ID: 969469186

View in Genome Browser
Species Human (GRCh38)
Location 4:7376927-7376949
Sequence AGGCCAGGGTTTGTGCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469186_969469196 21 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT 0: 1
1: 1
2: 3
3: 23
4: 241
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469186_969469194 14 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT 0: 1
1: 1
2: 3
3: 23
4: 241
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469186_969469198 22 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT 0: 1
1: 1
2: 3
3: 23
4: 241
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469186_969469195 15 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT 0: 1
1: 1
2: 3
3: 23
4: 241
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469186_969469192 3 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT 0: 1
1: 1
2: 3
3: 23
4: 241
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469186 Original CRISPR AGGCCAGGGTTTGTGCACTG GGG (reversed) Intronic
900157786 1:1210500-1210522 ATGCCTGGGTTTCTCCACTGTGG + Intergenic
900388789 1:2424371-2424393 AGGCCAGGGTTTGGGGAATGGGG - Intergenic
900474367 1:2869339-2869361 AGGCCAGAGTGGGAGCACTGAGG + Intergenic
900538697 1:3191990-3192012 ACTCCAGGGTTTTTGCAATGTGG + Intronic
900694696 1:4002456-4002478 AGGCCAGGCCATGGGCACTGGGG + Intergenic
902171266 1:14613274-14613296 AGGCCGGGGATTGTACTCTGAGG + Intronic
902689142 1:18098893-18098915 AGGACATGGTTTGTGCCCTGAGG - Intergenic
903352401 1:22725630-22725652 TTGCCAAGGTTTTTGCACTGGGG + Intronic
904370532 1:30045029-30045051 AGGCCCTGGTCTGGGCACTGAGG - Intergenic
904917708 1:33982341-33982363 AGCCCAGGGCTTGGGCACTGTGG - Intronic
905408760 1:37754111-37754133 AGGGCAGGGTCTCCGCACTGGGG - Intronic
905868572 1:41390229-41390251 GGGCGGGGGTGTGTGCACTGTGG + Intergenic
906153939 1:43603288-43603310 AGGCCAGGGGTTGTGGAAGGTGG - Intronic
907027207 1:51132146-51132168 TTGTCAGGGTTTTTGCACTGTGG - Intronic
908769518 1:67583375-67583397 GGGCCAGAGTTTGTGGACTGCGG - Intergenic
909457479 1:75866643-75866665 AGTCCAGGTATTGTGCAGTGGGG + Intronic
910990169 1:93047753-93047775 AGGCCAGGGTTTGTGTAGGATGG - Intergenic
915290148 1:154878047-154878069 AGGCCCTGTTTTGGGCACTGGGG - Intergenic
915456739 1:156045308-156045330 AGGCCAGGGTTCATGCACCATGG + Intronic
915495107 1:156276868-156276890 AGGCCTGGGATTGTGGACTAAGG - Intronic
917211759 1:172638938-172638960 AGGACATGGTTTGTGTCCTGTGG + Intergenic
918475321 1:184918199-184918221 AGGGCAGGGTTTGCTGACTGTGG - Intronic
920540536 1:206774546-206774568 AGGCCAGGGGTTCTGGACTCTGG + Intergenic
922418208 1:225441307-225441329 AGGCCAGGGTGTGTACATGGAGG - Intergenic
924949349 1:248867845-248867867 AGGCCAGCCTCTGTGGACTGAGG + Intergenic
1064132739 10:12724369-12724391 GGGCCAGGGTTTGTGTTCTGGGG + Intronic
1067052214 10:43028278-43028300 AGGCCAGGCTCTGAGCCCTGGGG - Intergenic
1068894974 10:62189118-62189140 AAGCCAGGGTTTGTCAACTCTGG + Intronic
1069509189 10:69028570-69028592 CGGCCAGGTTTTGTTCACTGAGG + Intergenic
1069596490 10:69675168-69675190 TGGCCAGTGGTTGTCCACTGGGG + Intergenic
1071523879 10:86347103-86347125 GGGCCAGGCTTTGAGCTCTGTGG - Intronic
1073483577 10:103802526-103802548 AGGCCAGATTGTGTGGACTGGGG - Intronic
1074776411 10:116771075-116771097 AGTCCAGGGTTTGCAAACTGAGG - Intergenic
1075342001 10:121654390-121654412 TCGCCAGGGTTTGTCTACTGCGG - Intergenic
1076931614 10:133535449-133535471 AGGCCAGGGATGGGGCACGGTGG - Intronic
1077164119 11:1127441-1127463 AGCCCTGACTTTGTGCACTGGGG - Intergenic
1077273260 11:1691735-1691757 GGGCCAGGGTATCTGCCCTGAGG + Intergenic
1078105988 11:8358239-8358261 ACGTCAGGGTTTGAGGACTGGGG + Intergenic
1079324672 11:19481274-19481296 AGGCCTGGGCTTATGAACTGTGG + Intronic
1081601316 11:44496811-44496833 AGCCCAGGGTCTCTGCACAGGGG + Intergenic
1081965879 11:47169333-47169355 AGGCCAGTCTTTGTGCTTTGAGG - Intronic
1083162700 11:60865069-60865091 AGGACAGGGATGGTGCAATGGGG - Intergenic
1083412670 11:62505086-62505108 AGGCCAGTGTTTGGGCATTGGGG + Intronic
1084536602 11:69761031-69761053 AGTCCATGGTGTGTGTACTGGGG - Intergenic
1086504674 11:87492981-87493003 AGGCAGGGGTTTGTGATCTGCGG - Intergenic
1093272221 12:17078136-17078158 AGACCAGGTTCTGTGCAGTGGGG + Intergenic
1095214431 12:39531119-39531141 AGGGCAGGTTTTGTTCACGGCGG - Intergenic
1096089626 12:48890251-48890273 AGACCAGGGTTTATGCCCTGGGG + Intergenic
1096238202 12:49943845-49943867 TGGCAAGGGTTTGTGCACCAGGG - Intergenic
1096507597 12:52104886-52104908 AGGCCAGGCTCTGAGCTCTGTGG + Intergenic
1099333866 12:81329132-81329154 AGGCCAGTGTTTCTCCTCTGAGG - Intronic
1100337592 12:93646709-93646731 AGGGCAGGGTTTCTGCTCTAGGG - Intergenic
1101693866 12:107106374-107106396 AGGCCATGTTCTGGGCACTGGGG + Intergenic
1102043478 12:109815504-109815526 GGAGCAGAGTTTGTGCACTGGGG - Intronic
1102924331 12:116815403-116815425 AAGCCAAGGTGTCTGCACTGTGG + Intronic
1103360323 12:120349810-120349832 AGGCCAGGGACTGGGCTCTGAGG + Intronic
1104275489 12:127323236-127323258 AGGCCAGGTTCTATGCTCTGGGG + Intergenic
1104973652 12:132542522-132542544 AGGGCCGGGTTTCTGCTCTGAGG - Intronic
1105328853 13:19395573-19395595 AGGAAGGGGCTTGTGCACTGGGG + Intergenic
1105787158 13:23760561-23760583 ATGCCAGGGTGTGGGCACAGAGG + Intronic
1105843091 13:24272374-24272396 GGGCCTGGGTCAGTGCACTGCGG + Intronic
1107546050 13:41434631-41434653 AGGCCAGGCTCTGAGCTCTGTGG - Intergenic
1108517580 13:51217603-51217625 AGACTTGGGCTTGTGCACTGTGG + Intergenic
1110046798 13:70842009-70842031 AGGGCAGGGCAAGTGCACTGTGG - Intergenic
1110699815 13:78533985-78534007 GGGCCAGGGTTTGTGACGTGTGG - Intergenic
1110817609 13:79879409-79879431 AAGCCAGGATTTGTGGACAGTGG - Intergenic
1111531360 13:89541569-89541591 AGGACTGGGTTTGTGCACTGGGG - Intergenic
1111919669 13:94396832-94396854 GGGGCAGTGTTTTTGCACTGGGG + Intronic
1114069309 14:19095286-19095308 AGGCCAGGGTTGATGGGCTGGGG + Intergenic
1114092952 14:19304716-19304738 AGGCCAGGGTTGATGGGCTGGGG - Intergenic
1114493944 14:23119783-23119805 AGGCCAGGGTTTGTTTTTTGAGG + Intergenic
1114700310 14:24671093-24671115 ATGACAGGGTTTCTCCACTGGGG + Intergenic
1117873386 14:60224013-60224035 AGGGCAGGATTTTTGAACTGGGG + Intergenic
1118262437 14:64260103-64260125 AGGATAGGGTTTGTGCAAGGTGG + Intronic
1121269822 14:92630717-92630739 ATGCCAGGCTCTGTGCCCTGTGG - Intronic
1121519133 14:94573913-94573935 AGGACAGGGTTTGGGCACTTTGG - Intronic
1124145975 15:27125812-27125834 AGGCTGGGTTGTGTGCACTGTGG + Intronic
1124439939 15:29678313-29678335 AGGCCAGCCTTTGTGGCCTGTGG + Intergenic
1125723194 15:41854902-41854924 AGGCCAAGGTGTATGCCCTGAGG - Exonic
1126675280 15:51155448-51155470 AGGCAAGGGTGTGCGGACTGGGG + Intergenic
1129210420 15:74064910-74064932 AGGCCAGTGTGTGTGGGCTGGGG + Intergenic
1129323745 15:74788898-74788920 AGGCCTGGGTTAGGGCCCTGGGG + Intronic
1129403594 15:75300463-75300485 AGGCCAGTGTGTGTGGGCTGGGG - Intergenic
1129822919 15:78616940-78616962 AGGCCAGGTTTTAAGCACAGTGG + Intronic
1129840271 15:78739429-78739451 AGGCCAGTGTGTGTGAGCTGGGG - Intergenic
1129921427 15:79322455-79322477 AGGCCAGGGATTAGCCACTGTGG + Exonic
1130688681 15:86061469-86061491 AGGCCCGGGATTAGGCACTGAGG + Intergenic
1130928117 15:88400177-88400199 AGGGCAGGGTTTGTCCACTTTGG - Intergenic
1131088488 15:89599241-89599263 AGGCCAGTTGTTGTCCACTGGGG - Intronic
1132105049 15:99057293-99057315 AGGCCTGGGTTTTTCCACTAGGG + Intergenic
1132593648 16:738105-738127 AGGCAAGGCTTTGTGCCTTGGGG - Intronic
1134399578 16:13897048-13897070 AGACTAGGGTTTGAGCACAGAGG - Intergenic
1135179561 16:20260987-20261009 AGGCCAGTGGATGTTCACTGGGG - Intergenic
1135616004 16:23911728-23911750 AGGCCAGCGTGGCTGCACTGAGG - Intronic
1138275318 16:55730116-55730138 CAGCCAGGGTATGTGCAGTGGGG + Intergenic
1139592668 16:67942198-67942220 AGGCCAGGGTCACTGCTCTGGGG + Intronic
1140646047 16:77031295-77031317 ATGCCATCTTTTGTGCACTGTGG + Intergenic
1140928617 16:79606737-79606759 AGACCAGGGTTTAAGGACTGGGG - Intergenic
1142358134 16:89613712-89613734 AGGCCAGGGTGAGTGGGCTGGGG + Intronic
1144743215 17:17595927-17595949 AGGCAGGGGTTTGTGCTCTGTGG - Intergenic
1144766006 17:17732872-17732894 AGGCCAGGGCTTGAGCACATAGG + Intronic
1145059781 17:19725165-19725187 AAGCCAGGCTTTGTTCAGTGGGG - Intergenic
1145274942 17:21423652-21423674 AAGCCAGAGTTGGTGCAGTGTGG + Intergenic
1145305423 17:21671679-21671701 TGGCCAGGGCTGCTGCACTGGGG - Intergenic
1145312796 17:21709552-21709574 AAGCCAGAGTTGGTGCAGTGTGG + Intergenic
1146276011 17:31516045-31516067 TGGCCAGGGTTTATTCATTGAGG + Intronic
1146569273 17:33938904-33938926 AGGCCAGAGTCTGAGCACAGAGG - Intronic
1147312263 17:39602418-39602440 AGGCCAGGAGCTGTCCACTGTGG - Intergenic
1147384366 17:40072723-40072745 AGCCCAGGGGCTGGGCACTGGGG - Intronic
1150325639 17:64254836-64254858 AGGACAGTGTTTGTCCACAGTGG - Intronic
1152235695 17:79137182-79137204 AGGCCTGCGTGTGTGCACAGAGG - Intronic
1154498004 18:14976529-14976551 AGGCCAGGGTGTCTACACTTCGG - Intergenic
1156237729 18:35220407-35220429 AAGCCAGCGTTTGTTCACTAAGG - Intergenic
1156500463 18:37554233-37554255 AGGCTGGGTTGTGTGCACTGGGG + Intronic
1156508208 18:37612573-37612595 AGGAAAGGGTGTGTGCAGTGTGG + Intergenic
1159023945 18:63166054-63166076 GGGCCAGGCTTTGTGTCCTGTGG - Intronic
1159938766 18:74389521-74389543 AGGCCAGGGGAGGAGCACTGGGG + Intergenic
1160210524 18:76874487-76874509 AGGCAAGTGCTTGTGCGCTGCGG - Intronic
1160242017 18:77131736-77131758 AGGCCGGGGTGTGTGACCTGCGG - Intronic
1160934132 19:1585251-1585273 AGGCCTGGGTTTGGGGTCTGGGG - Intronic
1162784448 19:13025453-13025475 AGGCCGGGGTTCGAGCACTGAGG - Exonic
1163500158 19:17671444-17671466 AGGCCAGGGATTGGGCTGTGGGG + Intronic
1163807567 19:19408894-19408916 AGGCAAGGGCTGGTGCAGTGAGG + Intronic
1164721054 19:30431784-30431806 AGGGCAGGGGCTGTGCGCTGAGG + Intronic
1164892735 19:31839092-31839114 AGACCAGGGTTTGAGTCCTGAGG + Intergenic
1165137482 19:33678833-33678855 AGTCCAGTGGTTGTGCTCTGTGG - Intronic
1165773615 19:38392121-38392143 AGCCCAGGTGATGTGCACTGTGG + Intronic
1167301352 19:48679861-48679883 ACCCCAGGGTCTGTGCTCTGAGG + Intergenic
1168239718 19:55082941-55082963 GGGACAGAGTCTGTGCACTGCGG + Intronic
925532771 2:4883431-4883453 GGCTCAGGGTGTGTGCACTGTGG + Intergenic
925776537 2:7341051-7341073 ATGCCTGGGTTTGTGAGCTGAGG + Intergenic
925899265 2:8496733-8496755 AGGGGAGGGATTGTGCCCTGGGG - Intergenic
926161638 2:10494111-10494133 AGGCCAGTGCCTGTGGACTGAGG + Intergenic
926961347 2:18361826-18361848 AGGCAGGCCTTTGTGCACTGTGG + Intergenic
929139062 2:38651468-38651490 AGGCCAGGGGCTGGGCACAGTGG + Intergenic
930152152 2:48069955-48069977 AGGCCAGGGTGTGGCCACTGAGG + Intergenic
930312937 2:49764593-49764615 AGGACAGGATGTGTGCACTTAGG + Intergenic
933682761 2:85117517-85117539 AGGATATGGTTTGTGCCCTGGGG - Intergenic
934927181 2:98389995-98390017 CAGCCAGGGTTTCGGCACTGTGG + Intronic
935546265 2:104402946-104402968 GGGCCAGGGTTTATGCTCAGGGG - Intergenic
935627246 2:105181351-105181373 ACCCCAGGGATTCTGCACTGTGG + Intergenic
937346778 2:121130965-121130987 TGGGCAGGGTTTGTGGGCTGAGG + Intergenic
940870970 2:158859907-158859929 AGGCCAGGCTCTGAGCTCTGTGG + Intronic
942604901 2:177680137-177680159 AGGCCAGGGTTAGGGCACACTGG - Intronic
943718774 2:191180870-191180892 ATCCCAGTGTTTGTGCAATGGGG - Intergenic
946749543 2:222879821-222879843 AGGCCAGGCAATGTGGACTGTGG + Intronic
948680889 2:239634056-239634078 AGGGATGGGTTTGGGCACTGGGG - Intergenic
948680910 2:239634116-239634138 AGGGATGGGTTTGGGCACTGGGG - Intergenic
948764047 2:240210483-240210505 AGGGCAGGGCTGGTGCACTGAGG + Intergenic
1168895278 20:1319731-1319753 AGGCCAGGGTCTGGGCATTAGGG + Intronic
1169870204 20:10241188-10241210 AGGGCAGGGTGGGTGCAGTGGGG + Intronic
1170541020 20:17388104-17388126 AGGCCAGTGTGTGTGTGCTGGGG + Intronic
1171151455 20:22829810-22829832 ACACCAGGGTAAGTGCACTGCGG - Intergenic
1171530677 20:25851119-25851141 TGGCCAGGGCTGCTGCACTGGGG - Intronic
1173175049 20:40758418-40758440 AGGCAATGTTTTGGGCACTGAGG - Intergenic
1174410115 20:50329961-50329983 AGGCCCTGGGTTGGGCACTGGGG - Intergenic
1176077667 20:63255600-63255622 GGGTCAGGTTTTCTGCACTGCGG + Intronic
1176243896 20:64088273-64088295 GGGCCAGGATCTGTGCATTGAGG + Intronic
1176243978 20:64088656-64088678 AGGCCAGGATCTGTGCAGAGTGG + Intronic
1176243987 20:64088696-64088718 AGGCCAGGGTCTGTGCAGAGTGG + Intronic
1176244020 20:64088854-64088876 AGGGCAGGGTCTGTGCAGAGTGG + Intronic
1176244023 20:64088874-64088896 TGGCCAGGGTCTGTGCAGAGTGG + Intronic
1176244027 20:64088894-64088916 TGGCCAGGGTCTGTGCAGAGTGG + Intronic
1179219752 21:39395761-39395783 AGGCCAGGAGCTCTGCACTGCGG + Intronic
1179996194 21:44975577-44975599 AGGCCAGGTTCTTAGCACTGTGG - Intronic
1180487780 22:15817849-15817871 AGGCCAGGGTTGATGGGCTGGGG + Intergenic
1182450110 22:30414971-30414993 AGGACAGGGTATGTGCATTCAGG + Intronic
1184119516 22:42441013-42441035 AGGCCAGGCTGTGGGCAGTGGGG - Intergenic
1184821336 22:46910998-46911020 GGGCCAGGGGTACTGCACTGGGG + Intronic
1184828183 22:46967497-46967519 ATTGCAGGGTTTGTGCAGTGTGG + Intronic
1184995674 22:48205729-48205751 AGGTCTGCGTTTCTGCACTGAGG + Intergenic
1184995690 22:48205808-48205830 AGGGCTGTGTTTCTGCACTGAGG + Intergenic
950283682 3:11728072-11728094 AGGCCAGGGGCTGGGCACGGTGG - Intergenic
952900630 3:38109566-38109588 AGCCCAGGGTTGGTGGTCTGGGG + Intronic
954381277 3:50220569-50220591 AGGCCACGGTCTGCGCCCTGGGG + Exonic
957042981 3:75351182-75351204 AGGCCAGGCTCTGAGCTCTGTGG - Intergenic
959702178 3:109308910-109308932 AAGGCAGGGTTTCTTCACTGTGG - Intronic
960967417 3:123114864-123114886 AGCCCAGGGTTCGCGTACTGGGG + Intronic
961452599 3:127009155-127009177 AGCCCAGGGTTCGAGCAGTGGGG + Intronic
961467684 3:127091478-127091500 AGGCGGGGGTTTGTGGGCTGAGG + Intergenic
961536279 3:127572934-127572956 AGCCCAGGGCTTGGGCACTGGGG + Intergenic
961654241 3:128432803-128432825 AGGCCAGGTTTCGGGGACTGCGG + Intergenic
961943000 3:130656700-130656722 AGCCCAGGCTGTTTGCACTGAGG + Intronic
963080501 3:141388905-141388927 AGGTCAAGGTTTGTGTACAGAGG + Intronic
969469186 4:7376927-7376949 AGGCCAGGGTTTGTGCACTGGGG - Intronic
969469930 4:7381768-7381790 AGTCCAGGGTTTGTGCACTGGGG - Intronic
969983314 4:11180917-11180939 TGACCAGGCTTTTTGCACTGGGG + Intergenic
970285456 4:14508201-14508223 AGGCCAGTGTTTGTTCTCTTAGG - Intergenic
972714368 4:41631269-41631291 AGGCAAAAGTTTGTGCACTTTGG + Intronic
976218903 4:82740366-82740388 AGTGCAAGGTTTGTCCACTGGGG + Intronic
981935119 4:150230951-150230973 ACACCAGGGTTTGTGCAAGGAGG - Intronic
983875476 4:172869993-172870015 ATACCAGGGTGTGTGGACTGAGG - Intronic
984674864 4:182535399-182535421 AGGCCAGGATTTGGGCAGAGAGG + Intronic
985949407 5:3211846-3211868 AGGCATAGGTATGTGCACTGAGG + Intergenic
986632160 5:9784277-9784299 AGGCCAAGGTCTGTCCACAGAGG + Intergenic
986668492 5:10123742-10123764 AGGCCTGCGTTTCTGCACAGCGG - Intergenic
987843447 5:23251794-23251816 AGGGCAGGGTTTGTGCACTATGG - Intergenic
987926314 5:24346393-24346415 AGGCCAGGTTTTGTGCTTTGGGG + Intergenic
990983565 5:61622123-61622145 AGGCCTGGGTTTGGTAACTGGGG + Intergenic
991292367 5:65045206-65045228 AGGCCAGGGTGTGTTCTATGGGG - Intergenic
992078835 5:73215870-73215892 AGGGCAGGGTGTCTGCAGTGAGG - Intergenic
996354705 5:122582719-122582741 AAGACAGTGTTTGGGCACTGTGG - Intergenic
996496789 5:124167106-124167128 AGCTCAGTGTTTGTGCTCTGAGG - Intergenic
997610098 5:135209788-135209810 AGGCCAGGGTCTGAGCCCTAAGG - Intronic
998161421 5:139814818-139814840 AGGCCAGGGTGTGTGCTTTGGGG - Intronic
999266767 5:150271591-150271613 AATCCATGGTTTGTGCAGTGCGG - Intronic
1001143125 5:169161760-169161782 AGGCCAGGTACTGTCCACTGTGG + Intronic
1002126699 5:177050966-177050988 GGACCAGGGTTTGGCCACTGGGG + Intronic
1002326844 5:178415403-178415425 AGGCCACAGCCTGTGCACTGAGG - Intronic
1002414567 5:179112886-179112908 AGGCCAGGGTTAGTGGACAGGGG + Exonic
1002418229 5:179132016-179132038 AGGCCAGGGTTTGGGATCAGAGG - Intronic
1002452642 5:179327678-179327700 AGGCCAAGGTTTGTCCACTTTGG + Intronic
1003347789 6:5286926-5286948 AGGTCAGGCTTTCTGCACTACGG - Intronic
1007795362 6:44342780-44342802 AGGCCCGGGTCTGTGCTCAGAGG - Exonic
1007926975 6:45657669-45657691 AGGCTTGGTTTTGTGCACTATGG + Intronic
1011114536 6:83875461-83875483 GGGTCAGGATTTCTGCACTGTGG + Intronic
1012245246 6:96919005-96919027 AGGACAGGGTATGTGAAATGGGG - Intergenic
1015074468 6:129138852-129138874 AGGCCAAGGGTTGAGCACTGTGG + Intronic
1016768674 6:147824085-147824107 TGGCCAGGCTCTGAGCACTGAGG - Intergenic
1018054617 6:160041154-160041176 AGGACAGGGGTTGTGCTGTGGGG - Intronic
1018717327 6:166543633-166543655 AGGCCAGGGACTGTGCCCAGGGG - Intronic
1020036785 7:4968638-4968660 GGGTGAGGGTTTGTGCACTCAGG - Intergenic
1020164578 7:5797855-5797877 GGGTGAGGGTTTGTGCACTCGGG + Intergenic
1021431322 7:20561440-20561462 AAGGCAGAGTTTGTGTACTGTGG + Intergenic
1023132288 7:37014929-37014951 TGATCAGGGTTTGTTCACTGGGG - Intronic
1023451720 7:40293422-40293444 AGGGCATGGTCTGTGTACTGAGG + Intronic
1025283370 7:57644076-57644098 TGGCCAGGGCTGCTGCACTGGGG - Intergenic
1026589748 7:71684448-71684470 AGCCCAGGGTTTGAACAGTGCGG + Intronic
1026980054 7:74521123-74521145 GAGCCAGGGCCTGTGCACTGGGG + Intronic
1028468780 7:91182146-91182168 AGGCTAGTGTGTGTGCAGTGTGG - Intronic
1028916639 7:96266726-96266748 AGGGGAGGGGTTGTGCAATGTGG - Intronic
1029148244 7:98462084-98462106 AGGCCAGGGCTTGGGCCCCGAGG - Intergenic
1029224001 7:99011918-99011940 AGGCCAGGCTGTGTGCCCTCAGG - Intronic
1029979222 7:104862633-104862655 AGTCAGGGGTTTGGGCACTGCGG - Intronic
1030094493 7:105885877-105885899 AGGCCAGTGTTTCTCTACTGTGG + Intronic
1033586437 7:142778223-142778245 GGCCCAGGGTTTGTCAACTGTGG - Intergenic
1034239333 7:149597789-149597811 GGGCCAGGGTTTGGCAACTGGGG + Intergenic
1034411520 7:150944806-150944828 AGGTCTGGGTGTGTGCAGTGGGG - Intergenic
1035013820 7:155745489-155745511 ACGCCAGGCTTTGTGTCCTGGGG - Exonic
1038938415 8:32277809-32277831 AGGCCAGGGTTTCTCAAATGTGG - Intronic
1040006680 8:42627015-42627037 GGGCCAGGGTTTGTGACCTAGGG + Intergenic
1041101417 8:54399443-54399465 AGGCCAGGATTTGAGCACCCAGG - Intergenic
1042804602 8:72757736-72757758 AGGCCAGGGTTGGCACAATGGGG + Intronic
1043291325 8:78605364-78605386 AGTCCTGGGTTTGTCCACTGCGG - Intergenic
1048949367 8:139481986-139482008 AGGCCATGTTTTGTGCACATAGG - Intergenic
1049357475 8:142195952-142195974 AGGGCAGTGTCTTTGCACTGAGG - Intergenic
1049529592 8:143147747-143147769 AGGCCAGGGTCAGTGGCCTGGGG + Intergenic
1050191720 9:3033400-3033422 AGGCCAGGGTTTGGGGGCTCAGG + Intergenic
1050909857 9:11055101-11055123 AGGCCAAGGTTGGAGCAGTGTGG + Intergenic
1051169604 9:14307066-14307088 AGTGCTGGGTTTGTGCAATGTGG + Exonic
1052520902 9:29547673-29547695 AGGTCACGGTTTCTGCACTATGG - Intergenic
1055611471 9:78030464-78030486 AGGAAAGGGTCTGTGTACTGGGG - Intronic
1056106784 9:83354998-83355020 AGTCCAGCATTTGAGCACTGTGG + Intronic
1057235412 9:93353914-93353936 AGGCCAGGCGTGGTGCACTTTGG - Intergenic
1057428507 9:94973669-94973691 AGGCCTGGGTTTCAGTACTGAGG + Intronic
1059422235 9:114199454-114199476 GGGCCAGGGTTTCTACACAGCGG - Intronic
1059704023 9:116802936-116802958 AGGACAAAGTTTGTGAACTGAGG - Intronic
1060044228 9:120327292-120327314 AGACCAGGGTGTGTGCACTGGGG + Intergenic
1060510455 9:124228551-124228573 AGGCCAGGGCCTGTGTCCTGGGG - Intergenic
1061059519 9:128243545-128243567 AGGCCAGGGTTGGGGTAATGAGG - Intronic
1062188216 9:135229843-135229865 AGACCAGGGTGTGCGCACGGTGG - Intergenic
1189861380 X:45275990-45276012 AGGCCAGGTGTGCTGCACTGGGG + Intergenic
1192569323 X:72189951-72189973 AGGGCAGGGTGTGGGCACAGGGG - Intronic
1194584513 X:95716420-95716442 TGGCCAGGGTTTTGGCATTGGGG - Intergenic
1195068046 X:101255015-101255037 GGGCCAGGGGATGTGCACAGTGG + Intronic
1197715242 X:129701748-129701770 GGGCCAGGGGTTGGTCACTGGGG - Intergenic
1199694742 X:150335886-150335908 ATGCCAGGCATTGTGCTCTGGGG - Intergenic
1200072245 X:153535030-153535052 AGGCCAGGCCATGTGCACTGAGG + Intronic
1202603035 Y:26614023-26614045 AGGAAGGGGCTTGTGCACTGGGG - Intergenic