ID: 969469187

View in Genome Browser
Species Human (GRCh38)
Location 4:7376928-7376950
Sequence CAGGCCAGGGTTTGTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469187_969469198 21 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469187_969469194 13 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469187_969469196 20 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469187_969469195 14 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469187_969469192 2 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469187 Original CRISPR CAGGCCAGGGTTTGTGCACT GGG (reversed) Intronic
900161456 1:1226095-1226117 GAAGCCAGGGTCTGGGCACTGGG - Intronic
900236835 1:1597074-1597096 CAGGCCAAGGCTTGTCCCCTGGG + Intergenic
900295434 1:1946843-1946865 CAGGCCAGACTTTGTCCACCAGG - Intronic
900388790 1:2424372-2424394 GAGGCCAGGGTTTGGGGAATGGG - Intergenic
900694695 1:4002455-4002477 CAGGCCAGGCCATGGGCACTGGG + Intergenic
900736827 1:4304414-4304436 CAGGCCAGTGACTGTGCACAAGG - Intergenic
901268961 1:7935474-7935496 CAAACCAGGGTTTGAGCCCTGGG + Intronic
901773254 1:11541852-11541874 CAGGACAGCATTTATGCACTTGG + Intergenic
902190272 1:14757985-14758007 CATTCCAGGGTGTGTGGACTTGG - Intronic
904287264 1:29460657-29460679 CAGGCCCTGGTCTGGGCACTGGG - Intergenic
904941680 1:34167969-34167991 CAAGTCAGGGACTGTGCACTAGG - Intronic
907856788 1:58311563-58311585 CAAGGCAGGATTTCTGCACTGGG - Intronic
907938714 1:59066358-59066380 CAGGGCAGGGAATGTGCACCAGG + Intergenic
908713443 1:67043871-67043893 CAGGCCAGGGTTTGAGAGGTGGG + Intronic
909457478 1:75866642-75866664 CAGTCCAGGTATTGTGCAGTGGG + Intronic
912048580 1:105492959-105492981 CAGGCCTGAGTCTCTGCACTTGG - Intergenic
915290149 1:154878048-154878070 CAGGCCCTGTTTTGGGCACTGGG - Intergenic
915460083 1:156065083-156065105 CAGGCCAGAGTTTTTGCCTTTGG - Intronic
920855096 1:209655525-209655547 CAATCCAGGCTTTGGGCACTGGG + Intergenic
922725681 1:227922051-227922073 CAGGGCAGGGTCTGCTCACTGGG - Intronic
923193797 1:231644891-231644913 AGGGCCTGGGTTTGTGCCCTAGG + Intronic
923278047 1:232415564-232415586 CAGGCCAGGATCTGCGCACTTGG + Exonic
923437107 1:233977850-233977872 CAGGCCAGGGCGTTTGGACTCGG + Intronic
1064132738 10:12724368-12724390 GGGGCCAGGGTTTGTGTTCTGGG + Intronic
1067175855 10:43944950-43944972 GAGGCCAGGCTGTGTGCACAGGG + Intergenic
1069230213 10:65999403-65999425 CAGCCCAGGGTTTTTAAACTGGG - Intronic
1071326485 10:84523734-84523756 CAGGTCAGGCTCTGTGCACAGGG + Intergenic
1073483578 10:103802527-103802549 CAGGCCAGATTGTGTGGACTGGG - Intronic
1073919519 10:108443035-108443057 CAGGCCAGGGTCTATGTACAAGG - Intergenic
1075546036 10:123355393-123355415 GAGGGCAGGGCTTGTCCACTGGG + Intergenic
1075724712 10:124605334-124605356 CAGGCCAGGTTTCCTGCCCTCGG - Intronic
1076852680 10:133100743-133100765 CAGGCCATGCTGTGGGCACTAGG + Intronic
1077776708 11:5280144-5280166 CAGGCCAGTCTTGGTGCATTAGG - Intronic
1078535173 11:12167373-12167395 CAGGCCCCGGTTTGTGCTCGAGG + Intronic
1079983524 11:27176858-27176880 CAGACCTGGGTTTGAGGACTGGG + Intergenic
1081281980 11:41220844-41220866 TAGGCCAGTGTCTATGCACTGGG + Intronic
1081601315 11:44496810-44496832 CAGCCCAGGGTCTCTGCACAGGG + Intergenic
1083412669 11:62505085-62505107 AAGGCCAGTGTTTGGGCATTGGG + Intronic
1084536603 11:69761032-69761054 CAGTCCATGGTGTGTGTACTGGG - Intergenic
1084652714 11:70498563-70498585 CAGCACAGGGTCTGGGCACTAGG + Intronic
1085060640 11:73443257-73443279 TTGGCCAAAGTTTGTGCACTTGG - Intronic
1087060630 11:93973565-93973587 TTGGCCAGGGTCTGTGCAGTGGG + Intergenic
1087708573 11:101522715-101522737 CAGGCCCTGTTTTATGCACTGGG - Intronic
1092727355 12:11499060-11499082 CAGGCCTGGCATTGTGCCCTAGG - Intronic
1093216708 12:16370213-16370235 CAATACAGGGTTTGTGAACTTGG + Intronic
1093272220 12:17078135-17078157 CAGACCAGGTTCTGTGCAGTGGG + Intergenic
1093772366 12:23032755-23032777 CAGGGCAGAGTTGGTGCACTGGG + Intergenic
1096089625 12:48890250-48890272 TAGACCAGGGTTTATGCCCTGGG + Intergenic
1096238203 12:49943846-49943868 TTGGCAAGGGTTTGTGCACCAGG - Intergenic
1096746264 12:53729149-53729171 CATGCCAGAGTTTCTGGACTGGG - Intergenic
1097183289 12:57183228-57183250 CAGGCTAGGGTGTGTGTGCTGGG + Intronic
1100337593 12:93646710-93646732 CAGGGCAGGGTTTCTGCTCTAGG - Intergenic
1101335903 12:103796611-103796633 AAGGCCAGGGCCGGTGCACTTGG - Intronic
1101612913 12:106308343-106308365 GAGTCCAGGGTTTGTGGCCTGGG - Intronic
1101693865 12:107106373-107106395 CAGGCCATGTTCTGGGCACTGGG + Intergenic
1102151930 12:110694554-110694576 CAGGACAGGGCTTTTGCCCTAGG - Intronic
1104275488 12:127323235-127323257 CAGGCCAGGTTCTATGCTCTGGG + Intergenic
1108120328 13:47178857-47178879 CACCCCAGGGCTTGTGCAATGGG - Intergenic
1111531361 13:89541570-89541592 TAGGACTGGGTTTGTGCACTGGG - Intergenic
1113958166 13:114110509-114110531 CAGGACAGGTTCTGCGCACTCGG + Intronic
1114367523 14:22046195-22046217 CCTGCCTGGGTTTCTGCACTGGG + Intergenic
1114651070 14:24284818-24284840 CCTGCCTGGGTTTGTCCACTGGG + Intergenic
1114903686 14:27099143-27099165 TAGGCCAGGCTTTTTGCTCTAGG + Intergenic
1116968940 14:51044613-51044635 CAGGCCAAGGATTGTGGACCAGG + Intronic
1117766587 14:59089644-59089666 CAGGGCAGGCTATGTGAACTTGG - Intergenic
1117873385 14:60224012-60224034 CAGGGCAGGATTTTTGAACTGGG + Intergenic
1119780942 14:77276527-77276549 CAGGCCAGGCTAGATGCACTTGG + Exonic
1120348199 14:83317605-83317627 CAGGCTAGAGTTTATGCTCTTGG + Intergenic
1121640155 14:95479863-95479885 CAGGCCAGGGTGTGTGGAGGAGG + Intergenic
1121959339 14:98244466-98244488 GAGGCCAGGGTTTGTGACCATGG + Intergenic
1122399320 14:101457967-101457989 CAGGCCTGCGTGTGTGCACCTGG - Intergenic
1122670029 14:103364475-103364497 GATGCCAGGGTTTGTGGATTTGG + Intergenic
1123047442 14:105526030-105526052 CAAGCTAGGGTTTGGGGACTTGG - Intergenic
1125300356 15:38248488-38248510 CAGGCCAGGGTTTATTCACAAGG - Intergenic
1131178335 15:90223961-90223983 CAGGCCGGGGTGTGGGCACCGGG - Exonic
1131380288 15:91957881-91957903 CAGGCCATGCTTTATGCACTGGG - Intronic
1132105048 15:99057292-99057314 AAGGCCTGGGTTTTTCCACTAGG + Intergenic
1132593649 16:738106-738128 CAGGCAAGGCTTTGTGCCTTGGG - Intronic
1132638130 16:963348-963370 CAGGCCAGTGTGTGTGCATATGG + Intronic
1133437089 16:5789061-5789083 GAGGGAAGGGTTTGTGCACAAGG - Intergenic
1134439636 16:14291222-14291244 CAGGACAGGGCTTTTGCACTGGG - Intergenic
1136500083 16:30665633-30665655 CAGCTCAGGGTTCGTGCTCTGGG - Exonic
1136994957 16:35182967-35182989 CAGGTCAGGGTCTGAGCCCTGGG - Intergenic
1139158657 16:64476242-64476264 AAAGCCAGGGTTTATCCACTTGG + Intergenic
1139592667 16:67942197-67942219 CAGGCCAGGGTCACTGCTCTGGG + Intronic
1142608487 17:1095402-1095424 CAGGGCTGGGTGTGTGCCCTTGG + Intronic
1142621869 17:1170374-1170396 CAAGCCAGGGACTGTGCGCTCGG - Intronic
1144658676 17:17054464-17054486 CTGTCCAGGCTTTGTGCCCTGGG - Intronic
1144684602 17:17217625-17217647 CAGCCCTGGGCTTGTGCACACGG - Intronic
1144735049 17:17550714-17550736 CTGTCCAGGCTTTGTGCCCTGGG - Intronic
1146005753 17:29159638-29159660 CAGGCCGGGTTTGGAGCACTGGG - Intronic
1146554303 17:33810481-33810503 CAGACCAGTGTTCCTGCACTTGG - Intronic
1147128972 17:38394666-38394688 CAGGCCTGGGATTGGCCACTTGG + Intronic
1147763099 17:42813706-42813728 CAGAAGAGGGTGTGTGCACTAGG - Intronic
1148227924 17:45912049-45912071 CAGGGCTGGGTCTGTGGACTGGG + Intronic
1151195453 17:72428004-72428026 CAGGCCAGGCTGTGTGCTCCTGG - Intergenic
1151420373 17:73993186-73993208 CAGGCCAGGGATGCTGCTCTGGG + Intergenic
1152858851 17:82683663-82683685 CAGGCCTGGTGGTGTGCACTTGG + Intronic
1158549919 18:58426989-58427011 CATGCCAGGGATTGGGCAGTTGG - Intergenic
1159114419 18:64097503-64097525 CAGTCCAAGGTTTGAGCACAAGG + Intergenic
1162824528 19:13243491-13243513 CAGGCCTGGCTTTGTGACCTTGG + Intronic
1163404543 19:17113944-17113966 CAGGGCAGGGGTTGGGAACTTGG - Intronic
1163781371 19:19250783-19250805 AAGGACTGGGTATGTGCACTGGG - Exonic
1164827625 19:31296158-31296180 CAGGCCAGGATTATTTCACTGGG - Intronic
1165159307 19:33806490-33806512 CTGGCAAGGGTGTGTGCACCAGG + Intronic
1165445484 19:35854943-35854965 CAGGCAAGTGTATGTGCACGCGG - Intronic
1165725564 19:38110346-38110368 CAGTGCAGGGGTTGTGGACTCGG - Exonic
1165746220 19:38231172-38231194 CAGCCCAGGGCATTTGCACTTGG - Intergenic
1167380325 19:49134548-49134570 CAGGCCTGTCTGTGTGCACTGGG + Intronic
1167409821 19:49338211-49338233 CACGCCAGGGTCTGGGTACTGGG - Intronic
1167420697 19:49401277-49401299 CAGGCCAGGGTGGGTGCTCATGG + Intronic
1168415066 19:56162493-56162515 CAGGCCAGGGTCTGAGGACAGGG + Intergenic
1168665800 19:58204063-58204085 CAGACCAGGGTTTGTACTCGAGG + Intronic
925899266 2:8496734-8496756 CAGGGGAGGGATTGTGCCCTGGG - Intergenic
927057411 2:19378578-19378600 CAGGCTAGGGATGGTGCACCTGG + Intergenic
928924023 2:36557911-36557933 CAGGCCATGATCTGGGCACTTGG - Intronic
929992961 2:46804925-46804947 CTGGCCTGGGTTTGTGGCCTGGG - Intergenic
932781412 2:74560871-74560893 AAGGCCTGGGATTGTGCTCTTGG - Intronic
933173863 2:79155786-79155808 CAGGCGAGGCTCTGTGGACTCGG - Intergenic
933682762 2:85117518-85117540 CAGGATATGGTTTGTGCCCTGGG - Intergenic
935546260 2:104402718-104402740 CAGGCCGGGGTTTATGCTCGGGG + Intergenic
935631972 2:105219545-105219567 CATGCCTGGGTGTGTGCCCTGGG - Intergenic
936069393 2:109355376-109355398 CAAGCAAGGGTTGGTGGACTAGG + Intronic
938995391 2:136672557-136672579 TAGGCCAGGGTTTCTCAACTTGG + Intergenic
943718775 2:191180871-191180893 CATCCCAGTGTTTGTGCAATGGG - Intergenic
945242029 2:207685106-207685128 CAGGCCCTGGTTTCGGCACTGGG + Intergenic
948304396 2:236935887-236935909 AGGGCCAGAGTTTCTGCACTTGG + Intergenic
949076728 2:242063997-242064019 CAGGCCGGGGTTTGTGTAGACGG - Intergenic
1168895277 20:1319730-1319752 GAGGCCAGGGTCTGGGCATTAGG + Intronic
1168912907 20:1464231-1464253 CAGGCCTGGGTGTGTGGACCAGG - Intronic
1171095980 20:22332583-22332605 CAGGACAGGGTCTGAGCTCTCGG + Intergenic
1171402038 20:24879990-24880012 CAGGCCTGGGAGTGTGCACGTGG - Intergenic
1173800539 20:45891880-45891902 CAGGGCAGGGTTGGCGCAGTTGG - Intronic
1174188796 20:48725333-48725355 CAGCCCAGGGTTTCAGCCCTTGG - Intronic
1174410116 20:50329962-50329984 CAGGCCCTGGGTTGGGCACTGGG - Intergenic
1174529531 20:51199921-51199943 CAGCCCTGGGTTCCTGCACTCGG - Intergenic
1174824224 20:53754871-53754893 CAGGCCAGAGTTTTTGGACTGGG + Intergenic
1175015132 20:55781678-55781700 CAGGCCAGGGTAAGGGCTCTAGG + Intergenic
1178557151 21:33602134-33602156 CTGGCCAGGGATTTTGTACTTGG + Intronic
1179029201 21:37705100-37705122 CAGGCCATGGCTTCTCCACTGGG - Intronic
1179164320 21:38924096-38924118 CAGGCGAAGGTTGGTGCCCTTGG + Intergenic
1179278119 21:39910267-39910289 CAGGCCAGGTCTGTTGCACTTGG - Intronic
1179539831 21:42076919-42076941 CAGGCCAGGGTCTGAGCCGTTGG + Intronic
1181127427 22:20710250-20710272 CCGGCCATGGCTTCTGCACTTGG + Intronic
1182072996 22:27476541-27476563 CAGGCGAGGGTTTGGACTCTGGG - Intergenic
1182320353 22:29474972-29474994 CTGGCCAGGGTCTTTGCTCTAGG - Intergenic
1183709729 22:39495809-39495831 CAGGCCCTGGTTAGAGCACTGGG + Intergenic
1184119517 22:42441014-42441036 CAGGCCAGGCTGTGGGCAGTGGG - Intergenic
953561287 3:43995521-43995543 CAAGCCAGGGTTTGGCCAGTTGG - Intergenic
961452598 3:127009154-127009176 CAGCCCAGGGTTCGAGCAGTGGG + Intronic
961536278 3:127572933-127572955 CAGCCCAGGGCTTGGGCACTGGG + Intergenic
961606896 3:128102308-128102330 CATCCCAGTGTTTGTGCCCTTGG + Intronic
962149123 3:132873847-132873869 CAGACCAGGGTTTGGGTGCTGGG - Intergenic
962271537 3:133981098-133981120 CAGGGCATGGGTTGGGCACTTGG - Intronic
969469187 4:7376928-7376950 CAGGCCAGGGTTTGTGCACTGGG - Intronic
969469931 4:7381769-7381791 CAGTCCAGGGTTTGTGCACTGGG - Intronic
972385936 4:38565448-38565470 CAGGCCTGGGCTTGTCCACAAGG + Intergenic
972399246 4:38685158-38685180 CACGGCAGGGTGTGTGCTCTGGG - Intronic
973632513 4:52832825-52832847 CAGCTCAGGGTGGGTGCACTGGG - Intergenic
974386963 4:61213825-61213847 CAGGCCAAGCTTTCAGCACTCGG - Intronic
977294696 4:95197928-95197950 CAGGGGAGGGTTTTTGGACTGGG + Intronic
981456048 4:144954292-144954314 CTGGCCAGGGCTGGTGCACACGG + Intergenic
981829271 4:148981496-148981518 CAAGCCAGGGTCTGTGCAGCTGG - Intergenic
983231865 4:165136729-165136751 TACGCCAAGGTTTGTGCTCTTGG + Intronic
987926313 5:24346392-24346414 GAGGCCAGGTTTTGTGCTTTGGG + Intergenic
990983564 5:61622122-61622144 CAGGCCTGGGTTTGGTAACTGGG + Intergenic
992622214 5:78605150-78605172 CAAGCCATGGCTTCTGCACTTGG - Intronic
993869979 5:93241069-93241091 AAGGCCAGGGTTTGAGTCCTGGG - Intergenic
996254727 5:121385212-121385234 CCTGCCAGGGTTTCTGGACTTGG - Intergenic
997519260 5:134512202-134512224 GAGGCCAGGGCTTGGGCTCTAGG - Intergenic
998092874 5:139381236-139381258 CAGGCCTAGGGCTGTGCACTCGG + Intronic
998161422 5:139814819-139814841 AAGGCCAGGGTGTGTGCTTTGGG - Intronic
998506543 5:142677012-142677034 CAGTCCAGGCTTTTTGCAGTTGG - Intronic
1001132841 5:169079217-169079239 CAGGCCAGGGTTTGTCCAGGTGG + Intronic
1001732464 5:173970405-173970427 AAGGCCTGGGTTTGAGCCCTGGG + Intergenic
1002414566 5:179112885-179112907 AAGGCCAGGGTTAGTGGACAGGG + Exonic
1002488104 5:179553343-179553365 CAGGCCGGGAATTTTGCACTGGG + Intronic
1002956660 6:1872163-1872185 CCGGCCAGTGTTTGTGCTGTGGG - Intronic
1003847120 6:10184990-10185012 CAGGGCAGAGTTCCTGCACTGGG - Intronic
1007475443 6:42116728-42116750 GAGCCCAGGGTTTGTGGAGTAGG - Intronic
1008886878 6:56440943-56440965 CATGGCAGGGTCTGTGAACTAGG + Intergenic
1018399179 6:163405133-163405155 CAGGAAACGGTTTGTGCAATAGG + Intergenic
1019749285 7:2718710-2718732 CAGGACAGGGCTTGTGCAGCCGG + Intronic
1020164577 7:5797854-5797876 TGGGTGAGGGTTTGTGCACTCGG + Intergenic
1029728744 7:102425682-102425704 AAGGCCTGGGTGTGTGCACAAGG + Exonic
1029898338 7:104010723-104010745 CAGGCCATGATTTGTTGACTTGG + Intergenic
1030239879 7:107310773-107310795 CAGTCCTGGGTGTGTGTACTGGG - Intronic
1031027295 7:116694033-116694055 CTGGCCAGTGCCTGTGCACTTGG + Intronic
1031965526 7:128025555-128025577 CAGGCCAAGGTTTGTTACCTAGG - Intronic
1034411521 7:150944807-150944829 CAGGTCTGGGTGTGTGCAGTGGG - Intergenic
1034679319 7:152916394-152916416 CTGGCCTGAGTTTGTGGACTTGG + Intergenic
1035013821 7:155745490-155745512 CACGCCAGGCTTTGTGTCCTGGG - Exonic
1035644697 8:1210162-1210184 CAGGCCAGGCTCTGTGGAGTGGG + Intergenic
1036552341 8:9826584-9826606 CAGGCCACGGTTCCTTCACTGGG + Intergenic
1037538240 8:19847750-19847772 CATCCTAGGGTTTGTCCACTTGG - Intronic
1037753345 8:21696605-21696627 CAGGCCAGGGAAAATGCACTTGG - Intronic
1039275108 8:35926592-35926614 CAGGCCACATTTTGTGCAATGGG + Intergenic
1039417500 8:37408335-37408357 CAGCCCAGGGTCTTTGCACTTGG - Intergenic
1039892511 8:41694893-41694915 CTGGGGAGGGTGTGTGCACTGGG - Intronic
1040006679 8:42627014-42627036 AGGGCCAGGGTTTGTGACCTAGG + Intergenic
1041678643 8:60563538-60563560 GAGGCCAGGATGTGTGCACAAGG - Intronic
1046777908 8:118183370-118183392 TATGCCAAGGTTTGTGCATTGGG + Intergenic
1048138620 8:131771041-131771063 CAGGCCAGTGGGTGTGCACACGG + Intergenic
1049102202 8:140587934-140587956 CAGGCCAGGGATTTGGGACTCGG - Intronic
1049692966 8:143970824-143970846 CAGGCCAGGCTTGGGGCGCTGGG + Intronic
1052803103 9:32988413-32988435 CAGGCCAGGGGTTCTGGAATAGG - Intronic
1056064669 9:82921769-82921791 CATGCCAGGGATGGTGCACATGG - Intergenic
1057220882 9:93257186-93257208 CAGGCCCTGGCTGGTGCACTAGG + Intronic
1057667886 9:97060936-97060958 CAGGCCAGTGTGGGTGCACCAGG - Intergenic
1057989651 9:99755166-99755188 CAGGCCAATGTTTTTGCACATGG - Intergenic
1060044227 9:120327291-120327313 GAGACCAGGGTGTGTGCACTGGG + Intergenic
1061425974 9:130498709-130498731 CAGGCCAGTATTCCTGCACTCGG - Intronic
1061704761 9:132444468-132444490 CATGCCATGGTTTGTCCTCTTGG + Intronic
1061743302 9:132722787-132722809 CAGGGCCGGGTGTGTGCTCTGGG - Intergenic
1062471777 9:136709306-136709328 CTGGCCAGGGTTTGAGCTCAGGG + Intergenic
1062511323 9:136907746-136907768 CAGAGCAGGGACTGTGCACTTGG + Intronic
1190596735 X:52059540-52059562 GAGGCCAGGGTGCGTGCACTGGG - Intergenic
1190612089 X:52194533-52194555 GAGGCCAGGGTGCGTGCACTGGG + Intergenic
1190817612 X:53942168-53942190 CAGGCCAGGGAGTTTGAACTTGG - Intronic
1193249585 X:79273446-79273468 GAGGCAGGGGTTTGTGGACTGGG + Intergenic
1196612810 X:117733588-117733610 CAGGCCAGTGGGTGTGCACACGG - Intergenic
1197848904 X:130835639-130835661 GAGGCCTGGGTTTGTACTCTAGG + Intronic
1199257227 X:145730494-145730516 CAGGCCAGGCCTTGTGCTGTGGG - Intergenic
1200053911 X:153448825-153448847 CAGGCCAGGGTCTGTTGACCCGG + Intronic