ID: 969469184

View in Genome Browser
Species Human (GRCh38)
Location 4:7376923-7376945
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 2, 1: 0, 2: 3, 3: 24, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469184_969469192 7 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469184_969469194 18 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469184_969469195 19 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469184_969469198 26 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469184_969469196 25 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469184 Original CRISPR CAGGGTTTGTGCACTGGGGC TGG (reversed) Intronic