ID: 969464867

View in Genome Browser
Species Human (GRCh38)
Location 4:7350405-7350427
Sequence ATACATAGACAGCTGGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969464865_969464867 0 Left 969464865 4:7350382-7350404 CCAGTGTGGAACAGAACTTAGCA 0: 1
1: 0
2: 1
3: 14
4: 125
Right 969464867 4:7350405-7350427 ATACATAGACAGCTGGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969464867 Original CRISPR ATACATAGACAGCTGGATCT AGG Intronic
No off target data available for this crispr