ID: 969469186

View in Genome Browser
Species Human (GRCh38)
Location 4:7376927-7376949
Sequence AGGCCAGGGTTTGTGCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469186_969469195 15 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT No data
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469186_969469198 22 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT No data
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469186_969469194 14 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT No data
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469186_969469196 21 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT No data
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469186_969469192 3 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT No data
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469186 Original CRISPR AGGCCAGGGTTTGTGCACTG GGG (reversed) Intronic