ID: 969463065

View in Genome Browser
Species Human (GRCh38)
Location 4:7338980-7339002
Sequence TGCCCTGCCAGAAGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969463065_969463072 15 Left 969463065 4:7338980-7339002 CCTGACACACTTCTGGCAGGGCA 0: 1
1: 0
2: 1
3: 6
4: 146
Right 969463072 4:7339018-7339040 ACTGCACCTCTTGGCCAAGACGG 0: 1
1: 0
2: 0
3: 8
4: 126
969463065_969463068 -9 Left 969463065 4:7338980-7339002 CCTGACACACTTCTGGCAGGGCA 0: 1
1: 0
2: 1
3: 6
4: 146
Right 969463068 4:7338994-7339016 GGCAGGGCAGAGCCTGCCAGGGG 0: 1
1: 0
2: 4
3: 68
4: 632
969463065_969463067 -10 Left 969463065 4:7338980-7339002 CCTGACACACTTCTGGCAGGGCA 0: 1
1: 0
2: 1
3: 6
4: 146
Right 969463067 4:7338993-7339015 TGGCAGGGCAGAGCCTGCCAGGG 0: 1
1: 0
2: 9
3: 85
4: 655
969463065_969463070 6 Left 969463065 4:7338980-7339002 CCTGACACACTTCTGGCAGGGCA 0: 1
1: 0
2: 1
3: 6
4: 146
Right 969463070 4:7339009-7339031 GCCAGGGGAACTGCACCTCTTGG 0: 1
1: 0
2: 0
3: 21
4: 130
969463065_969463073 16 Left 969463065 4:7338980-7339002 CCTGACACACTTCTGGCAGGGCA 0: 1
1: 0
2: 1
3: 6
4: 146
Right 969463073 4:7339019-7339041 CTGCACCTCTTGGCCAAGACGGG 0: 1
1: 0
2: 1
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969463065 Original CRISPR TGCCCTGCCAGAAGTGTGTC AGG (reversed) Intronic
900626803 1:3612047-3612069 TGCCCTGCGGGAAGTGGGTGAGG - Intergenic
901686680 1:10947285-10947307 GGCCCTGCCAGCTGTGTTTCTGG - Intronic
902246765 1:15125921-15125943 TGCCCTGTAAGGAGTGTGTGGGG - Intergenic
903365434 1:22802822-22802844 TGCCCCTCTAGAAATGTGTCAGG + Intronic
903783033 1:25834654-25834676 TGCCCTTCCAGATGTCTGACTGG - Exonic
904561704 1:31402608-31402630 TGCCCTGCCAGATGTAACTCTGG + Intergenic
905033609 1:34903649-34903671 GGCCCTGCCTGAATTGTATCAGG + Intronic
905301406 1:36988462-36988484 TGCCCTGCCAGCAGGGCCTCTGG - Intronic
910611467 1:89147776-89147798 TGTCCTGCCAGAAAAGTGTAGGG + Exonic
911065775 1:93786620-93786642 TGGCCTTCCAGGAGTGTCTCTGG - Intronic
911973971 1:104468012-104468034 TGCCTTGCCAGAGGAGTGTGCGG - Intergenic
912311450 1:108625296-108625318 ACTGCTGCCAGAAGTGTGTCTGG - Intronic
912695670 1:111840282-111840304 TACTCTGCAAGAACTGTGTCTGG - Intronic
914329881 1:146657704-146657726 TGCCCTTCCAGGAGTGTTTGAGG + Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
918583188 1:186156536-186156558 CCCCCTGCCAGCAGTGTGTAAGG - Intronic
919020955 1:192105227-192105249 TGCCCTTCCAAGATTGTGTCTGG + Intergenic
920430631 1:205916524-205916546 TGCCCATCCTGAACTGTGTCAGG + Intronic
923043055 1:230333484-230333506 TGCCCTCCCAGCTGTGAGTCTGG - Intronic
1067787854 10:49263834-49263856 TGCACAGCCAGAAGTGTGAATGG - Intergenic
1069774000 10:70916411-70916433 TTCCATGCCTGAAGGGTGTCTGG + Intergenic
1069899796 10:71700866-71700888 TCCCCAGCCAGAGGTGTCTCTGG - Intronic
1077151382 11:1074554-1074576 TGTCCTGCCAGAAGCAAGTCTGG - Intergenic
1081486159 11:43531036-43531058 AGCCTTGCCAGACGTGTGTGGGG - Intergenic
1081793283 11:45804075-45804097 TGCACTTCCAGAAGTGCGTGCGG - Intronic
1082924072 11:58527519-58527541 TGCCCTTCGACAACTGTGTCAGG + Exonic
1084091400 11:66881473-66881495 TCCCCTTCCAGAAGGGAGTCAGG + Intronic
1085646152 11:78224318-78224340 TGACCTGCCAGTGGTGAGTCTGG - Intronic
1086234668 11:84614388-84614410 GCCCCTTCCACAAGTGTGTCAGG - Intronic
1086937165 11:92757640-92757662 TGCCCTGCCACATTTGTGCCTGG - Intronic
1091178498 11:133582153-133582175 TGCCCTGCCAAAAGTGTCCTAGG - Intergenic
1093771652 12:23024847-23024869 TGCCCTGCGAGAAATGTTTTGGG + Intergenic
1094631408 12:32178863-32178885 TGCCCGGCCTGCAGTGTGCCAGG - Intronic
1095885898 12:47188084-47188106 TGCCATGACAGAGGTATGTCTGG - Intronic
1097347476 12:58510211-58510233 TGCCCTGCCTGATGTGGGTGGGG + Intergenic
1099366854 12:81776152-81776174 TACCCTGCCAGAAATGTTTAAGG - Intergenic
1101538731 12:105644848-105644870 TGCCCTGCCAAAAGTGTTCTTGG + Intergenic
1103134130 12:118492965-118492987 TGCCCTGCGATTAGTGTTTCAGG + Intergenic
1107871363 13:44749372-44749394 TGCCCTGCCATAAATGGTTCGGG + Intergenic
1109119854 13:58440917-58440939 TCCCCTGCCAGAAGTCTGAAGGG - Intergenic
1109395107 13:61746599-61746621 AACCCTGCCAAAAGTGTGCCAGG - Intergenic
1111641953 13:90980234-90980256 TGCCCAGGCAGAAGTCTGTAGGG - Intergenic
1114517828 14:23311239-23311261 TTCCCTGACAGAAGAGTCTCTGG - Exonic
1115978632 14:39024300-39024322 AGCCATGTCAGAAGTGTGTATGG + Intergenic
1120202813 14:81555630-81555652 GGCCCTGCCAGGTGTGTGCCAGG - Intergenic
1123036195 14:105472943-105472965 AGCCCTGCCAGAAGAGTGGATGG - Exonic
1123164617 14:106314599-106314621 TGCCCTGACAGGTTTGTGTCAGG + Intergenic
1124003697 15:25779981-25780003 TGGCCTGCTGCAAGTGTGTCAGG + Intronic
1127556570 15:60093757-60093779 TGCTCTGCCAGCAATGTGTTAGG + Intergenic
1129320515 15:74772134-74772156 TGACCAGCCAGCAGTGTGTTTGG - Intergenic
1130060526 15:80566579-80566601 GGCCCTGCCAGACGTGTCTGTGG + Intronic
1130330995 15:82922207-82922229 TGTCCTGGCAGATCTGTGTCAGG - Intronic
1130577429 15:85105082-85105104 TGCCTTGCCAGTAATGTGACAGG + Intronic
1130924843 15:88377393-88377415 TGCCCTTCCTGAACTCTGTCTGG + Intergenic
1136016496 16:27404199-27404221 TCCTCTGCCAGGAGGGTGTCCGG + Intronic
1140003674 16:71053210-71053232 TGCCCTTCCAGGAGTGTTTGAGG - Intronic
1141204792 16:81925419-81925441 GCCCTTGCCAGAAGTGGGTCTGG + Intronic
1142928260 17:3259919-3259941 GGCCATGTCAGAACTGTGTCAGG - Intergenic
1148535356 17:48433996-48434018 TGCCCTGGCTGAAATGGGTCTGG + Intergenic
1148575334 17:48706519-48706541 TGCCCTGCCGGATGTGGGGCAGG - Intergenic
1152464512 17:80458253-80458275 TGCCCCACCTGAAGTGGGTCTGG + Intergenic
1152736469 17:81999809-81999831 TGCCCTCCCAGGTGTGTGGCCGG - Intronic
1152931015 17:83109873-83109895 TGCTCAGCCAGATGTGTGTGTGG - Intergenic
1153522908 18:5968913-5968935 TGCTCTGCCATGAGTGTGCCTGG + Intronic
1154351049 18:13583819-13583841 TGCCATGCCAGAACTGTGAAAGG - Intronic
1156023772 18:32629254-32629276 TGCCCTGGCAGAAGAGACTCAGG - Intergenic
1159875279 18:73803919-73803941 TGCCCTGCCATGGGTGTGTTTGG - Intergenic
1161978274 19:7617991-7618013 TGCCCTGCCAGAGGTGTCCCTGG - Exonic
1164484330 19:28641785-28641807 TCCCCTGCCTGAAGTATGTGGGG + Intergenic
1164575713 19:29404284-29404306 GGCCCTGCCAGAAGGATGCCAGG + Intergenic
1166067779 19:40370183-40370205 TGCCCAGGTAGAAGTGGGTCTGG - Exonic
925299339 2:2799444-2799466 TGCCCTGTCACATGTGTGACTGG - Intergenic
925350030 2:3194532-3194554 TGTCCTTCCAGAAATGTGTCAGG - Intronic
926217208 2:10912911-10912933 GCCGCTGCCAGAAGTGCGTCTGG + Exonic
926594728 2:14777790-14777812 AGCCCAGCAAGAAGTGAGTCTGG + Intergenic
928902417 2:36334013-36334035 TGCCCTGCCTATTGTGTGTCAGG - Intergenic
929092288 2:38230955-38230977 TGCACTGCATGAAGTGTGTTTGG + Intergenic
940239989 2:151552167-151552189 TGCCCTGCCTGCTTTGTGTCAGG + Intronic
946199864 2:218065217-218065239 TGCCCTGCCTGCAGTGGGCCAGG - Intronic
946571590 2:221029738-221029760 TGCCCTGCCCTGACTGTGTCAGG + Intergenic
947745993 2:232507647-232507669 TGTCCTGTCAGAAGTGGCTCAGG - Intergenic
948615568 2:239196647-239196669 TGCCCTGCCAGATGTTAGACGGG - Intronic
948662713 2:239516799-239516821 TGCAGTCCCAGAAGGGTGTCTGG + Intergenic
1170044516 20:12071350-12071372 TGCCCTGTCTGAATGGTGTCAGG + Intergenic
1173596460 20:44261748-44261770 TTCCCTGGCAGAAGTCTGTAGGG + Intronic
1173701948 20:45080138-45080160 TGCCCTGCAAAAACTGTATCTGG - Intergenic
1173868178 20:46326150-46326172 TGCCCTTCCAAAAAGGTGTCAGG - Intergenic
1178043883 21:28672481-28672503 TGCCCTGTCAGAAATGTGCAAGG + Intergenic
1179617383 21:42590682-42590704 TGCCTTGCCAAAGGTGTCTCTGG + Intergenic
1179677986 21:42997778-42997800 TGCCCAGAGGGAAGTGTGTCTGG + Intronic
1179830299 21:43992324-43992346 GGCCTTGCCCGCAGTGTGTCCGG + Intergenic
1179830312 21:43992369-43992391 GGCCTTGCCCGCAGTGTGTCTGG + Intergenic
1180841706 22:18961963-18961985 TCCCCTGCCAGCAATCTGTCCGG - Intergenic
1181003426 22:19998507-19998529 TGCCCACCCAGAAGGGTCTCCGG + Intronic
1181059796 22:20276898-20276920 TCCCCTGCCAGCAATCTGTCCGG + Intronic
1182685767 22:32120996-32121018 TGCCCAGCAGGGAGTGTGTCGGG - Intergenic
1183354417 22:37350697-37350719 AGCTCTGGCAGAATTGTGTCAGG + Intergenic
949207351 3:1455768-1455790 TGTCATGGCAGAACTGTGTCTGG - Intergenic
950801769 3:15557771-15557793 TCGGCTGCCAGAGGTGTGTCCGG + Intergenic
955780401 3:62478405-62478427 TGTCCTGCCAGTAATGGGTCAGG - Exonic
960637391 3:119796782-119796804 TGCCCTGCCAGATCTGTCTATGG + Intronic
962315550 3:134357355-134357377 TGCCCTGCCAGTTGTCAGTCAGG - Exonic
964731595 3:159872452-159872474 TGCTTTGCCAGAAGAGTTTCAGG - Intronic
964749102 3:160038426-160038448 TGCCCTGCCAGAAGCAGGTCAGG - Intergenic
966873517 3:184307892-184307914 TGCCCTTCCCTAAATGTGTCAGG - Exonic
969463065 4:7338980-7339002 TGCCCTGCCAGAAGTGTGTCAGG - Intronic
972847667 4:43009216-43009238 CTACCTGCCAGAACTGTGTCTGG - Intronic
973996598 4:56465571-56465593 TGCCCTGCCATATTTTTGTCTGG - Intergenic
976272834 4:83248090-83248112 TGCCCTGCCAGTAGTCAGCCAGG + Intergenic
984873539 4:184348087-184348109 TCACCTGACAGAGGTGTGTCTGG + Intergenic
985336214 4:188897913-188897935 TGTCTTCCCAGAAGTGTCTCTGG - Intergenic
988720488 5:33872715-33872737 TGTCCTGCCTGAAATGTGTCTGG - Intronic
990672789 5:58151308-58151330 TGCCCTGCCAGTGGTGTTTCTGG - Intergenic
994201369 5:96979860-96979882 TGCCCTGCTAGAAGGGCTTCGGG - Exonic
994597703 5:101860455-101860477 TGCCCTGCCACAGCTGTGGCAGG + Intergenic
997643106 5:135462627-135462649 TGCCCTGCGAGATGTGAGTAGGG + Intergenic
999368132 5:151036106-151036128 TGCCCTGGCAGAGGTGGGTTGGG + Intronic
999540477 5:152566205-152566227 TCCCCTGCCACAAGTCTATCTGG - Intergenic
999697367 5:154198879-154198901 TGCCCTGGCAGGAGTTAGTCAGG - Intronic
999783297 5:154868746-154868768 TGTTCTGCCAGAAGTAGGTCTGG + Intronic
1000195281 5:158951211-158951233 CACCCAGCCAAAAGTGTGTCAGG - Intronic
1000442687 5:161282174-161282196 AGCCCTGGCAGGAGTGTGTCTGG + Intergenic
1009576111 6:65463239-65463261 TGCACAACCAGGAGTGTGTCAGG - Intronic
1009752987 6:67896612-67896634 TGCTCTGCCTGACCTGTGTCAGG + Intergenic
1009934865 6:70222113-70222135 TGTCCTGACAAAAGTCTGTCAGG - Intronic
1011495384 6:87932310-87932332 TGCCCTGTGAAAAGTGTCTCTGG + Intergenic
1013172402 6:107648634-107648656 TGCCCTGACAGTAGGGTGGCAGG - Intronic
1017630614 6:156392941-156392963 TGCCCTGGCAGCAGTGTGAAGGG - Intergenic
1018696461 6:166395356-166395378 TGCCCTGCCAGTCCTGTGTGTGG + Intergenic
1019084304 6:169459939-169459961 TGCCCTGCCAGAAATGTGTACGG + Intronic
1019665823 7:2251995-2252017 TCCCCTGCCTGCACTGTGTCCGG + Exonic
1022100681 7:27167238-27167260 GTCCCAGCCGGAAGTGTGTCAGG - Intronic
1033541956 7:142365514-142365536 TGCCCTGAAAGAAGAGTCTCAGG - Intergenic
1036208290 8:6821250-6821272 TGTCCTGCCAAAAGTGTCTGTGG + Intronic
1037898049 8:22671343-22671365 TGTCCTCCCAGGAGTCTGTCTGG + Intergenic
1037993312 8:23336029-23336051 GGCCTTGCAGGAAGTGTGTCTGG - Intronic
1048073787 8:131046699-131046721 TGCAGTGCCAGATGTGTGTGGGG + Intergenic
1048424134 8:134306882-134306904 TGCCATGGCAGAAGTCTGTGGGG - Intergenic
1049542670 8:143215556-143215578 GGCCCTGCCAGCACTCTGTCTGG + Intergenic
1049612917 8:143563762-143563784 TGCCCTGACAGAAGTGGGGAAGG - Intergenic
1051588054 9:18747935-18747957 TGCCCAGCCTCAAGTGTGCCTGG - Intronic
1053482431 9:38425510-38425532 TGCCCTGCCAGAACTCAGGCAGG - Intergenic
1056435369 9:86570459-86570481 TGTCCTGCCTGCTGTGTGTCAGG - Intergenic
1059481916 9:114597638-114597660 TGTTCTGCCGGAAGTATGTCTGG - Exonic
1059699130 9:116758359-116758381 TGCCATGCCAGGAGAGTGCCAGG + Intronic
1060665839 9:125431746-125431768 TGCCCCGCCAGAGTGGTGTCAGG + Intergenic
1062269982 9:135703932-135703954 TGCTCTGCCTGCAGTGTGACAGG - Intronic
1188720803 X:33520977-33520999 GGCCCTGCAAGAAGTTTGTGTGG - Intergenic
1189857768 X:45240489-45240511 GGCCCTGCCAGAAGTTGATCTGG + Intergenic
1197055192 X:122110495-122110517 GGCCCTGCTTCAAGTGTGTCAGG + Intergenic
1200639062 Y:5696041-5696063 TGCCCTGCAAGAAATGTTACAGG - Intronic
1200684304 Y:6245809-6245831 TGGCCTAGCAGAAGTGAGTCGGG - Intergenic
1200827993 Y:7662980-7663002 TGCACTCCCAGAAGTTTGGCAGG + Intergenic
1201048330 Y:9908577-9908599 TGGCCTAGCAGAAGTGAGTCGGG + Intergenic