ID: 969466417

View in Genome Browser
Species Human (GRCh38)
Location 4:7359725-7359747
Sequence CTGTAGGCATTAATGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969466417 Original CRISPR CTGTAGGCATTAATGTAGCT GGG Intronic
903198564 1:21713218-21713240 ATGTAGCCTTTCATGTAGCTGGG + Intronic
908178628 1:61581363-61581385 CTATAGGCATTTCTCTAGCTAGG - Intergenic
910491117 1:87772557-87772579 CTACAGGCATTAATATAGATGGG + Intergenic
911782008 1:101892755-101892777 CTGTAAGCATTATCGTAGCCTGG + Intronic
911946641 1:104118146-104118168 ATGTGGGCATTATTCTAGCTAGG + Intergenic
912903855 1:113682248-113682270 CTGAAAGCCTTAATGTTGCTCGG - Intronic
916780795 1:168026343-168026365 CTGTAGGGATTACTTCAGCTTGG + Intronic
916943634 1:169701879-169701901 CTGTAGGCATTAGACTAGCAAGG - Intronic
1062967584 10:1620768-1620790 CTGTAGGCGTAAATCTAACTTGG - Intronic
1065798368 10:29328270-29328292 CTGTAGACATTCAGGAAGCTTGG + Intergenic
1073189026 10:101636998-101637020 GTGTAGGGATTAATGGAGCAAGG + Intronic
1073302569 10:102480010-102480032 CTGTAAACATTAGTGTAGCAAGG + Exonic
1088562729 11:111132166-111132188 GGTTAGGAATTAATGTAGCTAGG - Intergenic
1090697989 11:129267967-129267989 CGGAAGGCATTAATGTAGACAGG + Intronic
1093521569 12:20057360-20057382 CTGTTGCCATTGATGTTGCTAGG - Intergenic
1096366551 12:51033186-51033208 CTGTAGGCAGGACTGAAGCTGGG + Intergenic
1101100341 12:101385243-101385265 CTGAAGACATTAAAGTAACTTGG - Intronic
1103019426 12:117522110-117522132 CTGTAGGCAGTTATGGCGCTTGG + Intronic
1108117696 13:47147584-47147606 CTGAAAGCATCAATGTAGATTGG + Intergenic
1109264868 13:60186308-60186330 CTATATTCATTCATGTAGCTGGG + Intergenic
1116554242 14:46283231-46283253 CTGTAAAGATGAATGTAGCTGGG - Intergenic
1117591618 14:57275134-57275156 CTGTAGGGATTAGCTTAGCTGGG + Intronic
1118812506 14:69285627-69285649 TTGTAGGCACCATTGTAGCTGGG + Intronic
1119083376 14:71717928-71717950 CTGTAGGTACTGATGTAACTGGG - Intronic
1124085344 15:26544649-26544671 CTGTAGGGAGTTATGTAGCAGGG + Exonic
1124388493 15:29230319-29230341 CTGTAGGGATTACTTCAGCTTGG - Intronic
1125067405 15:35505027-35505049 ATGTAGGAATTAATGTAGCTGGG - Intronic
1129504999 15:76073709-76073731 CTGTAGGCAGCTTTGTAGCTTGG + Intronic
1134515439 16:14883104-14883126 CTTTAGGGATTAATTTAGCTAGG - Intronic
1134703112 16:16281749-16281771 CTTTAGGGATTAATTTAGCTAGG - Intronic
1134964431 16:18430366-18430388 CTTTAGGGATTAATTTAGCTAGG + Intronic
1134968718 16:18512901-18512923 CTTTAGGGATTAATTTAGCTAGG + Intronic
1135484218 16:22849919-22849941 CTGAAGGGATAACTGTAGCTAGG + Intronic
1135944990 16:26857744-26857766 CTGTAGGCATCATTATTGCTGGG - Intergenic
1140571916 16:76117742-76117764 CTGTAGGCTTTAATGAAGCCTGG + Intergenic
1142209147 16:88799663-88799685 GTGCAGGCATGAATGTAGCTTGG - Intergenic
1144018803 17:11222012-11222034 CTCAAGGCATTAATATAGCTGGG - Intergenic
1146061426 17:29609448-29609470 CTGTAGGCAAGAGTGCAGCTGGG - Intronic
1146644883 17:34570803-34570825 CTGTAGGGACTAATGTGGTTTGG - Intergenic
1149928977 17:60730939-60730961 CTGTGGCCACTCATGTAGCTAGG + Intronic
1157795472 18:50570495-50570517 CTGTAGGCTGTATTTTAGCTGGG + Intronic
932691194 2:73915141-73915163 TTGTAGGCAGCAATGTAGCAAGG + Intronic
933196491 2:79395958-79395980 CCATAGCCATTAATGTAACTGGG + Intronic
937683349 2:124668205-124668227 CTGTAGTCATACATTTAGCTAGG + Intronic
939861520 2:147426620-147426642 ATGTAGGCATTTCTGTTGCTGGG - Intergenic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
947846534 2:233248783-233248805 CTGTAGGCAGTGGTGTTGCTGGG - Intronic
1173343083 20:42171862-42171884 CTGTGGGAATTAATGTGCCTTGG - Intronic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
951963844 3:28360124-28360146 ATGTATACATTAATGTAGCTTGG + Intronic
959092334 3:101917190-101917212 CTATAGCTATTAATCTAGCTGGG - Intergenic
961132737 3:124483946-124483968 CTTTAGGTATTAATATAGATGGG - Intronic
967724375 3:192847984-192848006 CTGTAGACATAAATGTATTTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969466417 4:7359725-7359747 CTGTAGGCATTAATGTAGCTGGG + Intronic
971132588 4:23829366-23829388 TTGTAGGTATTAATTCAGCTGGG - Intronic
974567844 4:63601373-63601395 CTTTAAGGATTAAAGTAGCTTGG + Intergenic
976690991 4:87866871-87866893 CTGGTGGCATTCATGTAGGTGGG + Intergenic
978008316 4:103647397-103647419 ATGTAAGCATTAATATAACTTGG + Intronic
978821268 4:112969346-112969368 CTACAGGCATTCATGTAGGTTGG + Intronic
981160579 4:141493942-141493964 CTTTATGCATCAATGTGGCTTGG + Intergenic
982765703 4:159345952-159345974 CTGTAGGATTTAATTTAGATAGG + Intronic
985700739 5:1370614-1370636 GTGTAGACATTAAGGTTGCTTGG + Intergenic
986684430 5:10263730-10263752 CTGTAGCCACTTGTGTAGCTCGG + Intronic
987641997 5:20624718-20624740 CTGTAGTCATTTAGGTATCTGGG - Intergenic
987967698 5:24896889-24896911 CTGTAAGCAATAATGTGGCTGGG + Intergenic
988045288 5:25943462-25943484 CAGTAGGCATTATTTTAACTTGG - Intergenic
989519247 5:42381740-42381762 GTGTAGGTATTAACCTAGCTAGG - Intergenic
992166751 5:74059876-74059898 CTGCAGGCATCACTGTAGCTTGG + Intergenic
998663936 5:144274306-144274328 GTGTAGGAATAAAGGTAGCTTGG + Intronic
1000117018 5:158162804-158162826 CTGTATGGTTTATTGTAGCTTGG - Intergenic
1001736269 5:174006112-174006134 CTGAAGTCTTTAATGTAGCAGGG - Exonic
1002840075 6:897816-897838 GTCTAGGCATTTATGGAGCTGGG + Intergenic
1009320617 6:62284178-62284200 TTGTATGCATTTATTTAGCTTGG + Intronic
1010186563 6:73150792-73150814 CTGTATACATTAATGTAGTGTGG + Intronic
1013717886 6:112985389-112985411 CTGGAGTCATTCATGTACCTGGG - Intergenic
1014705137 6:124737136-124737158 CTTTAGTCATTAATATGGCTTGG + Intronic
1016342076 6:143073476-143073498 CTGTTGGCAGGAATGTAGGTTGG - Intronic
1016704149 6:147087625-147087647 GTGTAGGCATTCATGTACTTTGG - Intergenic
1018068581 6:160141338-160141360 CTTTAGGTTTAAATGTAGCTTGG - Intronic
1021052669 7:16008068-16008090 CATTAGGGATTAATGTAGGTTGG + Intergenic
1021110326 7:16686753-16686775 CTATAGGCATGAATGAAGCTAGG - Intronic
1023223033 7:37940115-37940137 CTGTAGGCATTAGTGGAGAATGG + Intronic
1024104482 7:46068266-46068288 CTGTAGGAATTAATATAGAGAGG + Intergenic
1024173683 7:46815874-46815896 CTGTAAACATTAATGTGCCTAGG + Intergenic
1030446884 7:109656889-109656911 CTGTAGGCATGATAGTGGCTTGG + Intergenic
1030492040 7:110249448-110249470 CTGTAGGCACCACTGAAGCTTGG - Intergenic
1041198508 8:55425897-55425919 CTGATGGCATTTAAGTAGCTGGG - Intronic
1051764145 9:20503300-20503322 CTGTATTGATTACTGTAGCTTGG - Intronic
1057420031 9:94904128-94904150 CTGGAGGGATTAATTTAGTTGGG - Intronic
1059376657 9:113887215-113887237 GTGTAGGCATTAGTGTAAGTAGG + Intronic
1059789898 9:117630331-117630353 ATGAAGGCATTAATGCAGATTGG - Intergenic
1188093091 X:25987907-25987929 TTGTAGGGACTAATGCAGCTAGG + Intergenic
1189498531 X:41531528-41531550 CTGTATGCCTTAATGCAGTTGGG + Intronic
1191159384 X:57311913-57311935 CTGTGGACAGTAATGAAGCTGGG + Intronic
1194551261 X:95302510-95302532 CTGTGGGCATGTATGTAACTTGG - Intergenic
1195443169 X:104921085-104921107 CTGGAGGAATTCCTGTAGCTAGG - Intronic
1197834518 X:130680241-130680263 CTGTAGGCATTGTTGTAAGTAGG - Intronic
1201410941 Y:13698917-13698939 ATATAGGCACTAATGTAGGTGGG + Intergenic