ID: 969469183

View in Genome Browser
Species Human (GRCh38)
Location 4:7376912-7376934
Sequence CACTGGGGCTGGAACATCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469183_969469195 30 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469183_969469192 18 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469183_969469194 29 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469183 Original CRISPR CACTGGGGCTGGAACATCCG TGG (reversed) Intronic
900114515 1:1022791-1022813 CACAGGGGCTTGAACAGCTGGGG - Intronic
902396789 1:16136258-16136280 CACAGGGGCTGGCACATCAGAGG + Intronic
903127675 1:21258817-21258839 CTCGGGGGCTGGAACATCACAGG - Exonic
903213053 1:21829309-21829331 CCCTGGGGCTTGAAGAGCCGAGG + Intronic
903281548 1:22252904-22252926 CATTGGGCATGGAGCATCCGAGG + Intergenic
904156915 1:28491499-28491521 CACTGGGGGTGGGACCTCCAGGG + Intronic
904334441 1:29787633-29787655 CCCTGGGGCTGGAACCTTAGTGG + Intergenic
905514908 1:38555522-38555544 CACTGGTCCTGGCACATCTGGGG - Intergenic
907759580 1:57343989-57344011 CACAGTGGCTGGCACATCAGTGG - Intronic
908386892 1:63651496-63651518 CACTGGGGATGGAACAGGCCAGG - Intronic
908799001 1:67859592-67859614 CACTGGGGCAAGAACATCTTTGG - Intergenic
908905439 1:69003554-69003576 CACTGGGCCTAGATCATCAGTGG + Intergenic
910555695 1:88529902-88529924 CTGAGGGGCTGGAACATCCAGGG - Intergenic
916444734 1:164861835-164861857 CCCTGGGGCAGGAACATATGTGG + Intronic
916529818 1:165646180-165646202 CTCTGGGGCTGGCACAACCCAGG + Intronic
916749918 1:167714437-167714459 CACTGCGAGTGGAACAGCCGGGG + Intergenic
918872449 1:189992987-189993009 CACTGGGGCTGGAACTGCCCAGG - Intergenic
919784280 1:201249332-201249354 CAGTGGGGCTGGAACAAAGGTGG - Intergenic
920237918 1:204521465-204521487 AACTGGGGCTGGAAGATGTGTGG + Intronic
922555727 1:226530776-226530798 CACAGAGGCTGGCACATCCCGGG - Intergenic
922569502 1:226625638-226625660 CACTGTGGCTGTAACATCGTGGG - Intergenic
922764119 1:228148826-228148848 CCCTGTGGTTGGAACATCCTGGG + Exonic
922978327 1:229803452-229803474 AGCTGGGGCTGGAGCAGCCGTGG - Intergenic
1064148208 10:12842024-12842046 CACTGGGGTTGCCACATCCCAGG + Intergenic
1067320879 10:45219693-45219715 CACTGGGGCCGGAATGTCAGAGG + Intergenic
1067474607 10:46557219-46557241 ACCTGGGGCTGGAAAGTCCGAGG - Intergenic
1068062325 10:52083878-52083900 TACAGGGGCTGGAAGATCAGTGG + Intronic
1069061795 10:63902517-63902539 CACTGGGGCAGCAACGTCCTGGG - Intergenic
1070776334 10:79112009-79112031 CCCTGGGGCATGAACATCCAGGG + Intronic
1072564689 10:96607746-96607768 TGCTTGGGCTGGAACATCCAAGG - Intronic
1073449619 10:103601786-103601808 CACTGAGGCTGGAAGAGCCCAGG + Exonic
1075094091 10:119459910-119459932 CACTGGAGCTGGGCCATCTGTGG - Intergenic
1077054421 11:583939-583961 CCCTTGGGCTGGAAAATCCATGG + Intronic
1078333308 11:10443976-10443998 CACTGGGGCTATAACATCTCTGG - Intronic
1078475048 11:11622473-11622495 CGCTGGGGCTGGCACTTCCTTGG - Intergenic
1078508952 11:11971435-11971457 TACTGTGGCTGGAACATCATGGG + Intronic
1083651196 11:64205884-64205906 CACTGGGGTTGGAGCATGCAGGG - Intergenic
1083852129 11:65374371-65374393 CACTGCGGCTGGAAGCTCAGAGG + Intergenic
1084547084 11:69819856-69819878 CACTGGGACGGGATCCTCCGAGG - Intergenic
1084742279 11:71147411-71147433 CACTGGCGCTGGAACACACGTGG + Intronic
1084900730 11:72308038-72308060 CAGTTGGGCTGGATTATCCGAGG - Intronic
1085307462 11:75496110-75496132 AACTGGGGTTGGAAGACCCGGGG - Intronic
1100012908 12:89975172-89975194 CACTGGGGCAGGAACTACTGAGG + Intergenic
1103016657 12:117499979-117500001 CACTGGGGCTGAATCAACCCTGG + Intronic
1104001767 12:124864438-124864460 CCCTGGGGCTGGAGCCTGCGGGG - Intronic
1104729769 12:131098326-131098348 GGCTGGGGCTGGAGCATGCGGGG + Intronic
1108321796 13:49297393-49297415 CAGTGAGGCTGGACCATCCAAGG + Intergenic
1109914488 13:68962965-68962987 CACTGGAGCTGCAACCTCCTAGG - Intergenic
1113892468 13:113743626-113743648 CACTGTGGCCGGAAGATCAGAGG + Intergenic
1114795711 14:25712641-25712663 AACTGGAGCTGGAACAGCTGGGG + Intergenic
1115578573 14:34735886-34735908 CACTGTGGCTTGTACATCCTGGG - Intergenic
1115968580 14:38919732-38919754 CACTCTGGCTGGAAAATCCAGGG + Intergenic
1118158374 14:63263893-63263915 CACTGGGGGAGGAACAGCTGTGG - Intronic
1128466804 15:67919411-67919433 CACTGTGGCTTCAACATCCTGGG + Intergenic
1130073115 15:80665745-80665767 CACTGAAGCTTGAACATCCTGGG - Intergenic
1133268348 16:4598273-4598295 CACTGCAGCTGGAACCTCCTGGG - Intronic
1134608351 16:15588710-15588732 CACTGCAGCTGGAACCTCCCAGG - Intronic
1135430650 16:22379859-22379881 CACTGGGGCGGCAACGTCCTGGG - Intronic
1137560251 16:49497662-49497684 CACTGTGGCTGGAACCTGCCAGG - Intronic
1139910596 16:70395159-70395181 AACTGGGGCTGCAGCATCTGTGG + Exonic
1141475543 16:84270689-84270711 CACTGGGTCTGGAACGTCCAGGG + Intergenic
1142908856 17:3069949-3069971 CACTGGGGCTGAAGCATCCTGGG - Intergenic
1142925709 17:3234294-3234316 CACTGGGGCTGAAGCATCCTGGG + Intergenic
1143586814 17:7854567-7854589 CACTGGGGCAGGGACACCCCGGG + Exonic
1143918281 17:10310950-10310972 CCCAGGGGCTGAAACATCCACGG - Intronic
1144046136 17:11456313-11456335 CACTGGGGCTGTGACTTCCCAGG + Intronic
1146941820 17:36848603-36848625 CACTGGGGCGGGAACAGGGGAGG - Intergenic
1148554585 17:48570649-48570671 CACTGTAGCTGGAACCTCCGAGG - Intronic
1150136917 17:62701172-62701194 CACTGGGGATGCTACATCCTGGG - Intergenic
1150328571 17:64276267-64276289 CACTGGTGCTGGAAAATGCGAGG + Intergenic
1150979888 17:70129110-70129132 CACTGGGCCTGGAAGCTGCGGGG - Intronic
1154435310 18:14337645-14337667 CTATGGGGCTGGAGAATCCGAGG + Intergenic
1156659889 18:39334945-39334967 CACTGGGGCGGCAACGTCCTGGG - Intergenic
1160209126 18:76861694-76861716 CACTGTGGCTGGAACCTTAGAGG - Intronic
1161268917 19:3378717-3378739 CCCTGGAGATGGAAAATCCGAGG - Intronic
1163622062 19:18367078-18367100 CACTGGGGCTTCAACCTCCCAGG - Exonic
1167320636 19:48795523-48795545 CACTCGGCCTGGAACACCCCAGG - Intronic
1168164264 19:54535894-54535916 GAGTGTGGCTGGACCATCCGTGG + Intronic
1168522822 19:57066043-57066065 CACTGGGGAGGCAACATCCTGGG + Intergenic
925504788 2:4549840-4549862 CACTGAGCCGTGAACATCCGTGG - Intergenic
927849823 2:26491812-26491834 CCCTGGGGCTGGCACATCTGCGG - Intronic
928072036 2:28226796-28226818 CACTGGGGCTAAAACCTCCCTGG - Intronic
934490719 2:94760594-94760616 CTCTGGGGCTGGAGGATCCCAGG - Intergenic
937445945 2:121957968-121957990 CACAGGGCCTGGCACATCCCAGG - Intergenic
944663114 2:201937613-201937635 CACTGGGGGTGGAGCACCTGTGG + Intergenic
947947445 2:234118480-234118502 CTCTGGGGCTGGGACATAGGAGG + Intergenic
948797683 2:240413090-240413112 CGCTGAGGCTGGAGCATCCAGGG + Intergenic
948942801 2:241204474-241204496 CCCTGGGGCTGGAACACGGGTGG + Intronic
1169034008 20:2435000-2435022 CACTGGGGCTGGAATAACCAGGG - Intergenic
1172284649 20:33732160-33732182 CGCCGGGGCTGGAACAGCCGCGG + Intronic
1172284680 20:33732236-33732258 CTCCGGGGCCGGAACAGCCGGGG + Intronic
1172332159 20:34082673-34082695 CCCAGGGGCTGGAGCATCCAGGG - Intronic
1173627685 20:44485556-44485578 CACAGGGGCTGAAACATTTGTGG - Intronic
1174058990 20:47819218-47819240 CACTGGGGGTGGCACATGGGTGG - Intergenic
1176963747 21:15188787-15188809 CAGTGAGGCTGGAACACCCAAGG - Intergenic
1177569943 21:22874462-22874484 CACTGGGGCTCCAACAACCAAGG - Intergenic
1180208378 21:46277572-46277594 CACTGTGGCTGAGACATCCAAGG - Exonic
1180966780 22:19792999-19793021 CACTGGGGCGGCAACATCCTGGG + Intronic
1180979744 22:19872900-19872922 CACTGGGGCTGGAGTGGCCGTGG + Intergenic
1184555618 22:45231416-45231438 CAGTGGGGCCTGAAGATCCGAGG + Intronic
949832410 3:8229918-8229940 CACTGGGGCAGCACCATCGGGGG - Intergenic
950219356 3:11182864-11182886 CACTGGGCCTGGAAAATCCTGGG - Intronic
950555731 3:13694908-13694930 TGCTGGGGATGCAACATCCGGGG - Intergenic
950576766 3:13836849-13836871 CCCTGGGGCTGGAAAAACCAAGG + Intronic
953901917 3:46848420-46848442 CCCTGGGGCTTGGACATCAGTGG - Intergenic
955217570 3:56997181-56997203 CCCTGGGGCTGGGTCATCAGAGG - Intronic
956081615 3:65563365-65563387 CACTGGAGCTTGAACACCTGGGG - Intronic
957312932 3:78543111-78543133 CAGTGGGGCTGGAATATTCAGGG - Intergenic
958807909 3:98834023-98834045 AAGTGGTGCTGGAAAATCCGAGG - Intronic
960796642 3:121494813-121494835 CACTGGGGCGGCAACGTCCTGGG + Intronic
962015976 3:131441357-131441379 GACTGGGGCTGGCACTTCCTTGG - Intergenic
962413263 3:135160127-135160149 CTCTGGGGATGTAACATCTGTGG - Intronic
963354994 3:144200226-144200248 GACTGGCCCTGGAACATCCTTGG + Intergenic
963944280 3:151128498-151128520 CACTGTGGCTGGAACATCACAGG - Intronic
968903600 4:3442089-3442111 GGCTGGGGCTGGAACCCCCGTGG - Exonic
969406928 4:6999646-6999668 CACAGGGCCTGGAACATGCGAGG - Intronic
969469183 4:7376912-7376934 CACTGGGGCTGGAACATCCGTGG - Intronic
969469927 4:7381753-7381775 CACTGGGGCTGGAATGTCAGTGG - Intronic
969564430 4:7969609-7969631 TACTGGGGCTGCAAAATCCAGGG - Intronic
970810435 4:20087005-20087027 CCCTGGGGCTGGGAGATCAGAGG - Intergenic
974053223 4:56960632-56960654 GACTGGGGCAGGAAAATCCCTGG - Intergenic
976592595 4:86863779-86863801 CAGTGGGGCTGGATCATGAGTGG + Intergenic
978101507 4:104847170-104847192 CAATGGGGGTGGCACATCCGTGG + Intergenic
978804717 4:112788156-112788178 CACTGGGGTGGCAACATCCTGGG - Intergenic
986615524 5:9613565-9613587 CACTGGGGCTGCAAGATGCAAGG - Intergenic
986762107 5:10889649-10889671 CACTGGGCCTGTAACTTCAGTGG - Intergenic
992712335 5:79471779-79471801 CACTGTGGCTGGAACAAAAGAGG - Intronic
996590993 5:125147584-125147606 AACTGGGGCTGGAGGATCAGTGG - Intergenic
997445202 5:133935301-133935323 CAGTGGGGCTGGCACATGCAGGG - Intergenic
998188425 5:140001049-140001071 AACTGGGTCTGGAAAATCCAGGG - Intronic
999326500 5:150647510-150647532 CCCTGGGGCAGGAACATACTTGG + Intronic
1001266081 5:170275593-170275615 CCCTGGGTCTGGGACATCAGGGG - Intronic
1001399064 5:171436041-171436063 CAGTGGGCCTGGGACATCTGGGG + Intronic
1001564400 5:172690067-172690089 CAGTGAGCCTGGAACAGCCGAGG - Exonic
1005297511 6:24440983-24441005 ATCAGGGGCTTGAACATCCGTGG - Intronic
1007238204 6:40406098-40406120 CACTGGGGCTTGAACCCCGGTGG - Intronic
1009011890 6:57853036-57853058 CATTGTGGCTGCAACATCTGTGG + Intergenic
1010684105 6:78831733-78831755 CACTGGGGCTGGAACCTTGGAGG - Intergenic
1016648583 6:146438259-146438281 CACAGGGGCTGGGACACCAGAGG + Intergenic
1019001875 6:168760757-168760779 CCCAGGGGCTGGAACATCCCTGG - Intergenic
1019314968 7:380103-380125 ACCTGGGGGTGGATCATCCGGGG - Intergenic
1025118397 7:56278272-56278294 CTCTGGGGTTGGAACATCATAGG + Intergenic
1026202410 7:68225811-68225833 CTCTGGGGTTGGAACATCATAGG + Intergenic
1027053321 7:75033103-75033125 CACTGGAGCCGGAACATCCATGG + Intronic
1030075455 7:105732844-105732866 CACTGAGGCAGGAACATGCTTGG - Intronic
1031999180 7:128253857-128253879 CACTGAGGCTGACACCTCCGTGG - Intronic
1033215414 7:139490029-139490051 GACTGGGGATGAAACATTCGGGG - Intergenic
1035868134 8:3107124-3107146 AACTGGGGCTGAAAAATCCTGGG + Intronic
1036030727 8:4968951-4968973 CACAGGGGCTTGAACATTCATGG - Intronic
1036482515 8:9151202-9151224 CACCGGGGCTGGAACACTCTAGG - Intronic
1038589678 8:28825149-28825171 CCCTGGGGCTTGAACCTCCTGGG + Intronic
1039538375 8:38340725-38340747 AACTGGGCCTGGAACGTCCTAGG - Intronic
1039579275 8:38650885-38650907 CGCTGGGGCAGGAACGGCCGGGG + Intergenic
1039634099 8:39144229-39144251 CACTGGGACTGGATCAACAGTGG - Intronic
1042435062 8:68754581-68754603 CACTGTGGCTGGGACAGCCTTGG - Intronic
1045459827 8:102415753-102415775 CACTGGGGCTCAAACACCTGAGG + Intergenic
1049242275 8:141544027-141544049 CTCTGGGGCTGGAAGCTCCTTGG + Intergenic
1049614864 8:143571711-143571733 CACTGGCCCTGGAGCATGCGCGG - Exonic
1049620349 8:143595573-143595595 CAGTGGGGCTGGAATATCCAGGG - Intronic
1053383959 9:37672327-37672349 CACTAGGTCTGGAACCTCCTGGG + Intronic
1053569786 9:39292163-39292185 CACTGGGGCTGGAAGAGTAGAGG + Intergenic
1053835750 9:42133195-42133217 CACTGGGGCTGGAAGAGTAGAGG + Intergenic
1054127363 9:61326849-61326871 CACTGGGGCTGGAAGAGTAGAGG - Intergenic
1056765621 9:89442962-89442984 CACTGGGGCTAGAGCAACCTCGG + Intronic
1057927505 9:99166279-99166301 CACAGTGGCTGGGACATTCGGGG - Intergenic
1060177570 9:121508280-121508302 CACTGGGGCTGCAACAGCAGAGG - Intergenic
1060736138 9:126067548-126067570 TACTGGGGCTGCAGCATCCCAGG - Intergenic
1061315944 9:129795848-129795870 CACTGGGGCTGGGAGGTCAGAGG + Intergenic
1062196596 9:135277512-135277534 CACTGTGGCTGCTAAATCCGCGG - Intergenic
1062242355 9:135547286-135547308 CAGTGGGGCTGGTGCATCCGGGG - Intronic
1199977712 X:152904157-152904179 CCCTGGGACTGGAGCATCCCAGG + Intergenic