ID: 969462535

View in Genome Browser
Species Human (GRCh38)
Location 4:7336367-7336389
Sequence CCGGGGAGTTGGGGGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969462535_969462554 23 Left 969462535 4:7336367-7336389 CCCAGAGACCCCCAACTCCCCGG No data
Right 969462554 4:7336413-7336435 CAATGCGAACAGATGGATGAAGG 0: 1
1: 0
2: 0
3: 64
4: 835
969462535_969462544 -7 Left 969462535 4:7336367-7336389 CCCAGAGACCCCCAACTCCCCGG No data
Right 969462544 4:7336383-7336405 TCCCCGGAGGCCCTTGGCCCCGG No data
969462535_969462553 16 Left 969462535 4:7336367-7336389 CCCAGAGACCCCCAACTCCCCGG No data
Right 969462553 4:7336406-7336428 CTGAGATCAATGCGAACAGATGG 0: 1
1: 0
2: 0
3: 30
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969462535 Original CRISPR CCGGGGAGTTGGGGGTCTCT GGG (reversed) Intronic