGGCGGGGCACTGGGGTGTGGG + Intronic
1077221024 11:1416427-1416449 GGTGACGGGCACTGGGAAGGGGG - Intronic
1077267866 11:1661078-1661100 GGGACAGGGCCGTGGGGAGTGGG - Intergenic
1077267902 11:1661178-1661200 GGGACAGGGCCGTGGGGAGTGGG - Intergenic
1077267910 11:1661198-1661220 GGGACAGGGCCGTGGGGAGTGGG - Intergenic
1077267918 11:1661218-1661240 GGGACAGGGCCGTGGGGAGTGGG - Intergenic
1077289462 11:1782252-1782274 TGTCCAGGGCACAGGGGAGGAGG - Intergenic
1077353792 11:2105330-2105352 GGTGCAGAGCTCTGTGGAGAAGG - Intergenic
1077356790 11:2122417-2122439 AGGGCACGGCACTGGGGAGAGGG + Intergenic
1077399859 11:2349563-2349585 TGTGCAGGGCACTGGGCCCTGGG - Intergenic
1077460241 11:2705466-2705488 GGTGCCAGGCACGGGGGGGTGGG + Intronic
1078348853 11:10575980-10576002 GGAGCGGGGCACGGGGGAGGAGG - Exonic
1079099771 11:17533912-17533934 TGTGCAGGGGCCTGGGGAGGGGG - Intronic
1079111882 11:17609809-17609831 GGTTCAGGGCTGTGGTGAGTGGG - Exonic
1079289414 11:19173826-19173848 GGGGCAGGGCACAATGGAGTTGG + Intronic
1079299210 11:19262518-19262540 GGAGCTGGGCACTGGGGTCTTGG - Intergenic
1080272580 11:30466571-30466593 GGAGCAGGGCAATGAGGAATGGG + Intronic
1081668271 11:44929208-44929230 GGTGCTGGGCAGTGGTGGGTGGG - Exonic
1081831668 11:46120550-46120572 GGTGGAGGGCAGAGGGGAGGGGG + Intronic
1082641973 11:55673058-55673080 AGTGCAGGGGCCTTGGGAGTTGG - Intergenic
1083334421 11:61914430-61914452 GGTGCTGGACACTTGGGACTTGG - Intronic
1083777418 11:64900961-64900983 AGTGCTGGGCACTGGGAAATGGG + Exonic
1084393046 11:68891070-68891092 GCGGCAGGGCCCAGGGGAGTGGG - Intergenic
1084958502 11:72703885-72703907 GGTGCAGGAGACTGAGGAATTGG + Intronic
1085063046 11:73466099-73466121 GCTGCAGGGAACAGAGGAGTTGG - Intronic
1085103546 11:73822269-73822291 GGTGCAGGGTGCAGGGGAATAGG - Intronic
1085369930 11:75992564-75992586 GGTGATCGGCACTGGGGAGTGGG + Intronic
1086128297 11:83372826-83372848 GGTGTAGGGCACTAGAGAGGAGG - Intergenic
1086989949 11:93291905-93291927 GGAGCAGGGCAGTGGTCAGTGGG + Intergenic
1087008866 11:93494953-93494975 GGTGGAGGGCACGGTGGGGTGGG - Intronic
1088693754 11:112349087-112349109 GATGCAGTGCAGTGGGGAGTGGG + Intergenic
1088795675 11:113264994-113265016 ACTACAGGGCACAGGGGAGTGGG - Intronic
1088867963 11:113867124-113867146 GGTGGAGGGCATGGGGGAATAGG + Intronic
1089207695 11:116778111-116778133 TGTGCAAGGAAATGGGGAGTAGG - Exonic
1089269493 11:117291856-117291878 GATGCTGGGCTCTGGGCAGTAGG + Intronic
1089378663 11:118012539-118012561 TGGGCTGGGCACGGGGGAGTGGG - Intergenic
1089948670 11:122505369-122505391 GGTACAGACCACTGGTGAGTGGG + Intergenic
1090215456 11:124958686-124958708 TGTGGAAGGTACTGGGGAGTGGG + Intronic
1091330752 11:134729331-134729353 GGTGCAGAGGACTGAGGAGCAGG + Intergenic
1091374831 12:18429-18451 GGTGCAGGCCATTGGAGAGAAGG - Intergenic
1091456246 12:610279-610301 GGTGCTGGGCACTGGGGACTGGG - Intronic
1091727044 12:2853648-2853670 GGACCAAAGCACTGGGGAGTTGG - Intronic
1091764510 12:3110049-3110071 GGGGCAGAGATCTGGGGAGTGGG - Intronic
1091911454 12:4233699-4233721 GGTGAGGGGCACTGGGTAGGTGG - Intergenic
1092984456 12:13832001-13832023 GGTGAAGGGCAGTGGGGGGCAGG + Intronic
1093453663 12:19342912-19342934 GTGGCAGGGCATTGGGGAATGGG - Intronic
1094187917 12:27664775-27664797 GGTGGTGGGCAGTGGGGAGAGGG + Intronic
1094818916 12:34210088-34210110 GGACCAGGGCACTGTGGTGTGGG + Intergenic
1095454030 12:42363637-42363659 GGGGCAGGGCAGTGGGGAGTGGG - Intronic
1095942067 12:47733824-47733846 TGTGCAGGGCTCAGGGGAGCTGG + Intergenic
1096541863 12:52312458-52312480 GGTGGGGGGCAATGGGGAATAGG + Intergenic
1096601966 12:52735916-52735938 GGGGCAGGGCACAGGGGTGCTGG - Intergenic
1096601975 12:52735938-52735960 GGGGCAGGGCACAGGGGTGCTGG - Intergenic
1096623632 12:52879778-52879800 GGCGGAGGGCACTGAGGAGCAGG - Intergenic
1097245969 12:57607733-57607755 GGTCCAGGGCACTGAGTAGGAGG - Intronic
1097708918 12:62897275-62897297 GGGGGAGGGCACAAGGGAGTAGG - Intronic
1098892704 12:76025785-76025807 GCTGCAGAGCAGTGGAGAGTAGG + Exonic
1099390938 12:82078034-82078056 GGTACAGGGCAGTGGGGTCTGGG + Intergenic
1101017724 12:100519331-100519353 GGGATTGGGCACTGGGGAGTGGG + Intronic
1101811568 12:108112312-108112334 TGTGCAGGGCTCTGGGGACCTGG - Intergenic
1102193872 12:111010241-111010263 GCTGCAGGGTGGTGGGGAGTAGG + Intergenic
1102581294 12:113889962-113889984 GGAGCAGGGAGCTGGGGAGCTGG - Intronic
1102820173 12:115901874-115901896 GGTGCTGAGTCCTGGGGAGTCGG + Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103415842 12:120741092-120741114 GGTCCAGGGCCCCGGGGAATAGG + Intergenic
1103680502 12:122690127-122690149 GGTGCAGGGCACGGGTGGCTTGG - Intergenic
1103921676 12:124402574-124402596 GGGGGAGGGCAGAGGGGAGTGGG + Intronic
1103995123 12:124824677-124824699 GGGTCAGGCCACTGGGGAGTCGG + Intronic
1104232750 12:126900895-126900917 GGTGCCTGGAACTGGGGAGGGGG + Intergenic
1104512815 12:129396588-129396610 GATGCAGGGAACTGGGGCTTTGG + Intronic
1104834989 12:131783861-131783883 GGTGAAGGAGACTGGGGATTTGG + Intronic
1107833954 13:44398687-44398709 GGGGCTGGGGGCTGGGGAGTGGG - Intergenic
1108668980 13:52662536-52662558 TGTTCTAGGCACTGGGGAGTCGG - Intronic
1112120089 13:96400550-96400572 GTTGATGGGCACTGGGGAGTTGG + Intronic
1112440616 13:99422154-99422176 TGTGCTGGCCACTGGGGAGGGGG + Intergenic
1113050199 13:106202765-106202787 GGAGCAGGGCTGTGGAGAGTAGG - Intergenic
1113467547 13:110522982-110523004 GGTGGGGGGCGCTGGGGAGATGG - Intergenic
1113593219 13:111514907-111514929 GGTGCCTGGCTCTGGGGAGCAGG - Intergenic
1113681886 13:112250326-112250348 GTTGCAGGAGGCTGGGGAGTCGG + Intergenic
1113759896 13:112840123-112840145 GCTGGAGGGCACGGGAGAGTGGG - Intronic
1113759928 13:112840219-112840241 GCTGGAGGGCACGGGAGAGTGGG - Intronic
1113759938 13:112840251-112840273 GCTGGAGGGCACGGGAGAGTGGG - Intronic
1113759948 13:112840283-112840305 GCTGGAGGGCACGGGAGAGTGGG - Intronic
1113842006 13:113365729-113365751 GGTGCTGGGAAGTGGGGAGCAGG - Intergenic
1114789140 14:25636293-25636315 GCAGCAGGGCAGTGGAGAGTAGG + Intergenic
1116808261 14:49514206-49514228 GGTGAATGGCACTGGGTTGTGGG + Intergenic
1118178257 14:63464295-63464317 TGTGCAGGGCAAGGGGGACTAGG + Intronic
1118730517 14:68662895-68662917 GGTACAGAGCAGTGGGGAGGAGG - Intronic
1118836322 14:69480465-69480487 GGGGCAGGGAGCTGAGGAGTTGG + Intergenic
1119211411 14:72835038-72835060 GGTAGAGGGGACAGGGGAGTGGG + Intronic
1119860569 14:77933103-77933125 GGGGCAGGGAGCTGGTGAGTTGG + Intronic
1119901685 14:78265948-78265970 GGTGCTAGGCACTGGGGTGATGG - Intronic
1121471311 14:94156490-94156512 AGTGCAGAGCAAAGGGGAGTGGG - Intronic
1122066104 14:99175330-99175352 GGTGCCGGGCTCGGGGGAGCTGG + Exonic
1122374095 14:101247210-101247232 GGTGCCGGGGGCTGGGGAGAGGG - Intergenic
1122637081 14:103135152-103135174 AGTGCAGGGAGCTGGTGAGTAGG + Intronic
1122738231 14:103855904-103855926 TGTGCTGGGCACTGGGGATCTGG - Intergenic
1122799911 14:104224377-104224399 GCTCCAGGGCCCTGGGGAGGGGG + Intergenic
1123106070 14:105841622-105841644 AGTGGAGGGCACTGGGGAGGAGG + Intergenic
1124559601 15:30759410-30759432 GGTGGGGGGCACGGGGGAATGGG - Intronic
1124671650 15:31646296-31646318 GGTGGGGGGCACGGGGGAATGGG + Intronic
1127469446 15:59277102-59277124 CGTACAGGGCAGTGGGGAGGAGG + Intronic
1128555825 15:68631052-68631074 GGTGCAGGGCGGTTGGGGGTAGG + Intronic
1129261223 15:74368498-74368520 GGTGCAGGGTGATGGGGGGTGGG - Intergenic
1129350854 15:74955343-74955365 GCTGCAGGGCTCAGGGGAGGAGG + Exonic
1129377974 15:75145901-75145923 GATGCAGGGCACAGGGGACATGG + Intergenic
1129519695 15:76177967-76177989 GGAGCAGAGCCCTGGGGAGAAGG + Intronic
1129659006 15:77542775-77542797 GGTGCAGGGCACGAAGGAGTGGG - Intergenic
1129690385 15:77710006-77710028 TGAGAAGGGCACAGGGGAGTTGG + Intronic
1129875770 15:78974258-78974280 GCGGCAGAGCACTGGGGAGGAGG - Intronic
1130151412 15:81314591-81314613 CGTGCTTGGCCCTGGGGAGTGGG - Intronic
1131949781 15:97669452-97669474 GGTCCAGGCTACTGGGGAGTCGG - Intergenic
1132451758 15:101972616-101972638 GGTGCAGGCCATTGGAGAGAAGG + Intergenic
1132455134 16:18013-18035 GGTGCAGGCCATTGGAGAGAAGG - Exonic
1132628103 16:901934-901956 GGTGGAGAGCAGTGGGGGGTGGG + Intronic
1132878132 16:2149221-2149243 GGGCCAGGGCACTGGGGCGCGGG - Intronic
1133270539 16:4609076-4609098 GAGGCAGGGCCCTGGGGAGGGGG + Exonic
1133279883 16:4659312-4659334 TGTGCTGAGCTCTGGGGAGTGGG + Intronic
1134040249 16:11062899-11062921 GGGGGAGGGCAGTGGGGAGGGGG + Intronic
1135065699 16:19307814-19307836 GGTGGAGGTCACTAGGGTGTCGG + Intronic
1135395383 16:22127730-22127752 TGTGCCAGGCACTGGGGAGATGG + Intronic
1135397504 16:22142366-22142388 GGTGGAAGGCGCTGGGGAGCTGG + Intronic
1135511169 16:23084810-23084832 TGCTCAGGGCAGTGGGGAGTGGG - Intronic
1136153336 16:28366194-28366216 GGTGGTGGGCCCTGGGCAGTAGG - Intergenic
1136209750 16:28749073-28749095 GGTGGTGGGCCCTGGGCAGTAGG + Intergenic
1136610442 16:31362405-31362427 GGTCCAGGGTTCTGGGGAGAGGG + Intronic
1136610498 16:31362552-31362574 GGTCCAGGGTTCTGGGGAGGGGG + Intronic
1136618032 16:31410578-31410600 GGTCCAGGGTTCTGGGGAGGGGG + Intronic
1136618072 16:31410677-31410699 GGTCCAGGGTTCTGGGGAGGGGG + Intronic
1138384754 16:56628535-56628557 GATTCAAGGAACTGGGGAGTTGG - Intergenic
1139329540 16:66176686-66176708 GGTGATGGTCACTGGGGAGGAGG - Intergenic
1139346677 16:66308234-66308256 GGTGAAGCGGACAGGGGAGTGGG - Intergenic
1139441736 16:66971429-66971451 GGTGGGGGGCAGTGGGGTGTGGG - Intronic
1140200014 16:72887512-72887534 TGTGGAGGGAGCTGGGGAGTGGG + Intronic
1140599546 16:76458766-76458788 GGTCCATGGCCCTGGGGATTGGG + Intronic
1141677849 16:85527022-85527044 GGTGCAGGGATTTGGGGAGGGGG + Intergenic
1142377309 16:89712547-89712569 GGCGCGGGGCAGAGGGGAGTCGG - Intronic
1142418172 16:89954333-89954355 TGAGCAGGGCCCTGGGGAGGAGG + Exonic
1143608243 17:8003128-8003150 GGGGCAGGGCCCGGGGGAGGCGG - Exonic
1143731532 17:8885320-8885342 GAGGCAGGGCCCTGGGGAGGCGG - Intronic
1143896978 17:10144065-10144087 GGAGCAGGGAACGGGGGACTCGG + Intronic
1144659404 17:17058467-17058489 GCTCCAGGGCCGTGGGGAGTGGG + Intronic
1145265172 17:21376545-21376567 GGTGCGGGGCGCCGGGGCGTAGG + Exonic
1145905464 17:28513893-28513915 GGTGCTGGGCAAAGGAGAGTGGG + Intronic
1146055061 17:29576820-29576842 GGGTCAGGGCACAGGGGAGTGGG + Intronic
1147261175 17:39210476-39210498 GGGGCAGGGAAGTGGGGAGTGGG - Intergenic
1147338211 17:39739446-39739468 GGTGCAGGGCCCAGGTGAGAAGG - Intronic
1147792423 17:43021883-43021905 TGCGCAGGCCACTGGGCAGTGGG - Intronic
1148235387 17:45965071-45965093 GGTGCCTGGGACTGGGGTGTGGG + Intronic
1148444199 17:47727729-47727751 GGTGCTGGGTGCTGGGGACTCGG + Intergenic
1148456337 17:47813421-47813443 GGTGCAGGGTACTGAGGACGGGG + Intronic
1148987824 17:51638945-51638967 GGTGCAGGGCGATGTGGAGATGG + Intronic
1149445130 17:56707553-56707575 GGTGCGGGGCAGAGGGGAGGGGG + Intergenic
1151497458 17:74467201-74467223 GGTGCAGGGTACGGAGGAGGGGG + Intronic
1151700003 17:75737833-75737855 GGTTGAGGACACTGGGGAGGTGG - Intronic
1151886996 17:76928783-76928805 GGATCAGGGCACCGAGGAGTGGG + Intronic
1152066867 17:78117022-78117044 GGACCAGGGCTCTGGGGGGTGGG - Intronic
1152110883 17:78357288-78357310 TGTGCAGGGCTCGGGGCAGTGGG + Exonic
1152481786 17:80559085-80559107 GGGGAAGGGGAATGGGGAGTTGG - Intronic
1152678948 17:81655891-81655913 GGTGCTGGGCACCTGGGATTGGG + Intronic
1153905767 18:9659861-9659883 GGTGCAGTGCACTGGAGTGTGGG - Intergenic
1153949890 18:10049566-10049588 TGTGCAGGGCATTGGGGAGGAGG - Intergenic
1155184326 18:23373753-23373775 GGAGGAGGGCACTGTGGAGAGGG + Exonic
1156354248 18:36328113-36328135 TGTGCTGGGCACTGGGGAGAGGG + Intronic
1157513893 18:48297403-48297425 AGGGAAGGGCAGTGGGGAGTGGG - Intronic
1157564125 18:48668327-48668349 GGAGGAGGGCACTGGGGACTTGG - Intronic
1158396437 18:57081854-57081876 GGGGCGGGGGAGTGGGGAGTGGG + Intergenic
1160299636 18:77668356-77668378 GGTGCTGAGCACTCCGGAGTGGG + Intergenic
1160540556 18:79617927-79617949 GGTGCGGGGCGTTGGGGTGTTGG - Intergenic
1160827513 19:1087549-1087571 GGTTCCCGGGACTGGGGAGTTGG - Exonic
1160958954 19:1708917-1708939 GGGGCGGGGAACTGGGGTGTTGG - Intergenic
1160978851 19:1807302-1807324 AGGGCAGGGGACGGGGGAGTGGG - Intronic
1161067642 19:2246487-2246509 GGTGAAGGGCTCTGGGGATTGGG + Intronic
1161133340 19:2604801-2604823 GATGCAGGGCAGTGGCGAGAAGG + Intronic
1161496408 19:4588584-4588606 AGTGCCAGGGACTGGGGAGTGGG + Intergenic
1161535689 19:4817463-4817485 GGTGCACTCCACTGGGTAGTTGG + Exonic
1161572810 19:5039742-5039764 GGTGCTGGTCTCTGGGGAGCCGG + Intronic
1161611693 19:5246690-5246712 GCCCCAGGTCACTGGGGAGTGGG - Intronic
1161711660 19:5851967-5851989 CGTGCAGGTCACAGGGGAGATGG - Intergenic
1161723022 19:5914162-5914184 TGTGCTGGGCAGTGGGGAGTGGG - Exonic
1161928343 19:7318171-7318193 GGTGCCAGGGGCTGGGGAGTGGG - Intergenic
1161980132 19:7626044-7626066 GCTGCAGGGCATGGGGCAGTGGG + Exonic
1162019057 19:7860460-7860482 GCTGAAGGGCTCTGGGGAGGCGG + Intronic
1162020096 19:7864405-7864427 GATGTGGGGCACTGGGGAGAGGG - Intronic
1162064832 19:8119108-8119130 GGTGAAGGGGGCTGGGGAGGTGG - Intronic
1162080461 19:8214881-8214903 GATGAAGGGCAGTGGGGAGGAGG + Intronic
1162379070 19:10321303-10321325 GCTGGAGGGCCCTGGGGAGAGGG - Intronic
1162609080 19:11735505-11735527 GCTGCAGAGCACTGGAAAGTTGG - Intronic
1162798950 19:13100798-13100820 GGTGGGGGGCAGTGGGGATTGGG - Intronic
1163273272 19:16266910-16266932 GGGTCAGGGCATTGGGGAGGGGG + Intergenic
1163371354 19:16902930-16902952 GGAGAAGGGCAGTGGGGAGGTGG + Intronic
1163527649 19:17831070-17831092 GGGGCGGGGCTCTGGGGAGTGGG + Intronic
1163682132 19:18688895-18688917 GGGGCTGGGCAAGGGGGAGTGGG - Intronic
1164601519 19:29566461-29566483 TGTGATGGGCACAGGGGAGTGGG + Intergenic
1165066799 19:33234325-33234347 GGTGCAGTGCACGGGGGAGTGGG - Intergenic
1165316803 19:35060789-35060811 GGGGCAGGGGACTGGAGAGGTGG - Exonic
1165573020 19:36791463-36791485 GGTGCAGGGCAGTGGGGCTGAGG - Intergenic
1165692488 19:37874386-37874408 GGGGCAGGGCACAGGGGACACGG + Intergenic
1165717620 19:38056490-38056512 GGAGCAGGGTGCTGGAGAGTGGG - Intronic
1165819410 19:38665159-38665181 AGTTCTGGGCAGTGGGGAGTGGG - Intronic
1165860651 19:38907518-38907540 GGAGCATGGCACTGCCGAGTGGG - Exonic
1166212072 19:41313211-41313233 TGGGGAGGGCACAGGGGAGTGGG - Intronic
1166581598 19:43905213-43905235 AGGGCAGGTCACTAGGGAGTTGG - Intergenic
1166657532 19:44623192-44623214 GGTGCAAGGAACTCGAGAGTGGG + Intronic
1166759855 19:45217814-45217836 GGGGCTGGGGACTGGGGCGTGGG - Intronic
1167320830 19:48796401-48796423 GCTGCAGGGAGCTGGGGAATGGG - Intronic
1167459052 19:49614799-49614821 GGCCCAGGGCACGGGGGTGTTGG + Intronic
1167467323 19:49657272-49657294 GGTGAGGGGCACTGGGGAGTGGG - Intronic
1167688287 19:50969675-50969697 GGAGCATGGCACTGGGGTGCTGG - Intergenic
1167795340 19:51704798-51704820 GGAGGAGGGGACTGGGGACTTGG - Intergenic
925412505 2:3648036-3648058 GGTGTGGGGCAATGGGCAGTGGG + Intergenic
925940273 2:8810325-8810347 GGTACAGGGCACTGCATAGTGGG + Intronic
926442431 2:12903897-12903919 GGTGAAGGGGACTGGGGGCTGGG - Intergenic
926709923 2:15871035-15871057 GATGAAGGGCACTGGGCAGGAGG - Intergenic
927200631 2:20575930-20575952 GGGGAAGGGGACTGGGGAGGGGG + Intronic
928121183 2:28584656-28584678 AGTGCAGGGCACTGCAGAGGTGG - Intronic
928586243 2:32761335-32761357 GGTGCAAGACAATGGGGATTTGG - Intronic
929539490 2:42809338-42809360 GGTGGTGGGCACTCGGGAGGTGG + Intergenic
932947842 2:76258199-76258221 GTTGCATGGCACTGTGGACTTGG - Intergenic
935214305 2:100964046-100964068 GGGGCTAGGCACTGGGGGGTTGG - Exonic
935592405 2:104855186-104855208 GGAGCAGCGCTCTGGGGAGGGGG - Intergenic
935820246 2:106886741-106886763 GGAGCCGGGCACTGGGAAGTTGG + Intronic
936403685 2:112184363-112184385 GCTGCAGGGCTCTGAGGAGTGGG + Intronic
936567969 2:113595083-113595105 GGTGCAGGCCATTGGAGAGAAGG + Intergenic
936939020 2:117863715-117863737 AGTGAAGGGCACAGGGCAGTAGG - Intergenic
937228157 2:120381620-120381642 GGTGCCAGGCTCTGGGGACTGGG + Intergenic
937333411 2:121045883-121045905 AGTGCAGGGCACACGGGAGGTGG + Intergenic
938018167 2:127885316-127885338 GGTCCGGGGCGCTGGGGAGTTGG + Intronic
938141822 2:128800660-128800682 GGTGGAAGGCAAAGGGGAGTAGG + Intergenic
938407175 2:131039129-131039151 GGTGCAGAGCACTGGGTGGTGGG + Intronic
939710402 2:145509891-145509913 GTTCCTGGGCACTGGGGAGAGGG - Intergenic
940216521 2:151309097-151309119 TGTGCAGGTCACTGGGGATATGG - Intergenic
942531762 2:176917625-176917647 GGGGCAGGGGACTGGGGAGGTGG + Intergenic
942776365 2:179587093-179587115 GGTGGAAGGGAGTGGGGAGTAGG - Intronic
944615947 2:201460514-201460536 GGTGCAGGGCAGAGTGGAGATGG - Intronic
944660276 2:201916031-201916053 GGAGCAGGGCATTGCGGAGAGGG + Intergenic
946857791 2:223970199-223970221 GGCACAGGGAACTGGAGAGTGGG - Intergenic
947530304 2:230904953-230904975 GTTGCTGGGCACTGGGCACTGGG - Intergenic
948066523 2:235085038-235085060 TGGGCAGGGCACTGTAGAGTTGG - Intergenic
948718485 2:239881401-239881423 GGGGCAGGGCAGTGGGCAGGAGG - Intergenic
948809264 2:240466566-240466588 GGTGCAGGGAGCTGGGGGGAGGG - Exonic
948897394 2:240933831-240933853 GCTGCAGGGCACTGGAGACCAGG + Intronic
1170711620 20:18796446-18796468 TTTGAAGAGCACTGGGGAGTTGG + Intergenic
1170832054 20:19851172-19851194 GGTGCTGGGAACTGGGGTGATGG + Intergenic
1171391403 20:24803732-24803754 TGTCCAGGGCCCTGGGGATTTGG - Intergenic
1172032408 20:31991237-31991259 TGTGAAGGGGCCTGGGGAGTTGG - Intronic
1172427168 20:34863270-34863292 GGGGGAGGAAACTGGGGAGTGGG - Intronic
1173513839 20:43650954-43650976 AGGGCAGGGCACTGGGGAACGGG + Intergenic
1173791178 20:45828691-45828713 CAGGCTGGGCACTGGGGAGTAGG + Intronic
1175174902 20:57105475-57105497 TGTGCCGGGCAGTGGGAAGTCGG - Intergenic
1175221929 20:57422196-57422218 GGAGCAGGGAACAGGGGAGGGGG - Intergenic
1175778225 20:61666277-61666299 GGTGCCTGGAGCTGGGGAGTCGG + Intronic
1175826046 20:61937102-61937124 GGTGCAGGGCGCTGTGGGGGTGG - Exonic
1175980835 20:62737861-62737883 GGTGCAGGGGTGTGGGGGGTGGG - Intronic
1176234889 20:64049567-64049589 GGCGGCGGGCACTGGGGAGCCGG + Exonic
1176238467 20:64065047-64065069 GGCGCTGTGCAGTGGGGAGTGGG + Intronic
1176249155 20:64112073-64112095 AGTGCAGTGCACTGTGGAGCAGG + Intergenic
1177169614 21:17640729-17640751 TGTGCAGGGCAGTGGGGCCTTGG + Intergenic
1177835770 21:26184755-26184777 TGTGCAGGGCAGTGGGGCCTTGG + Intergenic
1178117929 21:29436468-29436490 GGTGCAGCGTATTGGTGAGTGGG + Intronic
1178240520 21:30894288-30894310 GGTGGAGGGGAGTGGGGAATGGG + Intergenic
1178258845 21:31080123-31080145 ACTGCAGGGCACTGGGCATTGGG + Intergenic
1178867445 21:36341269-36341291 GGTGCACGTCAGTGGGGGGTTGG - Intronic
1179437680 21:41373569-41373591 GCTGAAGGGCAGAGGGGAGTTGG - Intronic
1179509797 21:41865019-41865041 TGAGCAGGGGAGTGGGGAGTGGG - Intronic
1179567886 21:42260538-42260560 GGAGGGGGTCACTGGGGAGTTGG - Intronic
1179931411 21:44573387-44573409 TGTGCCGGGCTATGGGGAGTGGG - Intronic
1180145354 21:45915644-45915666 GGTGAAGGGCCCTGTGCAGTGGG + Intronic
1180879884 22:19196188-19196210 GGTGCAGGGGAATGGGCAGGTGG - Intronic
1180996851 22:19970160-19970182 ACTGCAGGGCTCTGGGGAGGTGG + Exonic
1181056256 22:20261815-20261837 GGTGCCAGGCACTGGGAACTAGG + Intronic
1181171979 22:21015015-21015037 GGTGCAGGGCAGCTGGGATTAGG + Exonic
1182029193 22:27144263-27144285 ATTGCAAGGCACTGGGGATTAGG - Intergenic
1182049318 22:27300865-27300887 GGTGCAGAGCCATGGGGAGGGGG - Intergenic
1182244685 22:28946740-28946762 TGTTCTGGGGACTGGGGAGTGGG + Intronic
1182335434 22:29580713-29580735 GGTACTGGGCCCTGGAGAGTGGG - Intronic
1182352013 22:29704484-29704506 GGTGCAGGGCAGATGGGGGTGGG + Intergenic
1183186452 22:36294199-36294221 GCTGCAGGGCAAAGGGGACTCGG - Exonic
1183188506 22:36306367-36306389 CGGGCAGGGCACTGTGGTGTGGG - Intronic
1183456276 22:37924905-37924927 GGAGCAGGGACCTGGGGAGGGGG - Intronic
1183557947 22:38546000-38546022 GGTGCAGGGCACTGTGGCAAGGG - Intronic
1183971960 22:41484076-41484098 GGGGCAGGGAAATGGGGGGTTGG + Intronic
1184012349 22:41758623-41758645 GATGCTGGGCACTGGGGACACGG + Intronic
1184297151 22:43532123-43532145 GGTGCAGGGATTTGAGGAGTGGG + Intronic
1184414868 22:44346394-44346416 TGTGTAGGGGACAGGGGAGTGGG - Intergenic
1184589707 22:45473747-45473769 GGTGCCGGAAGCTGGGGAGTGGG - Intergenic
1184684527 22:46090163-46090185 GGTGCAGGGCACTGGGAGGGAGG - Intronic
1184856698 22:47150274-47150296 TTTGGAGGGCACTGGGGAGTGGG + Intronic
1184887553 22:47355572-47355594 GGAGCATGTCACTGGGGGGTGGG + Intergenic
1185010041 22:48307704-48307726 GGCACAGGGCACTGGGTACTGGG + Intergenic
1185110163 22:48896294-48896316 GGTGAAGGGCAGTGGGCAATGGG + Intergenic
1185175607 22:49324867-49324889 TGTGCAGGGGGCTGGGGAGTTGG - Intergenic
1185389213 22:50549749-50549771 GGTGCAGTGCAGTGGGGCGGGGG - Exonic
949452699 3:4205044-4205066 TGTGCAGGTCACTGGGGATATGG - Intronic
949980576 3:9499830-9499852 GATGCGGGGCAGTGGGGAGGGGG - Exonic
950576869 3:13837328-13837350 GATGCGGGGCACTGTGGAGAGGG - Intronic
950635666 3:14312566-14312588 GGTGTAGGGCACAGGTGAGGAGG + Intergenic
950652351 3:14415234-14415256 GGTACAAGGCACTGTGGAGTAGG - Intronic
950670757 3:14524068-14524090 AGTGCAGGGCAGTGGAGTGTGGG + Intronic
952150753 3:30587856-30587878 GGGGCAAGGCAGTAGGGAGTAGG - Intergenic
953869637 3:46615318-46615340 GGAGGAGGGCTATGGGGAGTGGG - Intronic
954873733 3:53787143-53787165 GGTGCAGGGCTCTATGGGGTAGG - Intronic
955094671 3:55785518-55785540 AATGCAGGGCATTGGAGAGTTGG - Intronic
955410050 3:58649404-58649426 GGGGCTGGGGGCTGGGGAGTGGG + Intronic
957329203 3:78738196-78738218 TCTGAAGGGCACTGGGGATTTGG + Intronic
957522008 3:81329998-81330020 GGTCCAGGGGACCGGAGAGTCGG + Intergenic
958922663 3:100123860-100123882 GGTGAAGAACACTGGGAAGTTGG - Intronic
960305186 3:116051820-116051842 GGTGCAGGGGGCTGGGGAGGGGG + Intronic
961384346 3:126515853-126515875 GGTGGTGGGCACTGGGGGTTGGG - Intronic
961384504 3:126516290-126516312 GGTGGTGGGCACTGGGGGGTGGG - Intronic
961384587 3:126516514-126516536 GGTGGTGGGCACTGGGGGGTGGG - Intronic
961469409 3:127101798-127101820 GGAGCTGGGCACCGGGGAGGTGG + Intergenic
961733961 3:128988973-128988995 GCTCCAGGGAACTGGGGAGACGG - Intronic
962280450 3:134048385-134048407 GGGGCAGGGCAGTGGGAGGTTGG - Intronic
962311908 3:134332665-134332687 GGAGCAGGGCAGAAGGGAGTAGG - Intergenic
962593712 3:136917513-136917535 GGTGGAGGGCACTAGGAAGATGG - Intronic
963038673 3:141052769-141052791 GGCGCAGGGCTCTGGGAAGGAGG + Intronic
964645143 3:158950948-158950970 GGTGCAGAGCACTGTGGGTTGGG - Intergenic
964763201 3:160153662-160153684 GGAGCAGGGCACTGTGGAATGGG + Intergenic
965765784 3:172128563-172128585 GGGGCTGGGGAGTGGGGAGTTGG + Intronic
966805579 3:183805026-183805048 GCTGCAGGGCCATGGGGTGTAGG + Intronic
967252933 3:187561751-187561773 GGAGAAGGGCACTGGGTGGTTGG + Intergenic
967368614 3:188717093-188717115 AGTGGAGAGCCCTGGGGAGTGGG - Intronic
968181787 3:196600670-196600692 GTTGCCGGGGACTGGGGAGTTGG - Intergenic
968808177 4:2788324-2788346 TGTGCAGGGCACTCTGGCGTGGG + Intergenic
968812063 4:2804618-2804640 GGGGCAGGGCTCTGGGTAGGAGG - Intronic
968875429 4:3264657-3264679 GGTGCCCGGGGCTGGGGAGTTGG - Intronic
968958450 4:3730643-3730665 GGTGCAGGGCAGGGGCCAGTGGG + Intergenic
968958464 4:3730673-3730695 GGTGCAGGGCAGGGGCCAGTGGG + Intergenic
969247579 4:5945546-5945568 GTCGCAGGGCCCTGTGGAGTCGG + Intronic
969297357 4:6277847-6277869 GGTGCAAGGCTCTGAGGAGGTGG - Intronic
969347011 4:6576027-6576049 TGTGCAGGGCCCTCGGGACTCGG + Intronic
969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG + Intronic
969692247 4:8710172-8710194 GTTCCCGGGCACTGGGGAATGGG - Intergenic
970109648 4:12623382-12623404 GGTGGGGGGCAGTGGGGAGAAGG + Intergenic
970633474 4:17980692-17980714 GGTCCATGGCCCTGGGGATTGGG - Intronic
971526097 4:27620819-27620841 GATGCAGAGCCCTGGGGAATGGG - Intergenic
972628704 4:40824870-40824892 GGTCTAGGGGTCTGGGGAGTGGG - Intronic
973716613 4:53683087-53683109 GGTGCAGGTACCTGGGGAGAGGG - Intronic
973744329 4:53948390-53948412 GGAGGAGAACACTGGGGAGTGGG + Intronic
978541710 4:109823145-109823167 TGAGCAGGGCTCTGGGGAGTGGG + Intronic
979546986 4:121950925-121950947 GGGGCAGAGAAGTGGGGAGTAGG - Intronic
979737066 4:124100313-124100335 GGTGTGGGGCAGTGGGGAGGAGG + Intergenic
979741680 4:124159166-124159188 AGAGCAGGGCAGAGGGGAGTGGG - Intergenic
980073673 4:128270246-128270268 GGTGCATGGGGCTGTGGAGTGGG - Exonic
982106131 4:152013615-152013637 TGTGCAGGGGACTAGGGAGTGGG - Intergenic
982204607 4:152988498-152988520 TGAGCAGGGCCCTGGGCAGTGGG - Intergenic
985519626 5:367475-367497 GGTCAAGGGCACAGAGGAGTGGG + Intronic
985583287 5:711595-711617 GGAGCACGGCACTGGGAAATGGG - Intronic
985755043 5:1708806-1708828 TGAGCAGGGCACTGGGCAGTGGG + Intergenic
985951670 5:3226315-3226337 GCTGCTGGGAACTGGGCAGTAGG - Intergenic
986289768 5:6390450-6390472 GCTGTAGGGCACTGGTCAGTGGG - Intergenic
986571028 5:9166385-9166407 TGAGCTGGGCACTGGGGAGAAGG - Intronic
988099279 5:26657045-26657067 GTTGCAGGGCACTGAGCAGTGGG + Intergenic
991979398 5:72215730-72215752 GGGGAAGGGCACTGGTGAGCAGG + Intergenic
992003897 5:72460087-72460109 TGAGCAGAGCACTGGGGAGCAGG - Intronic
993563028 5:89435574-89435596 GCTGCAAGGCACTGGTGTGTGGG - Intergenic
994342529 5:98647919-98647941 GGTGAACGACATTGGGGAGTTGG - Intergenic
994917472 5:105999058-105999080 GGTCCAGGGGACTGGAGTGTCGG + Intergenic
995052265 5:107719847-107719869 GGTGCATTGCACTGGGCGGTGGG - Intergenic
996085999 5:119305914-119305936 GGTGCACGGCACAGGTAAGTGGG - Intronic
996277992 5:121691635-121691657 GGTGTAAGGGAGTGGGGAGTTGG + Intergenic
996916775 5:128721694-128721716 GGAGCAGTGCACTTGGGAGAGGG + Intronic
997521570 5:134527004-134527026 GGTGCAGGGCCCTAGGCAGAGGG - Intronic
997537098 5:134631040-134631062 GGTGCAGGGCCCTGGCTAGCAGG - Intronic
997658001 5:135569423-135569445 GATGCAGGGCTGTGGGTAGTTGG + Intergenic
997930582 5:138069482-138069504 GATGCAGGGAAATGGGCAGTAGG - Intergenic
999232595 5:150070365-150070387 GGGGCAGGGCACAGGGAAGTAGG - Intronic
999461081 5:151758236-151758258 GGGGCAGGGGATGGGGGAGTTGG - Intronic
1000569655 5:162895975-162895997 GCGGCAGGGCACTGGGTGGTAGG - Intergenic
1001403677 5:171461218-171461240 GGGGGAGGGCAGTGGGGAGGGGG + Intergenic
1002473789 5:179452701-179452723 AGGGCAGGTCACTGGAGAGTGGG - Intergenic
1002571172 5:180140103-180140125 GGTGCTGGGCACATGGGAGGTGG + Intronic
1002900743 6:1407753-1407775 GGTGGGGGGCACTGGGGATCCGG - Intergenic
1003067840 6:2918586-2918608 GATGCAGGGCCCAGGGCAGTGGG + Intergenic
1003226998 6:4215047-4215069 GGTACTGGGTACTGGGCAGTGGG - Intergenic
1003845797 6:10172110-10172132 GGTGCACGGCACTGGGGCTGAGG + Intronic
1003870737 6:10400661-10400683 GGTGAAGGGAATTAGGGAGTTGG - Intronic
1003980946 6:11389320-11389342 GGTGAAGGGCACTGCAGAGGTGG - Intergenic
1004131110 6:12921109-12921131 GGTGCAGTGCACCTGGGAATGGG + Intronic
1004304928 6:14491757-14491779 GATGCTGGGCACAGGGAAGTTGG - Intergenic
1005035515 6:21552308-21552330 GGGACTGGGCACTGTGGAGTAGG + Intergenic
1005988746 6:30890646-30890668 GGTGCAGGGCTGTGAGGATTGGG + Intronic
1006357437 6:33568179-33568201 GGTGGAGGGGGCTGGGGAGACGG + Intergenic
1007105855 6:39282440-39282462 GCTGGAGGGCAGTGGGGAGGAGG - Intergenic
1007166404 6:39831819-39831841 GGACCAGAGCACTGGGGGGTAGG + Intronic
1007775776 6:44223651-44223673 GGGGCCGGGGACTGGGGACTGGG + Exonic
1012052636 6:94362629-94362651 GATGCAGGGCACAGGGGACATGG + Intergenic
1015187855 6:130438937-130438959 AGGGCAGGGCAGTGGGGAGTGGG + Exonic
1015568157 6:134595091-134595113 GGTGCAGGGTGCTGGGAAGGAGG + Intergenic
1015569310 6:134604788-134604810 GGAGCGGGGAACTGTGGAGTTGG - Intergenic
1016667165 6:146655416-146655438 GGGGCAGGGAGGTGGGGAGTAGG - Intronic
1016986840 6:149901479-149901501 GCTAGAGGGCACTGGGGACTGGG + Intergenic
1017127469 6:151079405-151079427 GGGGCAGGGCAGTGGGGGGCAGG + Intronic
1018469200 6:164081312-164081334 CGTGCAGGGCCCAGTGGAGTTGG - Intergenic
1018960958 6:168448317-168448339 GGAGGATGGCACTGGGGAGGAGG + Intronic
1018971415 6:168531931-168531953 GGTCAAGGGCTCTGGAGAGTGGG + Intronic
1019503812 7:1380483-1380505 AGTCCAGGGTTCTGGGGAGTTGG + Intergenic
1019544484 7:1566944-1566966 AGGGCAGGGCACTGTGGGGTGGG - Intergenic
1022315404 7:29240708-29240730 GGTGGGGGGCGGTGGGGAGTGGG + Intronic
1023110811 7:36808783-36808805 GGTGCAGGGAGCTAGGGAATGGG + Intergenic
1023169564 7:37377537-37377559 AGAGCAGGTCACTGGGGAGAAGG + Intronic
1023985192 7:45089805-45089827 GGTGCCTGGCACGGGGGAGGAGG - Intergenic
1025112047 7:56225642-56225664 GGGGCAGGGGAGTGGGGAGATGG - Intergenic
1025130004 7:56370207-56370229 GGTGCAGGCCACTGGGAGGCAGG - Intergenic
1026578209 7:71592093-71592115 GGGCCAGGGAACTGGGCAGTGGG + Intronic
1026867357 7:73831930-73831952 GCTGCTGGGGACTGGGGACTGGG + Exonic
1028290370 7:89057710-89057732 GAAGCAGGCCACTGTGGAGTGGG + Intronic
1029464342 7:100715965-100715987 GGTGGGGGGCACTGGGCAGGGGG + Intergenic
1029570089 7:101363313-101363335 GGCGCAGGGCAGCGGGGACTGGG + Intronic
1029619160 7:101679191-101679213 GGACCAGGGCACGGCGGAGTGGG + Intergenic
1029748224 7:102528526-102528548 GAGGCAGGGCCCTGGGCAGTGGG + Intergenic
1029766171 7:102627613-102627635 GAGGCAGGGCCCTGGGCAGTGGG + Intronic
1030350255 7:108476966-108476988 GTTGCCAGACACTGGGGAGTAGG + Intronic
1032090062 7:128907116-128907138 GGTGCAGGCATCTGGGGAGAAGG + Exonic
1033125053 7:138700017-138700039 GTTGCAGGGCACAGGGCTGTTGG + Intronic
1033669092 7:143472627-143472649 GGTCCAGGGGACTGGAGCGTTGG - Intergenic
1034417177 7:150971316-150971338 GGCACAGTGCACTGGGGAGCAGG + Intronic
1034627358 7:152503670-152503692 GGTGCAGGGGACAGGGGAATGGG + Intergenic
1034877939 7:154741868-154741890 GATGCAGGACACTGGGATGTGGG - Intronic
1035167650 7:157000892-157000914 GGAGTGGGGTACTGGGGAGTCGG - Intronic
1035650689 8:1261568-1261590 GGGGCTGGGCAGTGGGGGGTGGG + Intergenic
1037579375 8:20235710-20235732 GGAGGAGGGAAATGGGGAGTGGG - Intergenic
1038019942 8:23544453-23544475 GGTGCTGGGCACTAAGGAGACGG + Intronic
1039991224 8:42489552-42489574 GCTGCAGGCCTCTGGGAAGTGGG - Intronic
1040007313 8:42631368-42631390 GGTGCAGGGAGAAGGGGAGTGGG - Intergenic
1040521172 8:48177219-48177241 GGGCCTGGGGACTGGGGAGTCGG + Intergenic
1041100537 8:54392438-54392460 GGGCCAGGGGACAGGGGAGTGGG - Intergenic
1041548169 8:59069902-59069924 TGTGAAGGGCACTGAGGAGTCGG + Intronic
1041933471 8:63311612-63311634 GATGCAGAACACTGGGGAATGGG - Intergenic
1042675948 8:71322217-71322239 GGTGGAGAGAACTGGTGAGTTGG + Exonic
1043447381 8:80332226-80332248 GGAGGAGGGGACTGGGGAGGTGG + Intergenic
1044698042 8:94942623-94942645 AGTGCTGGGCACAGGGGAGATGG + Intronic
1046211800 8:111085856-111085878 GGTTCACGGCACTTGGGAGTTGG - Intergenic
1048971165 8:139645635-139645657 GGTGCAGGGCTCTAGAGTGTGGG - Intronic
1048974382 8:139662808-139662830 GGTGCGGGGGACAGGGGAGGGGG + Intronic
1049171652 8:141165128-141165150 GGAGCAGGGACCTGGGGAGTCGG + Intronic
1049309204 8:141924432-141924454 GGTGCAGGGCAGCGGGGACAGGG - Intergenic
1049531480 8:143157767-143157789 GGCTCAGGGCACTGGGGTGCTGG - Intergenic
1049673632 8:143880283-143880305 GGCCCAGGGACCTGGGGAGTAGG - Intergenic
1049687050 8:143943239-143943261 GGGGCGGGGCCCTGGGGATTGGG - Intronic
1049806702 8:144544266-144544288 GGTGGAGGCCACAGGGCAGTGGG - Intronic
1049884561 9:18437-18459 GGTGCAGGCCATTGGAGAGAAGG - Intergenic
1051671648 9:19516415-19516437 GAAGCAGGGCAGAGGGGAGTGGG + Intronic
1052341275 9:27366586-27366608 GGTCCAGGAGACTGGGGGGTGGG + Intronic
1056379717 9:86046413-86046435 GGTGCACGGCACCTGGGAGGCGG - Intronic
1056445953 9:86666501-86666523 GGTCCAGGACACAGGGGATTGGG - Intergenic
1056763784 9:89432342-89432364 GGGACAGGACCCTGGGGAGTTGG + Intronic
1056781641 9:89555235-89555257 AGGGCAGGGAACTGGGGAGGAGG - Intergenic
1057172551 9:92971926-92971948 GGTGGAGGGGGCTGGGGAGGTGG - Intronic
1057725869 9:97567766-97567788 AGTGAAGGGCACTGAGGAGGGGG + Intronic
1059350106 9:113658452-113658474 GCAGTGGGGCACTGGGGAGTGGG - Intergenic
1059465027 9:114463351-114463373 GGTGGAGGAGACTGGGGAGAAGG - Intronic
1059572190 9:115451091-115451113 TGTGAAGGGAAATGGGGAGTTGG + Intergenic
1059867639 9:118534187-118534209 AGTACAGAGCACTGGGGAGAGGG - Intergenic
1060294345 9:122333021-122333043 GGTGATTGACACTGGGGAGTGGG + Intergenic
1060444678 9:123677323-123677345 GGTGGAGGGCAGTGGGGATGGGG - Intronic
1060465166 9:123897573-123897595 GCCGCAGGGCACTGAGGAGATGG + Intronic
1060475658 9:123984669-123984691 GTTGAAGGGCACTGGGAAGGAGG - Intergenic
1060968416 9:127724373-127724395 CGACCAGGGCACTGGGGAGGGGG + Intronic
1061796898 9:133090873-133090895 TGTGCAGGGCACAGGGGATGGGG + Intergenic
1061934356 9:133849225-133849247 GGGACAGGGCACTGGGAAGGAGG + Intronic
1062003010 9:134226218-134226240 GAGGCAGGGGGCTGGGGAGTCGG + Intergenic
1062060765 9:134494078-134494100 GGTGAATGGCACTGGGGTGGTGG + Intergenic
1062060771 9:134494096-134494118 GGTGGATGGCACTGGGGTGGTGG + Intergenic
1062174019 9:135151019-135151041 GGTGCTGGGGACTGGGATGTGGG + Intergenic
1062254577 9:135614918-135614940 GGTGCAGGGCTGAGGGAAGTGGG + Intergenic
1062337908 9:136080563-136080585 GGAGCAGGGTAGTGGGGAGATGG - Intronic
1062396321 9:136354276-136354298 GGCCCAGGGCACAGGAGAGTGGG - Intronic
1062411754 9:136429297-136429319 GGTGCAGAGCACGGGGGTGTTGG + Exonic
1062429663 9:136521359-136521381 AGCTCAGGGCCCTGGGGAGTGGG - Intronic
1062491033 9:136805011-136805033 GGTGCAGGGCCCTTGGGTGCTGG - Intronic
1186239564 X:7552033-7552055 GGTGCAGACCACTGGGGACAGGG - Intergenic
1186503961 X:10075078-10075100 GGTGGTGGGCACTGGGGAGCTGG + Intronic
1187697666 X:21937902-21937924 GGTGCAGGGGGCTGGGGTGGGGG + Intergenic
1188587591 X:31796917-31796939 GGTGAAGGGCAAAGGGGAGCTGG - Intronic
1189169540 X:38895792-38895814 GGTGGTGGGCAGTGGGTAGTGGG + Intergenic
1189363297 X:40369633-40369655 GGGGCAGGGGAGTGGGGAGGGGG + Intergenic
1192260794 X:69504983-69505005 GGTGCGGGGCACTGGGGCGGTGG - Intergenic
1192760419 X:74090219-74090241 GGTGCAGGGCACTGGTGCCCTGG + Intergenic
1193169782 X:78322149-78322171 GAAAGAGGGCACTGGGGAGTTGG - Intronic
1193843657 X:86441262-86441284 TGGGAAGGGCACTGGGGAGGAGG - Intronic
1195090511 X:101454150-101454172 GGAGCAGGGCAGTGGTGTGTTGG + Intronic
1195274945 X:103273031-103273053 GGTGCAGGACCCTGGAGAGGGGG + Intergenic
1195830191 X:109048908-109048930 TGAGCAGGGCAATGGAGAGTGGG - Intergenic
1195917595 X:109951064-109951086 GGTGGGGGGCAAGGGGGAGTGGG + Intergenic
1196100125 X:111839076-111839098 GGTCCAGGGAACTGTGGAATGGG - Intronic
1196317941 X:114251389-114251411 GTTTCAGGGCAGTGGTGAGTAGG - Intergenic
1199846514 X:151695612-151695634 GGTGCAGGGCATTGTTGAGGAGG + Intronic
1200094326 X:153650206-153650228 GGAGCAGGGCAGTGGGGGGCAGG + Exonic
1200401245 X:156021714-156021736 GGTGCAGGCCATTGGAGAGAAGG + Intergenic
1200873346 Y:8126279-8126301 GGTGCAGGGGACAGGAAAGTAGG + Intergenic
1202381851 Y:24280653-24280675 TGTGCAGGGCACTGAGGAACTGG + Intergenic
1202488933 Y:25389472-25389494 TGTGCAGGGCACTGAGGAACTGG - Intergenic
1202584728 Y:26410148-26410170 GGGGGATGGCAGTGGGGAGTAGG + Intergenic