ID: 969469183

View in Genome Browser
Species Human (GRCh38)
Location 4:7376912-7376934
Sequence CACTGGGGCTGGAACATCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469183_969469194 29 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469183_969469195 30 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469183_969469192 18 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469183 Original CRISPR CACTGGGGCTGGAACATCCG TGG (reversed) Intronic