ID: 969468897

View in Genome Browser
Species Human (GRCh38)
Location 4:7374817-7374839
Sequence CTGGGTAGACCGCGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969468880_969468897 14 Left 969468880 4:7374780-7374802 CCCCACAGCCATCTTGTGCTCCC 0: 1
1: 0
2: 1
3: 21
4: 243
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468887_969468897 -7 Left 969468887 4:7374801-7374823 CCTCCAGCCTCTCTGCCTGGGTA 0: 1
1: 0
2: 4
3: 53
4: 416
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468881_969468897 13 Left 969468881 4:7374781-7374803 CCCACAGCCATCTTGTGCTCCCT 0: 1
1: 0
2: 0
3: 15
4: 193
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468886_969468897 -6 Left 969468886 4:7374800-7374822 CCCTCCAGCCTCTCTGCCTGGGT 0: 1
1: 0
2: 6
3: 77
4: 530
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468879_969468897 19 Left 969468879 4:7374775-7374797 CCTGGCCCCACAGCCATCTTGTG 0: 1
1: 0
2: 3
3: 26
4: 305
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468888_969468897 -10 Left 969468888 4:7374804-7374826 CCAGCCTCTCTGCCTGGGTAGAC 0: 1
1: 0
2: 1
3: 30
4: 292
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468882_969468897 12 Left 969468882 4:7374782-7374804 CCACAGCCATCTTGTGCTCCCTC 0: 1
1: 0
2: 1
3: 20
4: 326
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468878_969468897 30 Left 969468878 4:7374764-7374786 CCACAGCGTCACCTGGCCCCACA 0: 1
1: 1
2: 2
3: 21
4: 269
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
969468883_969468897 6 Left 969468883 4:7374788-7374810 CCATCTTGTGCTCCCTCCAGCCT 0: 1
1: 0
2: 3
3: 37
4: 500
Right 969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969468897 Original CRISPR CTGGGTAGACCGCGGGTGGG GGG Intronic
900099892 1:957468-957490 CAGGGAAGACCGCGGCTGGGGGG - Intronic
900181252 1:1311981-1312003 CTGTGTTGACCGCGGTGGGGTGG + Intronic
902480868 1:16710835-16710857 CGGTGTACACAGCGGGTGGGGGG + Intergenic
902712176 1:18247961-18247983 CTGGGCAGACTGCGTGTGTGTGG - Intronic
903087898 1:20880505-20880527 CTTGGGAGACCGAGGTTGGGTGG + Intronic
906794652 1:48687381-48687403 CCCGGTGGGCCGCGGGTGGGCGG + Intronic
916821296 1:168401176-168401198 CTGGGCAGAGCGGGGTTGGGTGG + Intergenic
919899717 1:202034899-202034921 CTGGCCAGGCCACGGGTGGGTGG - Intergenic
922986832 1:229872577-229872599 ATGGGTAGAACGCGGGTGGTGGG - Intergenic
1065367899 10:24952778-24952800 CTGGCTAGGCCGCGGGGGCGCGG + Intergenic
1067091315 10:43266957-43266979 CGGGGGCGGCCGCGGGTGGGCGG - Intergenic
1067214805 10:44293108-44293130 TCGGGAGGACCGCGGGTGGGAGG + Intronic
1067469063 10:46523256-46523278 CTGGCTTGACCCTGGGTGGGAGG + Intergenic
1072917691 10:99549484-99549506 CTCGGGAGACTGAGGGTGGGAGG - Intergenic
1075587886 10:123670630-123670652 CTGGTTAGAGCTGGGGTGGGAGG - Intronic
1076529349 10:131134135-131134157 CTGGGTAGGCTGGGGGTGGCAGG + Intronic
1076687352 10:132204112-132204134 CTGGGCAGACAGCGGGCAGGAGG - Intronic
1077539932 11:3141784-3141806 CTGGGTGGGAGGCGGGTGGGGGG - Intronic
1081668833 11:44932156-44932178 CTGGGGAGACGGCGGGTGCTGGG - Exonic
1081867492 11:46367567-46367589 CTTGGGAGAGGGCGGGTGGGCGG + Intronic
1084153549 11:67302183-67302205 CTGGGTGGACCGGGGGCTGGGGG - Exonic
1084272061 11:68034256-68034278 CTGGGTAGCCCGCTGGGGGAGGG - Intronic
1084835936 11:71801930-71801952 CTGGCTTGAGCGTGGGTGGGTGG - Intergenic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085270591 11:75267601-75267623 GGGGGTGGGCCGCGGGTGGGCGG - Intronic
1087282921 11:96232433-96232455 CTGGGTAGGATGTGGGTGGGTGG + Intronic
1096849891 12:54428734-54428756 CTGGGGAGACTGCTGGTGAGGGG - Intergenic
1096876144 12:54631921-54631943 CTGGGTGGAGTGGGGGTGGGGGG - Intronic
1100616334 12:96234486-96234508 GTGGGTGGACGGCGGGTGGTGGG - Intronic
1103495243 12:121357054-121357076 CTTGGGAGGCCGAGGGTGGGAGG + Intronic
1103800119 12:123532693-123532715 CTGGGGAGACTGGGGGGGGGGGG + Intronic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1112029468 13:95443834-95443856 CTGGCTAGCCCTCGGGTTGGAGG + Intronic
1114659508 14:24335335-24335357 GTGGGGAGACCGAGGGCGGGGGG + Intronic
1118423369 14:65633002-65633024 CTGGGGAGACGGGGGGGGGGAGG - Intronic
1118971704 14:70642647-70642669 CTGGGGAGAACCCGGGAGGGAGG + Intronic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126523222 15:49620901-49620923 CTGGGACGACAGCGGGGGGGGGG - Exonic
1128357190 15:66936440-66936462 CTGGGGACGCCGTGGGTGGGTGG - Intergenic
1128632837 15:69282845-69282867 CTGGGTGAACCTGGGGTGGGTGG - Intergenic
1129361927 15:75029708-75029730 CTGGGTACACAGCGGGTGGCTGG - Intronic
1129671832 15:77611962-77611984 CTGGGAAGAACCCTGGTGGGAGG + Intergenic
1132781052 16:1625897-1625919 CAGGGTAGAGGGCCGGTGGGAGG - Intronic
1133235865 16:4387180-4387202 CTGGGGAGACTGAGGCTGGGGGG - Intronic
1137056791 16:35749889-35749911 CTGGGGAGACCGGGGGCTGGAGG + Intergenic
1137057837 16:35753906-35753928 CTGGGGAGACCGAGGGCTGGAGG + Intergenic
1141622829 16:85246332-85246354 GTGTGTAGACAGCGTGTGGGGGG - Intergenic
1142045096 16:87920167-87920189 CTGTGCAGACCTCGGGTGAGGGG - Intronic
1142142705 16:88479699-88479721 CTGGGTAGCAGGTGGGTGGGGGG - Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1145012456 17:19377744-19377766 CTGCGGAGCCCGCGGGTGGGCGG - Exonic
1150229678 17:63543289-63543311 CTGTGCAGATCGCGGGAGGGAGG - Intronic
1150715908 17:67572458-67572480 CTGGGTAAAGCGGGGGGGGGGGG + Intronic
1151582155 17:74986372-74986394 CTGGGGAGGCCGAGGTTGGGAGG - Intergenic
1151630841 17:75309731-75309753 CTGGGAAGACCTGGGGTGGAGGG - Intergenic
1151713903 17:75821819-75821841 CTGGGTTGGCGGTGGGTGGGAGG + Intronic
1152821353 17:82439341-82439363 CTGGGTGGACCTTGGGTGGGTGG - Intronic
1155096469 18:22560271-22560293 CAGGGAAGACCGCGGGTGTCAGG - Intergenic
1157592117 18:48842261-48842283 CTGAGTAGAACGAGGGTGGTGGG + Intronic
1161078941 19:2300852-2300874 CTGGGGAGACCGCGGTTTGCAGG - Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161790498 19:6356788-6356810 CTTGGTAGACTGAGGTTGGGAGG + Intergenic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1162334411 19:10051613-10051635 CTGGGAATACCGGGGGGGGGGGG - Intergenic
1162547323 19:11338755-11338777 CTGGAAAGACCAAGGGTGGGCGG - Intronic
1163581817 19:18143958-18143980 CTGGGGTGGCCGCTGGTGGGGGG - Exonic
1165413670 19:35677919-35677941 CTGGGTGGGCTGGGGGTGGGGGG + Intronic
1166381894 19:42359072-42359094 TTGGGGAGACGGGGGGTGGGGGG - Intronic
1166830894 19:45639179-45639201 CTGGGGGAACTGCGGGTGGGGGG - Intronic
1167114237 19:47479819-47479841 ATGGGGAGAGAGCGGGTGGGAGG - Intronic
1167610762 19:50506786-50506808 GTGGGTGGACGGTGGGTGGGTGG - Intronic
1167610770 19:50506805-50506827 TTGGGTGGACGGTGGGTGGGTGG - Intronic
1168028764 19:53663312-53663334 CTGGGGACGCCGTGGGTGGGAGG + Intergenic
1202714904 1_KI270714v1_random:36740-36762 CGGTGTACACAGCGGGTGGGGGG + Intergenic
927312599 2:21647964-21647986 CTGGGGAGACCCAGGGCGGGGGG + Intergenic
930018155 2:46984877-46984899 CTGGGCAGCCCGTGGGTGTGTGG + Intronic
945133740 2:206603274-206603296 CTGAGTAGCTCACGGGTGGGTGG - Intronic
945203727 2:207310213-207310235 CGGGGTGGAGGGCGGGTGGGAGG + Intergenic
948834513 2:240619743-240619765 CTGGGGAGACCTCCGGTTGGGGG - Intronic
1172780632 20:37435000-37435022 ATGGGTACACGGTGGGTGGGAGG - Intergenic
1173807179 20:45933844-45933866 CTGGGGAGACCGGAGATGGGTGG + Intergenic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1176086174 20:63296568-63296590 CTGGGCAGACAGCGGCTGGTGGG - Intronic
1176172057 20:63700531-63700553 CTGTGAAGACAGCGGGTGTGAGG + Intronic
1177593291 21:23201812-23201834 CTGGTTAGTCCGCTGGTGAGGGG + Intergenic
1180135004 21:45856592-45856614 CGGGGCAGAGCGGGGGTGGGGGG - Intronic
1181555810 22:23671147-23671169 CTGGGAGGGCCCCGGGTGGGAGG + Intergenic
1182080770 22:27527097-27527119 CTGGCGAGGCTGCGGGTGGGAGG + Intergenic
1183593201 22:38793808-38793830 CTGGGCAGGCCTTGGGTGGGTGG + Intronic
1184488183 22:44793972-44793994 CTGGGGAGACCGAGGGAGCGAGG + Intronic
955410459 3:58652406-58652428 ATGGGTAGATGGTGGGTGGGTGG - Intronic
957081397 3:75638979-75639001 CGGGGTGGGGCGCGGGTGGGTGG + Intergenic
965757353 3:172040106-172040128 CTGGGAAGGCTGGGGGTGGGGGG - Intronic
967147771 3:186620630-186620652 CTGGGTCCACCACGGGTGTGGGG - Exonic
969100620 4:4765546-4765568 CTGGGTTGAAGGTGGGTGGGAGG - Intergenic
969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG + Intronic
969617333 4:8261550-8261572 CTGGGTAGAAATCGGGGGGGGGG - Intergenic
970771212 4:19614955-19614977 CTGCTTAGAGCGTGGGTGGGGGG - Intergenic
984534775 4:180960664-180960686 CAGGGGAGACGGGGGGTGGGGGG - Intergenic
985559263 5:574250-574272 CTGGGTAGACCCCGGGAGGTGGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
992527645 5:77628318-77628340 ATGGGGAGGCCGTGGGTGGGAGG - Intergenic
1000149849 5:158488997-158489019 CTAGGGAGACGGTGGGTGGGTGG + Intergenic
1001793565 5:174482931-174482953 CTCTGTAGAACGGGGGTGGGAGG - Intergenic
1004624791 6:17364640-17364662 CTCGGGAGGCCGAGGGTGGGAGG - Intergenic
1006043113 6:31271353-31271375 CTGGGCTGACCGCGGGGGCGGGG - Intronic
1007217302 6:40250290-40250312 CTGATTAGACTGGGGGTGGGAGG + Intergenic
1008558583 6:52700564-52700586 GTGGGCAGACCGCGGGAGGGTGG + Intergenic
1019342814 7:516659-516681 CCCGGTGGACCACGGGTGGGTGG - Intronic
1019936927 7:4263362-4263384 CTGCGTAGACCTCTGCTGGGTGG + Intronic
1021221904 7:17984506-17984528 CTGGGTAGTCCAGGTGTGGGAGG - Intergenic
1023567820 7:41540966-41540988 TTGGGTAGACAACGGGAGGGTGG + Intergenic
1024837172 7:53535334-53535356 CTCCGTAGACCAGGGGTGGGTGG + Intergenic
1028887188 7:95947477-95947499 CTGGGTAGACCAATGGTGGCAGG - Intronic
1032013602 7:128361764-128361786 GTGGGGGGACCGCGGGTGGCGGG - Intergenic
1032078024 7:128845304-128845326 CTGGGTAGTCCGTGGGAGGGAGG + Intronic
1042020591 8:64369448-64369470 CCGGCTAGTCCGCGGGCGGGCGG + Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049592181 8:143467767-143467789 CTGGGCAGAGGGCGGGAGGGAGG - Intronic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1054809662 9:69425047-69425069 GTGGGAAGACAGCTGGTGGGAGG - Intergenic
1057259503 9:93576236-93576258 CGGGGGAGAAGGCGGGTGGGGGG - Intergenic
1057326482 9:94069281-94069303 TTTGGTATACCGGGGGTGGGAGG - Intronic
1059714975 9:116905152-116905174 CTGGAGGGGCCGCGGGTGGGTGG + Intronic
1060992587 9:127857346-127857368 TTGGGACCACCGCGGGTGGGGGG + Intergenic
1061597705 9:131642912-131642934 CTGGATTCACTGCGGGTGGGAGG - Intronic
1061950857 9:133935109-133935131 CTGGGCAGGCCAAGGGTGGGAGG + Intronic
1062003796 9:134229501-134229523 TTGGGTGGACTGCGGGTGGTAGG - Intergenic
1062530048 9:136995762-136995784 GTGGGTGGAGCGGGGGTGGGGGG + Intronic
1185745485 X:2569408-2569430 CTGGGTAGACTGAGAGTCGGTGG - Intergenic
1190730865 X:53224730-53224752 CGGGGCTTACCGCGGGTGGGCGG + Exonic
1200099674 X:153684415-153684437 GTGGGAAGGGCGCGGGTGGGGGG + Intronic
1200279252 X:154762847-154762869 CAGGGCAGTGCGCGGGTGGGTGG + Exonic