ID: 969463926

View in Genome Browser
Species Human (GRCh38)
Location 4:7343685-7343707
Sequence GCTTCCTCTTGACCTCCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969463926_969463938 29 Left 969463926 4:7343685-7343707 CCCTTAGGAGGTCAAGAGGAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 969463938 4:7343737-7343759 CCACCTAGTGTTGAGTGGGTTGG 0: 1
1: 0
2: 1
3: 12
4: 135
969463926_969463935 25 Left 969463926 4:7343685-7343707 CCCTTAGGAGGTCAAGAGGAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 969463935 4:7343733-7343755 GCACCCACCTAGTGTTGAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 68
969463926_969463934 24 Left 969463926 4:7343685-7343707 CCCTTAGGAGGTCAAGAGGAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 969463934 4:7343732-7343754 AGCACCCACCTAGTGTTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 98
969463926_969463929 -9 Left 969463926 4:7343685-7343707 CCCTTAGGAGGTCAAGAGGAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 969463929 4:7343699-7343721 AGAGGAAGCACTGTGGCAGATGG No data
969463926_969463930 -8 Left 969463926 4:7343685-7343707 CCCTTAGGAGGTCAAGAGGAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 969463930 4:7343700-7343722 GAGGAAGCACTGTGGCAGATGGG 0: 1
1: 0
2: 3
3: 16
4: 210
969463926_969463931 -7 Left 969463926 4:7343685-7343707 CCCTTAGGAGGTCAAGAGGAAGC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 969463931 4:7343701-7343723 AGGAAGCACTGTGGCAGATGGGG 0: 1
1: 1
2: 7
3: 26
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969463926 Original CRISPR GCTTCCTCTTGACCTCCTAA GGG (reversed) Intronic
901874923 1:12161929-12161951 GCTTCATCTGGCCCTCCTACCGG - Intergenic
903818145 1:26080415-26080437 GCTTCCTTCTGGCCTCCTCAAGG - Intergenic
907756794 1:57318576-57318598 GCTTCCCCTTTGCCTCCCAAGGG + Intronic
909602853 1:77478979-77479001 GGTTCCTTTTGCCCTCCTAATGG + Intronic
909892228 1:81021880-81021902 GCTTCTTCTTTACCCCCAAATGG - Intergenic
916008783 1:160685728-160685750 GCTTCCCCTTCACCTTCTGAAGG + Intronic
917780663 1:178392767-178392789 GCTTCTCCTTGATCTCCTTAAGG - Intronic
918004355 1:180527674-180527696 GATTCACCTTGACCTCCTCAGGG - Intergenic
918756926 1:188349771-188349793 GCTTCCTGTGGAGTTCCTAAGGG + Intergenic
919211060 1:194487219-194487241 GATTCCTCTAGACCTACAAAAGG - Intergenic
920211985 1:204335165-204335187 CCTTCCCCTTGGCCTCCCAAGGG + Intronic
921507213 1:215986643-215986665 TCTTCCTCTTGGCCTGCTGAAGG - Intronic
922756078 1:228097640-228097662 GCATCCTCATGAGCTCCTCACGG - Exonic
1066698923 10:38105628-38105650 GCTTCCTAATCACCTCCTAAAGG + Intronic
1066993729 10:42542602-42542624 GCTTCCTAATCACCTCCTAAAGG - Intergenic
1075239512 10:120765148-120765170 GCTGCCTCTTCATCTCCTAATGG - Intergenic
1076331584 10:129674479-129674501 GCTCCTTCCTGACCTCTTAATGG + Intronic
1076350514 10:129811810-129811832 GCTTCCTCCTGGCCTCAAAATGG + Intergenic
1078199705 11:9169586-9169608 GGTTCCTATTGAACTCCTCAGGG + Intronic
1079075015 11:17379526-17379548 GCTTCCTCGTGTGCTTCTAATGG + Intergenic
1080875715 11:36272454-36272476 CCTTCCTCTTGGCCTCCCATGGG - Intergenic
1085523628 11:77152105-77152127 GCTTGCTCTTGCCCTCTTACTGG + Intronic
1088130159 11:106478859-106478881 GCTTTTTCTTTACCTCCAAATGG + Intergenic
1089156253 11:116405205-116405227 GACTCCTCTTGACCTCCAAGGGG - Intergenic
1090877987 11:130807966-130807988 CCACCCTCATGACCTCCTAAAGG + Intergenic
1091802885 12:3335564-3335586 GCTTCCTCTGGAGCTTCTAGGGG - Intergenic
1092889394 12:12954629-12954651 GATTCCTCTTGAGCTCCTGATGG + Intergenic
1093221211 12:16422475-16422497 GTTTCCTTTTGACCTGATAATGG - Intronic
1094244140 12:28268472-28268494 GCTTCCTACTGATCTCTTAAAGG - Intronic
1094535980 12:31323759-31323781 GCTCCCTGTTGCCCTACTAAGGG - Intronic
1097179490 12:57163098-57163120 GCTTCCTGTTGGCCCCCTAAGGG - Intronic
1102022945 12:109696443-109696465 CCTTCCTCCTGACCTCCCACTGG - Intergenic
1102280230 12:111613061-111613083 GCTTCCTATGCACCTGCTAATGG + Intergenic
1108545713 13:51491146-51491168 GCATCCTTGTCACCTCCTAAAGG + Intergenic
1111684629 13:91487081-91487103 GTTTCCTCTTCACCTTCTGAGGG + Intronic
1112034006 13:95481078-95481100 GCTGCATCTTGACCACCTATTGG + Intronic
1113433752 13:110272775-110272797 GCTTCCTTTTTACCTGCTCAGGG - Intronic
1116219867 14:42069747-42069769 TCCTATTCTTGACCTCCTAATGG - Intergenic
1117250265 14:53929663-53929685 ATTTCCTCTAGACCTCCTCATGG - Intergenic
1119288311 14:73474245-73474267 GCTTGCTCTTGACCTCTGAAAGG + Intergenic
1122629320 14:103100070-103100092 GCTTCCTTTTGACAGCCTGAGGG + Intergenic
1124078687 15:26470858-26470880 GCTTCCTCTTCACCCTCTGAAGG + Intergenic
1127070567 15:55284702-55284724 ACTTCTTCATGACCTCTTAAGGG + Intronic
1127163477 15:56217508-56217530 GCTTTCTCTTGATGTCATAAAGG + Intronic
1127235026 15:57039779-57039801 GTTTCTTCTGGACCTCCTAAAGG + Intronic
1128140346 15:65295759-65295781 GCCTCCACTTCACCCCCTAAAGG + Intronic
1128378291 15:67092749-67092771 CCTTGCTCTTAACCTCTTAATGG + Intronic
1131020461 15:89093538-89093560 GCTTCCTCTTGGACGCCCAAAGG - Intronic
1141007114 16:80363029-80363051 TCTTCCTCTTGATCTCCTTGTGG - Intergenic
1142135139 16:88448514-88448536 GCTGCCGCCTGACCTCCTTATGG + Intergenic
1145017820 17:19410582-19410604 GCCACCTCTGGACCTTCTAATGG - Intergenic
1147131401 17:38411671-38411693 GCTTCCTCTTGACATCATAGAGG + Intergenic
1147232594 17:39030115-39030137 GTCTCCTGTTGACCTGCTAAAGG - Intergenic
1148128858 17:45250687-45250709 GGTTTCTCTTGCCCTCCTCATGG + Intergenic
1149356904 17:55848445-55848467 GGTTCCTCTGGACCTAGTAAGGG - Intergenic
1151993443 17:77593398-77593420 GGTCCCTCTTGACATCCCAAGGG - Intergenic
1155503980 18:26515270-26515292 GCTTCCTCTGGACCTTACAAGGG - Intronic
1156881710 18:42088204-42088226 GCTTCCTCCTCACCTCCTCTTGG + Intergenic
1157393664 18:47324322-47324344 GCTTCATCTGAACCACCTAAGGG - Intergenic
1157434852 18:47659737-47659759 GCTTCCTTTTCAGCTTCTAATGG + Intergenic
1160032799 18:75277684-75277706 CTTTCCTGGTGACCTCCTAAAGG + Intronic
1163448284 19:17360577-17360599 TCTTCCTCTTGAACTCCTCCAGG + Exonic
1165608796 19:37132595-37132617 ACTTCTGCTTGACCTCCTGAAGG + Intronic
1166948125 19:46409498-46409520 GCTTCCTCCTAACCTCCACAGGG + Intergenic
1167221579 19:48202427-48202449 GTTTCCTCTTGCCTTCCTGAAGG - Intronic
1167645604 19:50703516-50703538 GCTGCCTCTTGGCGTCCTCAGGG + Exonic
925236292 2:2280723-2280745 GCTTCCTCTCCACCTCCTGATGG - Intronic
925641634 2:5990882-5990904 GATTCCTGTTGACCTCCTTCAGG - Intergenic
927991080 2:27447571-27447593 GCATCGTCTTGAACTCCTCATGG + Exonic
928068286 2:28188713-28188735 CCTTCCTCATGAGCTCCCAAAGG + Intronic
928738084 2:34315929-34315951 GCTTCCCTTTCACCTTCTAAAGG - Intergenic
929500746 2:42489573-42489595 GTTTCCTCCTGAACTCCTTAAGG - Intronic
937119328 2:119431235-119431257 GTTTCCTCCTGAACTCCTCAGGG - Intronic
937211417 2:120274480-120274502 GCTTTCTCTTGACGACCTCAGGG - Intronic
937651929 2:124328845-124328867 GCTTCCTCTTTACCGCCAGAAGG + Intronic
938904694 2:135826744-135826766 GCTGCCTTTTGTCCTCCTCATGG - Intronic
940577137 2:155523057-155523079 GCTTCCTCTTGTCATCTTCAAGG + Intergenic
943202157 2:184842229-184842251 GCTTTGTCTTGAACTCCAAATGG - Intronic
947027876 2:225759277-225759299 GACTCCTCTTGATCCCCTAAAGG - Intergenic
1171399263 20:24861128-24861150 GCTGCCTCTTGAGCTGCTTATGG + Intergenic
1172765821 20:37350183-37350205 GCTTCCCCTTGAGCTCCTGGGGG + Intronic
1172770436 20:37379264-37379286 GCTTCCCCTTGACCCCCGCAAGG + Intronic
1179277070 21:39901438-39901460 GCTTTATCTTGACATCCTATTGG + Intronic
1181047736 22:20223608-20223630 GGTTCCACTTGACCACCTCAGGG - Intergenic
1182396919 22:30042857-30042879 GCTTTCTCCTGACCTTCTCAGGG + Intergenic
1183128856 22:35813054-35813076 ATTTCTTCTTGACCTCTTAAGGG - Intronic
1183305104 22:37078670-37078692 TCTTCCTCTTCTCCTTCTAAAGG - Intronic
952396224 3:32922728-32922750 GCCTCCTCTTGATCTCACAATGG + Intergenic
954390612 3:50266346-50266368 CCTTCCACTTGCCCTCCTGAAGG + Intergenic
955252689 3:57300320-57300342 GACTCTTCTTTACCTCCTAATGG - Intronic
957483884 3:80832816-80832838 GCTACATCTTGACCTACAAAAGG + Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
961325432 3:126106605-126106627 GCTTCCACCTGGCCTCCGAAGGG + Intronic
961631386 3:128301536-128301558 GCCTCCCCTTGACATCCTGATGG - Intronic
969463926 4:7343685-7343707 GCTTCCTCTTGACCTCCTAAGGG - Intronic
971980713 4:33746688-33746710 TCATCCTGTTGTCCTCCTAAAGG - Intergenic
975655297 4:76635454-76635476 GTTTCCCCTTGAGTTCCTAATGG + Intronic
975691140 4:76964848-76964870 GCTTTCTTTTGACCTTTTAAAGG - Intronic
977313041 4:95410907-95410929 GTTCCCTCTGGACCTTCTAATGG + Intronic
978195831 4:105970845-105970867 TTTCCCTCTTGACCTCCTAATGG + Intronic
984023017 4:174509242-174509264 GCTTACTCTTGATTTCCTAGAGG + Intronic
985635404 5:1033352-1033374 GCCTCCTCTTGTCCCCCTAGTGG + Exonic
988485620 5:31666000-31666022 GCTGCCTCTCCACCTCCAAAGGG - Intronic
990507311 5:56457449-56457471 GCTTCCCAAGGACCTCCTAATGG - Intergenic
990763785 5:59160067-59160089 GCTTATTCTTAACCTCTTAAAGG - Intronic
993633147 5:90312052-90312074 GTTTCATCTTGAGCTGCTAATGG - Intergenic
996207424 5:120758687-120758709 GCTTCCCCTTGGCCTCCTGTTGG + Intergenic
996663797 5:126034629-126034651 GTCTCCTCTTGCCCTGCTAAGGG - Intergenic
998517356 5:142768671-142768693 GCTTTATCTTGAGCACCTAAAGG - Intergenic
999110403 5:149115674-149115696 GCTTCTGGATGACCTCCTAATGG + Intergenic
1000762209 5:165240412-165240434 TCTGCCTATTGATCTCCTAATGG - Intergenic
1001877722 5:175215815-175215837 TCTCCCTCTTGACCTCCAAGGGG - Intergenic
1002792222 6:444992-445014 GCGTCCTCTGGAGCTCCTCAAGG - Intergenic
1006713300 6:36094901-36094923 GCTTCAACTTCACCTCCTAAGGG - Intronic
1006829795 6:36961864-36961886 GCATCCTCCTGACCTCCTGTAGG + Exonic
1011652791 6:89522441-89522463 GCTTCCTCAAAACCTGCTAAAGG + Intronic
1014599106 6:123386635-123386657 GCTGCCTCTTGACATCCTCCTGG - Intronic
1015186836 6:130426708-130426730 GCTTCCTCCTGGGCTCCAAAAGG - Intronic
1018283553 6:162213978-162214000 GCTGCCTTCTGGCCTCCTAAGGG - Intronic
1018729314 6:166637038-166637060 CCTTCCTCTCCACCACCTAAAGG + Intronic
1019637542 7:2084083-2084105 GCTTCCTCTGGACACCCGAAAGG + Intronic
1021955059 7:25816081-25816103 TCTTCCTCTTCACCTCCTCCTGG + Intergenic
1024554705 7:50593353-50593375 CCTTCCCCTTGACCACCTTAGGG - Intronic
1029020882 7:97363941-97363963 GCTTCCTAGAGACCTCATAATGG + Intergenic
1029237438 7:99132650-99132672 TCTTCCTCTTGACTTCTCAATGG - Intronic
1029636047 7:101784514-101784536 GCTTCCTCTTGACTTTTGAAAGG - Intergenic
1030044310 7:105481289-105481311 GCTTTCTCTCTACCTCCCAAGGG + Intronic
1030865450 7:114697233-114697255 GCTACCTATTAACCTCCTAATGG - Intergenic
1032059763 7:128714858-128714880 TCTTCAGTTTGACCTCCTAAGGG + Intronic
1032293948 7:130617747-130617769 TCTTCCTCTTGGTTTCCTAATGG - Intronic
1040491368 8:47925132-47925154 CCTTCCTCTGTACCACCTAAAGG + Intronic
1045050239 8:98317979-98318001 GCTTACTATAAACCTCCTAAGGG + Intergenic
1045459919 8:102416538-102416560 GCTTCCTCTAGACAGCCTATTGG + Intergenic
1048832715 8:138492239-138492261 CCTTCCTCTTGACCTATCAATGG + Intronic
1048958613 8:139557250-139557272 CCTACCTCTTGAGCACCTAAAGG - Intergenic
1055198783 9:73630245-73630267 GCTTGGTCTGGACCTGCTAAAGG + Intergenic
1058927667 9:109683496-109683518 TCTTCCTCATAACCTCCAAAAGG + Intronic
1059042295 9:110827755-110827777 GCTTCCTAATTACCTGCTAATGG - Intergenic
1060275582 9:122179863-122179885 GCTTCCTGTTGGCATCCTGAAGG + Intronic
1060756490 9:126218053-126218075 GCTTCCTCTTGCACTCCCACGGG - Intergenic
1185895843 X:3858158-3858180 GCTTCCTCCTGACATCCCAAAGG + Intergenic
1185900962 X:3896582-3896604 GCTTCCTCCTGACATCCCAAAGG + Intergenic
1185906077 X:3935021-3935043 GCTTCCTCCTAACATCCCAAAGG + Intergenic
1186179049 X:6954936-6954958 GCATCAGCTTGACCTCCTGAGGG - Intergenic
1186472819 X:9834524-9834546 GCTTCCCCTTGACCTCTTCCAGG - Intronic
1190892994 X:54587129-54587151 GCTGACTCTTGACCTCCAGATGG - Intergenic
1195384923 X:104305131-104305153 TCTTCCTCTTGGCCTTCCAAAGG + Intergenic