ID: 969469182

View in Genome Browser
Species Human (GRCh38)
Location 4:7376911-7376933
Sequence ACTGGGGCTGGAACATCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469182_969469192 19 Left 969469182 4:7376911-7376933 CCCACGGATGTTCCAGCCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 103
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469182_969469194 30 Left 969469182 4:7376911-7376933 CCCACGGATGTTCCAGCCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 103
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469182_969469185 -10 Left 969469182 4:7376911-7376933 CCCACGGATGTTCCAGCCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 103
Right 969469185 4:7376924-7376946 CAGCCCCAGTGCACAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469182 Original CRISPR ACTGGGGCTGGAACATCCGT GGG (reversed) Intronic
901858805 1:12061572-12061594 ACTGGGCCTGGTACATCCAGAGG + Intergenic
902913256 1:19617290-19617312 ACAGAGGCTGGAACATCTGCAGG - Intronic
903199326 1:21720885-21720907 AGTGGGGCTGGCACAACCGCTGG + Intronic
904334443 1:29787634-29787656 CCTGGGGCTGGAACCTTAGTGGG + Intergenic
910743514 1:90547910-90547932 GCTGGGGCTGGATTATCCATAGG + Intergenic
918008550 1:180564821-180564843 AGTGGGGCTCAAACATCAGTGGG - Intergenic
918254048 1:182731959-182731981 ACTGAGGCTGGAAGACCTGTGGG + Intergenic
920164485 1:204026047-204026069 ACTGGGGGTGGAAAGTCCATGGG + Intergenic
923703921 1:236327704-236327726 ACTGAGGCAGGAGCATCCTTTGG - Intergenic
1065351249 10:24797507-24797529 ACTGAGGCAGGAAGATCCCTTGG - Intergenic
1067030538 10:42876637-42876659 CCTGGGGCTGGCGCATCCCTTGG + Intergenic
1067211396 10:44262652-44262674 GCTGGGGCTGGATCATCTGCAGG + Intergenic
1067778002 10:49176942-49176964 ACTTCGGCTGGACCATGCGTGGG - Intronic
1068062326 10:52083879-52083901 ACAGGGGCTGGAAGATCAGTGGG + Intronic
1069345433 10:67463977-67463999 ACTGGGGTTAGAGCATTCGTAGG - Intronic
1072031632 10:91527313-91527335 ACTGGGGCATGAACATCTTTGGG + Intergenic
1072159257 10:92751077-92751099 ACTGGGTTTCGAACATCCTTGGG - Intergenic
1072205037 10:93196064-93196086 GCTGGGGCTGCAACATCCAAAGG - Intergenic
1075094090 10:119459909-119459931 ACTGGAGCTGGGCCATCTGTGGG - Intergenic
1076348755 10:129800144-129800166 GCTGGGCCTGGAGCAGCCGTGGG - Intergenic
1076516328 10:131046764-131046786 CCTGAGGCTGGATCATCCCTCGG + Intergenic
1078333307 11:10443975-10443997 ACTGGGGCTATAACATCTCTGGG - Intronic
1084742280 11:71147412-71147434 ACTGGCGCTGGAACACACGTGGG + Intronic
1086667231 11:89497760-89497782 ACTGGGCTTGGAACATCAGTAGG + Intronic
1096720454 12:53517309-53517331 ACAGGGGCTGGAGAACCCGTTGG + Exonic
1100113226 12:91271099-91271121 ACTGGGACTGAAACATTGGTTGG - Intergenic
1103232133 12:119340398-119340420 ACTGGGGCTTGAAGATCCCCAGG + Intronic
1115451146 14:33548972-33548994 ACTGGGGATGAAACATTTGTTGG - Intronic
1119893349 14:78199680-78199702 ACTGGGCCTGGAACCTCAATTGG + Intergenic
1121719696 14:96100679-96100701 ACTGGGCCTAGAAAATCAGTCGG + Intergenic
1121986758 14:98514259-98514281 ACTGGGGCTGAAAAAACCTTTGG + Intergenic
1128101093 15:65000519-65000541 ACCTGGGCAGGAAGATCCGTTGG - Intergenic
1129652953 15:77504539-77504561 GCTGGGGCTGGAGTTTCCGTTGG + Intergenic
1129980299 15:79863238-79863260 ACTGGGAGTGGACCATCCCTTGG - Intronic
1130195192 15:81772790-81772812 ACAGGACCTGGAACATCCCTAGG - Intergenic
1131758888 15:95597960-95597982 AGTGGGGCTGGCGCATCCCTGGG + Intergenic
1135527904 16:23228082-23228104 ACTGAGGCAGGAAAATCCCTTGG - Intergenic
1138535335 16:57657024-57657046 CCTGGGGCTTGAACACCCCTGGG + Intronic
1139233912 16:65314722-65314744 CCTGGTGCTGGAACATACTTGGG - Intergenic
1139840354 16:69873538-69873560 CCTTGTGCTGGAACATCCGGTGG + Intronic
1140019578 16:71225267-71225289 CCTGGGCCTGGAACATTCCTAGG + Intronic
1141435251 16:83996202-83996224 CCTGGGGCTGGAAAAGCCATAGG - Intronic
1144088848 17:11835261-11835283 ACTGGAGCAGGAAGATCCCTGGG - Intronic
1146354161 17:32120057-32120079 GCTGGGGCTGGAATATCTGAAGG - Intergenic
1147582936 17:41637065-41637087 TCTGGGGCTGGAAGAGCCATTGG - Intergenic
1147594556 17:41708459-41708481 ATTGGGGCAGGAACATCTTTGGG + Intergenic
1150328572 17:64276268-64276290 ACTGGTGCTGGAAAATGCGAGGG + Intergenic
1157912039 18:51625386-51625408 GCTGGTGCTGGAACATCTGAAGG + Intergenic
1158001067 18:52619814-52619836 ACTGGGGCTGGATTTTGCGTAGG - Intronic
1158953737 18:62521810-62521832 GGTGGTGCTGGAACATCTGTTGG - Intergenic
1160716711 19:580043-580065 ACTGGGGCTGGGACGGCCCTGGG + Intronic
1161281163 19:3446465-3446487 ACTGGGGCTGGATCATTCTCTGG - Intronic
1161326171 19:3665241-3665263 ACTGGGGCTGGACCGTTCTTTGG + Intronic
1161654002 19:5502260-5502282 ACTGGGGCTGTATCATCTGAAGG - Intergenic
1166123262 19:40698683-40698705 ACTAGGGCTGGAGACTCCGTGGG + Intronic
1167146060 19:47681255-47681277 CCTGGGGCAGGAACATCTGCAGG - Exonic
1167355801 19:49003301-49003323 ACTGGGGCTGGACGATGCCTTGG + Exonic
927652252 2:24919918-24919940 ACGAGGGCTGGGAGATCCGTGGG + Intergenic
927849821 2:26491811-26491833 CCTGGGGCTGGCACATCTGCGGG - Intronic
935603917 2:104950553-104950575 ACTAAGGCTGGAACATATGTGGG + Intergenic
946407165 2:219497893-219497915 CCTGGGGCTGGAACCTGGGTGGG + Intronic
948942803 2:241204475-241204497 CCTGGGGCTGGAACACGGGTGGG + Intronic
1171504532 20:25623165-25623187 ACTGGGGCTGGAACACGGGAAGG + Intronic
1172284650 20:33732161-33732183 GCCGGGGCTGGAACAGCCGCGGG + Intronic
1174058989 20:47819217-47819239 ACTGGGGGTGGCACATGGGTGGG - Intergenic
1180979745 22:19872901-19872923 ACTGGGGCTGGAGTGGCCGTGGG + Intergenic
1181174081 22:21026214-21026236 TCGGGGGCTGGAACATGGGTTGG + Intronic
1181440229 22:22931935-22931957 TCTGGGGCTGGAACAGCCCAAGG - Intergenic
1181689486 22:24550629-24550651 ACTGGGGCTGGCACAGCAGGAGG - Intronic
1181773647 22:25144562-25144584 ACTTGGGCTGGAATACCCTTCGG + Intronic
1183022048 22:35035074-35035096 ACTGGGACTGGAACATCTTTTGG + Intergenic
949343897 3:3058755-3058777 ACTGGGGCTGGAGCTACCCTAGG - Intergenic
954429896 3:50464956-50464978 ACTGGGGCTGGAGCAACCTCAGG + Intronic
959690764 3:109195366-109195388 ACTGGGGCAGGAAATTCCGCAGG + Intergenic
962413262 3:135160126-135160148 TCTGGGGATGTAACATCTGTGGG - Intronic
968795680 4:2702597-2702619 AGTGGGGCTGGGATATCTGTGGG - Intronic
969469182 4:7376911-7376933 ACTGGGGCTGGAACATCCGTGGG - Intronic
969469926 4:7381752-7381774 ACTGGGGCTGGAATGTCAGTGGG - Intronic
973329267 4:48896069-48896091 ATTGGGGCTGGGACATCTATGGG - Intronic
976280153 4:83319303-83319325 TTTGGGGCTGGAACATCTCTAGG + Intronic
976592596 4:86863780-86863802 AGTGGGGCTGGATCATGAGTGGG + Intergenic
978101508 4:104847171-104847193 AATGGGGGTGGCACATCCGTGGG + Intergenic
981800480 4:148649366-148649388 ACTGGTGCTGGACCCTCCCTAGG + Intergenic
983897673 4:173099232-173099254 TGCGGGGCTGGAACATCCCTCGG + Intergenic
986762106 5:10889648-10889670 ACTGGGCCTGTAACTTCAGTGGG - Intergenic
993242385 5:85407382-85407404 ACCTGGGCTGTAATATCCGTGGG - Intergenic
996590992 5:125147583-125147605 ACTGGGGCTGGAGGATCAGTGGG - Intergenic
999441831 5:151607431-151607453 GCTGGGGCTGGAAGATCTTTAGG - Intergenic
1002454905 5:179340313-179340335 ACTGCAGCTGGGACTTCCGTGGG - Intronic
1009011891 6:57853037-57853059 ATTGTGGCTGCAACATCTGTGGG + Intergenic
1010684104 6:78831732-78831754 ACTGGGGCTGGAACCTTGGAGGG - Intergenic
1014976552 6:127892076-127892098 AGTGGGGCTGGGAAACCCGTAGG - Intronic
1017005390 6:150025198-150025220 ACTGGGGCAAGAACAGCCTTGGG + Intronic
1019314966 7:380102-380124 CCTGGGGGTGGATCATCCGGGGG - Intergenic
1019340971 7:508787-508809 GCTGGGGCTGGCACCTCCCTGGG - Intronic
1027053322 7:75033104-75033126 ACTGGAGCCGGAACATCCATGGG + Intronic
1039580877 8:38666052-38666074 ACCGGGGGTGGAACCTCTGTCGG - Intergenic
1039634098 8:39144228-39144250 ACTGGGACTGGATCAACAGTGGG - Intronic
1042435061 8:68754580-68754602 ACTGTGGCTGGGACAGCCTTGGG - Intronic
1047401694 8:124553564-124553586 GCTTGGCTTGGAACATCCGTCGG + Exonic
1049242276 8:141544028-141544050 TCTGGGGCTGGAAGCTCCTTGGG + Intergenic
1049620348 8:143595572-143595594 AGTGGGGCTGGAATATCCAGGGG - Intronic
1051215480 9:14793302-14793324 AATGGCACTGGAACATCTGTAGG - Intronic
1056207673 9:84335992-84336014 TGTGTGGCTGGGACATCCGTTGG - Intronic
1056577287 9:87866031-87866053 ACTGGGGATGGCACATACATGGG + Intergenic
1057827032 9:98379159-98379181 ACTGGGGCGGGAACAGACTTGGG - Intronic
1060192439 9:121601488-121601510 ACTGGTTCTGGAACAACCCTTGG + Intronic
1062288779 9:135785463-135785485 GCTGGGGCCGACACATCCGTGGG - Intronic
1062658464 9:137615901-137615923 CCTGGGGCTGGAACGTCTGCAGG - Exonic
1188370542 X:29364802-29364824 ACAGGGACTTGAACATCTGTGGG + Intronic
1197155025 X:123261140-123261162 CCTGGGGTTGGACCATCAGTAGG + Intronic
1197593650 X:128441018-128441040 ACTGGGGCTGGATGATGCTTTGG + Intergenic