ID: 969469188

View in Genome Browser
Species Human (GRCh38)
Location 4:7376929-7376951
Sequence GCAGGCCAGGGTTTGTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469188_969469198 20 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469188_969469195 13 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469188_969469196 19 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469188_969469194 12 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469188_969469192 1 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469188 Original CRISPR GCAGGCCAGGGTTTGTGCAC TGG (reversed) Intronic
900161457 1:1226096-1226118 GGAAGCCAGGGTCTGGGCACTGG - Intronic
900630791 1:3634115-3634137 GGAGGCCAGGGTGTCTGGACAGG - Intronic
900735449 1:4296867-4296889 GCAGGCAAGAGTGTGTGCAGGGG + Intergenic
901268960 1:7935473-7935495 GCAAACCAGGGTTTGAGCCCTGG + Intronic
901485566 1:9558364-9558386 GAAGGCCAGGGTCTGGGCCCTGG - Intronic
902436200 1:16399393-16399415 CCAGGCCAGGGGGTGTGCACTGG + Exonic
902507588 1:16948214-16948236 GAAGGCCTGGGTTTGAGCCCAGG - Intronic
903521236 1:23951762-23951784 GCAAGCCAGTGTTTGTTCTCTGG - Intergenic
903742711 1:25567522-25567544 GCAGGCGGGGGTTTGAGCCCTGG + Exonic
905118336 1:35661632-35661654 GAAGAAGAGGGTTTGTGCACAGG - Intergenic
908295327 1:62707144-62707166 GTATGCCAGGGTTTGTGCTAGGG + Intergenic
908713442 1:67043870-67043892 GCAGGCCAGGGTTTGAGAGGTGG + Intronic
908721530 1:67131488-67131510 GCAAGCCAAGGTTTGTGGGCTGG - Intronic
913282728 1:117201322-117201344 GCAGGCCAGGCTTTGTCTAAAGG - Intronic
916212798 1:162372487-162372509 GCAGGCCAGGGACTGAGCCCAGG - Intronic
916444111 1:164856139-164856161 GCAGGCCATTGTTGGTGCAGAGG + Intronic
920353500 1:205353159-205353181 GCAGGCCAGGGTTGGCCCTCAGG - Intronic
924390173 1:243546148-243546170 GCAGGCAAGGGCATGTGCAGGGG - Intronic
1063237665 10:4135199-4135221 GCAGGTCATCGTTGGTGCACTGG + Intergenic
1063298829 10:4833514-4833536 GCAAGACAGGGTGTGAGCACGGG - Intronic
1064132737 10:12724367-12724389 GGGGGCCAGGGTTTGTGTTCTGG + Intronic
1067175854 10:43944949-43944971 GGAGGCCAGGCTGTGTGCACAGG + Intergenic
1067247277 10:44557494-44557516 GTAGGTCAGGGTTTGTGAAGGGG - Intergenic
1067289791 10:44932433-44932455 GCAGACCTGGGTTTGGGAACTGG + Intronic
1071326484 10:84523733-84523755 CCAGGTCAGGCTCTGTGCACAGG + Intergenic
1072816066 10:98510531-98510553 TCAGGCTTGGGTTTGTGAACTGG + Intronic
1073471886 10:103727614-103727636 GCTGGCCAGGGTCTGTGCTTAGG - Intronic
1073483579 10:103802528-103802550 GCAGGCCAGATTGTGTGGACTGG - Intronic
1073607964 10:104915002-104915024 GTGGGCCAGGGTTTGGGGACAGG + Intronic
1074097947 10:110330421-110330443 CCAGGCCAGGGTTGGAGCAGTGG + Intergenic
1075376432 10:121981412-121981434 GCAGGCCAAGATTGGTGCATTGG + Intergenic
1077033892 11:484747-484769 GCAGGCGAGTGTAAGTGCACGGG + Intronic
1077033920 11:485138-485160 GCAGGCGAGTGTAAGTGCACGGG + Intronic
1077916413 11:6614622-6614644 GAGGGCCAGGGTTTCTGCTCTGG - Exonic
1078017094 11:7624229-7624251 GCAGGCCAGGGTTTGCATCCTGG + Intronic
1079403521 11:20125773-20125795 GCATGCCAGGGGTTGTCCACTGG - Intergenic
1079495496 11:21038755-21038777 GCAGGCCAGCATTGGTCCACAGG - Intronic
1079669854 11:23154982-23155004 GCAGGCAAGAGTGTGTGCAGGGG - Intergenic
1080536188 11:33223896-33223918 GCAGGCCAGGCCTGGTGCAGTGG - Intergenic
1081122480 11:39284595-39284617 GCAGGCAAGAGTTTGTGCAAGGG + Intergenic
1081601314 11:44496809-44496831 CCAGCCCAGGGTCTCTGCACAGG + Intergenic
1081610399 11:44559320-44559342 GCAGGGCAGGATTTGAGCAGGGG + Intergenic
1082898978 11:58225583-58225605 GCAGGCAAGAGAGTGTGCACAGG + Intergenic
1083727063 11:64634176-64634198 GCTGGCCAGGCTTTGTGGGCTGG - Intronic
1087708574 11:101522716-101522738 GCAGGCCCTGTTTTATGCACTGG - Intronic
1091288509 11:134423025-134423047 CAAGGCCTAGGTTTGTGCACTGG + Intergenic
1093272219 12:17078134-17078156 GCAGACCAGGTTCTGTGCAGTGG + Intergenic
1093772365 12:23032754-23032776 GCAGGGCAGAGTTGGTGCACTGG + Intergenic
1094165579 12:27439252-27439274 GCTGGCTAGGGTTCGTGCCCAGG - Intergenic
1095441255 12:42240339-42240361 GCAGGCCAGGGTTAGAGCTCAGG + Intronic
1095942310 12:47735286-47735308 GCAGCCCAGGCTGTGTGCAGGGG - Intronic
1097911360 12:64973303-64973325 GCAGGAGAGGGCTTGTGCAGGGG + Intergenic
1099230342 12:80016226-80016248 GCAGGCCAGATTTAGTCCACAGG + Intergenic
1100440125 12:94609295-94609317 GCAAGCCAGGGTTTGAACCCAGG + Intronic
1100856751 12:98764115-98764137 CTTGGCCAGGGTTTGTGCAAAGG + Intronic
1101498044 12:105274669-105274691 GCCGGCCAAGGTAAGTGCACAGG + Intronic
1101612914 12:106308344-106308366 GGAGTCCAGGGTTTGTGGCCTGG - Intronic
1104254654 12:127125443-127125465 GCAAGCCAGGACTTGTGCACTGG - Intergenic
1104438838 12:128778623-128778645 GCAGGCAAGAGTGTGTGCAGGGG + Intergenic
1105637517 13:22229700-22229722 GCAGGAACGGGTTTGTGCAGAGG - Intergenic
1106238058 13:27882104-27882126 GCTGGCCAGAGTGTGTTCACAGG + Intergenic
1107072068 13:36281224-36281246 GCAGTCCAGGGGTGGTGCAGTGG - Intronic
1110185874 13:72674229-72674251 CCATACCAGGGTGTGTGCACTGG + Intergenic
1110520027 13:76464758-76464780 GCAGGCAAGAGCTTGTGCACAGG - Intergenic
1110553183 13:76829768-76829790 GCAGGCCTGTGTTTGTGACCCGG + Intergenic
1111531362 13:89541571-89541593 TTAGGACTGGGTTTGTGCACTGG - Intergenic
1112849388 13:103685980-103686002 GCAGGCAAGAGTTTGTGCAGAGG - Intergenic
1113759590 13:112838142-112838164 GCAGGACAGGGTCTGAGAACAGG + Intronic
1114367521 14:22046194-22046216 GCCTGCCTGGGTTTCTGCACTGG + Intergenic
1114651068 14:24284817-24284839 GCCTGCCTGGGTTTGTCCACTGG + Intergenic
1115670616 14:35607888-35607910 GCAGCCTAGTGTATGTGCACAGG - Intronic
1118609241 14:67527198-67527220 GCAGGGCAGGGTTTGTGTCCTGG + Intronic
1119777324 14:77257188-77257210 GGAGGCAAAGGTATGTGCACGGG + Exonic
1121827166 14:97019594-97019616 GCAGGACAGGGTTTGTCCTTTGG - Intergenic
1121877671 14:97468370-97468392 GCAGACGAAGGTTTCTGCACCGG + Intergenic
1122008015 14:98721791-98721813 GCAGGCAAGAGATCGTGCACAGG - Intergenic
1124013961 15:25861214-25861236 GCAGGCCTGGGATTGAGCCCAGG - Intronic
1126580952 15:50242253-50242275 GCAGGCCATGGTTTAGACACAGG - Exonic
1126887665 15:53168173-53168195 CCAGGGCAGAGTGTGTGCACTGG - Intergenic
1126953608 15:53910333-53910355 GCAGGCCTGGGTATCTGCCCAGG - Intergenic
1128579383 15:68798181-68798203 GCAGCCCAGGGTTTCTGCCTTGG + Intronic
1129728414 15:77915797-77915819 GGAGGCCAGGGCATGGGCACGGG - Intergenic
1129825146 15:78629981-78630003 ACAGGCCAGGTTTTGTGTATGGG - Intronic
1130868906 15:87954673-87954695 GCTGGCCAGGGTTTGGGAAATGG + Intronic
1131178336 15:90223962-90223984 CCAGGCCGGGGTGTGGGCACCGG - Exonic
1131380289 15:91957882-91957904 CCAGGCCATGCTTTATGCACTGG - Intronic
1131952310 15:97694143-97694165 GCAGGCCAGTGTTGAAGCACTGG - Intergenic
1132593650 16:738107-738129 GCAGGCAAGGCTTTGTGCCTTGG - Intronic
1133398174 16:5464904-5464926 GCAGACCAGGGTCTGCACACAGG - Intergenic
1133642442 16:7730353-7730375 GCAGGCAAGAGTTTCTACACGGG + Intergenic
1134027204 16:10963555-10963577 GCAGGCAAGGGTGTGTGCATTGG + Intronic
1134439637 16:14291223-14291245 ACAGGACAGGGCTTTTGCACTGG - Intergenic
1135251673 16:20905699-20905721 GCTGGTTAGGGTTTGTCCACTGG - Intronic
1136028502 16:27485551-27485573 GCAGGCCAGGGTTAGACTACTGG + Intronic
1136500084 16:30665634-30665656 GCAGCTCAGGGTTCGTGCTCTGG - Exonic
1136994958 16:35182968-35182990 GCAGGTCAGGGTCTGAGCCCTGG - Intergenic
1138112029 16:54331286-54331308 CCAGGCCTGGCTCTGTGCACAGG + Intergenic
1141173622 16:81705570-81705592 GCAGGCCAGCGTCTGTGACCGGG - Exonic
1141801774 16:86314731-86314753 GTAGGACAGGGGTTGGGCACCGG + Intergenic
1142077373 16:88128005-88128027 GTAGGCCAAGGGTTCTGCACAGG + Intergenic
1142171393 16:88624558-88624580 GCAGGGCAGGGCTGGTGGACGGG - Intronic
1143843665 17:9755476-9755498 GCAGGCCAAGCTTTGTTCAAAGG - Intergenic
1145060685 17:19731366-19731388 GCAGGTCAGGGTTGGAGCTCAGG + Intergenic
1146770079 17:35560957-35560979 GCAGGCCAGGGTCTGACCTCAGG + Intergenic
1148332061 17:46818987-46819009 GCTGGCCAGGGTTAGGGCGCGGG + Intronic
1148861057 17:50604556-50604578 GCGGGCCAGCGTCTGTGCTCAGG - Intronic
1149082684 17:52677647-52677669 GCTGCACAGAGTTTGTGCACAGG + Intergenic
1151344777 17:73494827-73494849 CCAGGCCAGGGTGGGGGCACGGG + Intronic
1154997100 18:21650638-21650660 GCAGGCCAGAGCTGGTGCAGAGG - Intergenic
1157410235 18:47457359-47457381 GCAGCCCAGGGGTTGGGCTCAGG + Intergenic
1158395871 18:57078016-57078038 GAAGGCGTGGGTGTGTGCACAGG + Intergenic
1160449863 18:78955224-78955246 GCAGGATATGGTTTATGCACGGG - Intergenic
1161060334 19:2211487-2211509 GCAGGCCAGGGATGCTGCTCAGG + Intronic
1162404351 19:10464643-10464665 GGAGGCCAAGGTTTGAGCCCAGG - Intronic
1162613218 19:11772399-11772421 CCAGGCCAGGCTGGGTGCACTGG + Intronic
1165802688 19:38562629-38562651 GGAGCCAAGGGTTTGTGTACTGG - Intronic
1166560129 19:43727299-43727321 GCAGGCCACACTTTGTTCACGGG + Intergenic
1168413880 19:56156865-56156887 GCTGGCCAGGCATTGTCCACAGG - Intronic
1168415065 19:56162492-56162514 TCAGGCCAGGGTCTGAGGACAGG + Intergenic
925154098 2:1637163-1637185 TCAGGGCAGGCCTTGTGCACAGG - Intronic
925254460 2:2471088-2471110 GCAGGCAAGAGCTTGTGCAGGGG - Intergenic
925583127 2:5434700-5434722 GCAGGCCCGTGTGTGTGCATGGG - Intergenic
926972173 2:18477419-18477441 GCAGGCCAGGTTTTGTGATAAGG - Intergenic
927182420 2:20456102-20456124 GAAGGCCAGGCTTTGGGCACTGG + Intergenic
927267077 2:21162962-21162984 GCAGGCAAGAGTGTGTGCAGGGG + Intergenic
928078459 2:28286850-28286872 GCCGGCCATGGTATGTGCTCAGG + Intronic
928749322 2:34453625-34453647 GCAAGCGAGTGTTTGTGCAGGGG + Intergenic
929992962 2:46804926-46804948 GCTGGCCTGGGTTTGTGGCCTGG - Intergenic
930096311 2:47569690-47569712 GCCGGCCAGTGTTGGAGCACAGG + Intronic
931767013 2:65466019-65466041 ACAGTCCAGGGCTTTTGCACAGG - Intergenic
934653892 2:96107565-96107587 GCAGGGCTGGGTCTGTGCCCAGG - Intergenic
935546259 2:104402717-104402739 ACAGGCCGGGGTTTATGCTCGGG + Intergenic
935546267 2:104402948-104402970 GTGGGCCAGGGTTTATGCTCAGG - Intergenic
936054072 2:109247553-109247575 CCAGGCAAGAGTTTCTGCACAGG - Intronic
938132355 2:128727569-128727591 GTAGGCCAGGGCTGGGGCACAGG + Intergenic
939860790 2:147417683-147417705 GGAGGCCGGGGTGTGTGCGCCGG - Intergenic
940753820 2:157659122-157659144 GCAGGCTAGATTTTGTCCACAGG + Intergenic
943812807 2:192210623-192210645 TCAGGCCAGGATTTATGCAGAGG + Intergenic
945860965 2:215121808-215121830 GCAGGCAAGAGCTTGTGCAGGGG - Intronic
946400510 2:219466155-219466177 GCAGGCCTGGGTCTGTGGGCAGG - Intronic
947368962 2:229425456-229425478 GCAGGTCAGGGTCTGTGGGCTGG - Intronic
948618936 2:239221259-239221281 GAAAGCCAAGGTCTGTGCACAGG + Intronic
1169354355 20:4894988-4895010 ACAGGCCATGGTTTGTCCTCAGG + Intronic
1172567275 20:35940529-35940551 GCAGACAAGGGTTAGTACACGGG - Intronic
1173867398 20:46321344-46321366 GCTGGCCAGGGATTGTGCTTGGG - Intergenic
1174574488 20:51526829-51526851 GCAGGCGAGGGTAGATGCACAGG - Intronic
1174824223 20:53754870-53754892 CCAGGCCAGAGTTTTTGGACTGG + Intergenic
1175435199 20:58942100-58942122 GCAGGCCAGATTTGGTACACAGG + Intergenic
1175900224 20:62357134-62357156 GCAGAGCTGGGTTTGGGCACAGG - Intronic
1176127695 20:63483303-63483325 GCAGTCCTGGGTTTGAGCAGCGG - Intergenic
1176238977 20:64067235-64067257 GGAGGCCAGGGTGTGTGCTGGGG + Intronic
1176244083 20:64089109-64089131 GCATGCCAGGGTCTGTGCTGGGG + Intronic
1176409718 21:6442048-6442070 GCAGGGCAGGCTTTCTGCCCAGG - Intergenic
1178250789 21:31001406-31001428 GCTGGCCAGGGTCTGTGCTAAGG + Intergenic
1178787210 21:35664710-35664732 GCTGGCCTGGGTTTGTTCTCAGG - Intronic
1179049453 21:37876168-37876190 GCAGGCCTGTGTCTGGGCACAGG + Intronic
1179481047 21:41678861-41678883 GCAGACCAGGGTTTATGCCCTGG + Intergenic
1179587964 21:42385771-42385793 GCAGCCCAGGGTGGGTGGACGGG - Intronic
1179654526 21:42837199-42837221 GGAGGCCTGGGCTTCTGCACTGG + Intergenic
1179685211 21:43050370-43050392 GCAGGGCAGGCTTTCTGCCCAGG - Intergenic
1179912709 21:44458913-44458935 CCTGTCCAGGGTGTGTGCACTGG + Exonic
1180059968 21:45379696-45379718 GGAAGCCAGGGTTTGAGCCCCGG + Intergenic
1180145160 21:45914694-45914716 CCTGGCCAGGGTTTGGGCTCAGG - Intronic
1182072997 22:27476542-27476564 GCAGGCGAGGGTTTGGACTCTGG - Intergenic
1183475184 22:38032283-38032305 GCAGGCCAGGTGTGGTGCAGTGG - Intronic
1183709728 22:39495808-39495830 GCAGGCCCTGGTTAGAGCACTGG + Intergenic
950807834 3:15623045-15623067 GCAGACAAGAGTTTGTGCAGAGG + Intronic
951098145 3:18655453-18655475 GCAGTCCAGGATTAGTGCAATGG + Intergenic
951301853 3:21008172-21008194 GCTAGCCAGGGTTTGTAAACGGG - Intergenic
952336899 3:32411543-32411565 TCAGTGCTGGGTTTGTGCACTGG + Intronic
954322701 3:49842897-49842919 TGAGGCCTGGGTTTGTGCTCTGG - Intronic
954392542 3:50275139-50275161 GCAGTCCCGGGTTTGAGTACAGG + Intronic
954582243 3:51709169-51709191 GGAGGCCATGCTTTTTGCACTGG + Exonic
955755226 3:62219026-62219048 GCTGGCCAGGTTTTGCTCACGGG + Intronic
956389702 3:68758464-68758486 GCAGGCAAGAGTGTGTGCAGGGG - Intronic
960289029 3:115861544-115861566 GCAGGTGAGGGTCTGTGTACAGG - Intronic
960754930 3:121001137-121001159 GCATGGCAGGGTCTGTGCATAGG + Intronic
961039972 3:123671386-123671408 GGAGGCCAGGGTTTGATCCCAGG + Intronic
961452597 3:127009153-127009175 GCAGCCCAGGGTTCGAGCAGTGG + Intronic
961536277 3:127572932-127572954 CCAGCCCAGGGCTTGGGCACTGG + Intergenic
968519613 4:1029563-1029585 GCGGGGCAGGGTGTGGGCACGGG + Intergenic
968875138 4:3262743-3262765 GCAGGGCAGGGGCTGTGCAGGGG - Intronic
969458625 4:7315469-7315491 GCAGGCCAGGGCTGGTGCGGTGG + Intronic
969469188 4:7376929-7376951 GCAGGCCAGGGTTTGTGCACTGG - Intronic
969469932 4:7381770-7381792 GCAGTCCAGGGTTTGTGCACTGG - Intronic
970915057 4:21322403-21322425 TAAGTCCAGGGCTTGTGCACAGG + Intronic
971111308 4:23589082-23589104 GCAGGCAAGGGCTTGTGCAGGGG - Intergenic
972117995 4:35662638-35662660 GCAGGCCAGAGTGTGTGCAGGGG - Intergenic
973547427 4:51995773-51995795 CCAGGCCAGGGCTTTTGCTCTGG + Exonic
973632514 4:52832826-52832848 GCAGCTCAGGGTGGGTGCACTGG - Intergenic
978193048 4:105938368-105938390 GCAGGCCAGGGGATGGGCACTGG - Exonic
978210553 4:106131151-106131173 GCAGGCAAGAGCTTGTGCAGGGG - Intronic
979794834 4:124834059-124834081 GCAGGTCAGGGGTTGTGCAATGG + Intergenic
980917225 4:139044975-139044997 GCACTCCAGGGTCTGTGCAATGG - Exonic
985593228 5:776002-776024 GGAGGCCAGGGTATCTGCATGGG - Intergenic
987456059 5:18148302-18148324 TCAGGGCTGGGTCTGTGCACAGG - Intergenic
988500410 5:31779169-31779191 GCAGTGCAGGGTGTGTGCAGTGG - Intronic
990181125 5:53161988-53162010 GCAGACCAGGGATTCTCCACAGG - Intergenic
990741737 5:58919448-58919470 GGAGGTCAGGATTTGAGCACTGG + Intergenic
993208672 5:84920484-84920506 ACAGGCAAGAGTTTGTGCAGGGG - Intergenic
993869980 5:93241070-93241092 GAAGGCCAGGGTTTGAGTCCTGG - Intergenic
994166129 5:96610150-96610172 GCAGGCAAGAGCATGTGCACGGG - Intronic
996915116 5:128703179-128703201 GCAGGCAAGGGGCTCTGCACTGG - Intronic
997387239 5:133483141-133483163 GCAGGCAAGAGTTTGTGCAGGGG - Intronic
997526236 5:134555031-134555053 GCAGCCCAGGGCTTGTTCTCGGG - Intronic
997530682 5:134579554-134579576 GCAGGGCAGGGATGGTGCGCGGG - Exonic
997807631 5:136934782-136934804 GAAGACCATGGTTTGTGCAGGGG + Intergenic
997853633 5:137354456-137354478 GCAGGACAGGGTGTGTCCCCAGG - Intronic
998161423 5:139814820-139814842 GAAGGCCAGGGTGTGTGCTTTGG - Intronic
998388184 5:141770381-141770403 ACAGGCCTGGGTTTGTACTCCGG + Intergenic
999524958 5:152394818-152394840 TCAGTCCATGGTTTGTGTACAGG + Intronic
1001085736 5:168699023-168699045 GCAGCCCAGGCTGTGTGCCCTGG + Intronic
1002299629 5:178249886-178249908 GCAGACCAGGGTTTGCACACAGG + Intronic
1002414565 5:179112884-179112906 CAAGGCCAGGGTTAGTGGACAGG + Exonic
1002459644 5:179366953-179366975 AGTGGCCAGGGGTTGTGCACAGG + Intergenic
1003847121 6:10184991-10185013 GCAGGGCAGAGTTCCTGCACTGG - Intronic
1006212156 6:32405132-32405154 GCACACCTGTGTTTGTGCACAGG - Exonic
1007822452 6:44570671-44570693 TCAGACCAGGGTTGGTGCAAAGG - Intergenic
1008903044 6:56644990-56645012 GCAGGCAAGAGCTTGTGCAGGGG - Intronic
1020196613 7:6044491-6044513 GCAGGCCAGATTTGGTGCACGGG + Intronic
1020352259 7:7233734-7233756 GCAGGCCAGGTTTGGTCCATGGG + Intronic
1021572661 7:22081975-22081997 GCAGCCCAGGGTGGGAGCACTGG - Intergenic
1023031334 7:36092700-36092722 GCAGCCCAGGGTTACTGCCCGGG + Intergenic
1024619717 7:51147024-51147046 GCAGGCCAGGGTCCCTGCATAGG + Intronic
1029727328 7:102415779-102415801 GCAGGCCAGGGTGTGATCCCAGG + Intronic
1029866635 7:103638369-103638391 CCAGGCCTGGGATTGTACACAGG + Intronic
1032430511 7:131857442-131857464 GCAGGCCAGTGTGTCTGCAGTGG + Intergenic
1034040873 7:147875340-147875362 GCAGGCAAGAGATTGTGTACAGG + Intronic
1034459332 7:151189891-151189913 GAAGGCCAAGGTGTGTCCACAGG - Intergenic
1034480761 7:151318986-151319008 GCAGCCCAGGTGTTGAGCACAGG + Intergenic
1034526858 7:151669973-151669995 GCATGCAAGTGTGTGTGCACAGG - Intronic
1035229666 7:157457445-157457467 GCAGGCCAGAGGTTCTGCCCTGG + Intergenic
1035679740 8:1479141-1479163 GCAGGCCAGTGTTTCTTCAGCGG + Intergenic
1035848455 8:2890099-2890121 GCAGGGCAAGTGTTGTGCACGGG - Intergenic
1038255359 8:25946265-25946287 GCAGGCCAAGGAGTGTGCATGGG + Intronic
1038346512 8:26737119-26737141 CAAGGCCAGGGTGTGTGCTCTGG - Intergenic
1044205913 8:89491689-89491711 GCAGGCAATAGTGTGTGCACAGG - Intergenic
1044379689 8:91520014-91520036 GCAGGCCAAGCTGTGTGCAAAGG + Intergenic
1045213725 8:100125848-100125870 GCAGGCCCTGGTTTGTGCTTTGG - Intronic
1046606304 8:116375329-116375351 GCACACCAGGATCTGTGCACAGG + Intergenic
1046777907 8:118183369-118183391 GTATGCCAAGGTTTGTGCATTGG + Intergenic
1047414219 8:124650687-124650709 GCAGGGCAGGGTTTGGGTGCTGG + Intronic
1049785051 8:144446531-144446553 GCAGGCCTGGGTGTGAGGACAGG + Intergenic
1049791645 8:144475129-144475151 GCAGGCCAGGGTCGGAGCCCGGG - Intronic
1049923221 9:384473-384495 GCAGGCCAGGGTTTGGGGCTGGG + Intronic
1052238105 9:26237362-26237384 GCAGGCCAGAGCTGGTCCACAGG + Intergenic
1052982852 9:34461452-34461474 GCAGGCCAGGGGTGGGGCATAGG - Intronic
1055147518 9:72954557-72954579 GCAGGCCAGATTTGGTGCACGGG + Intronic
1056249663 9:84734678-84734700 GCAGGCAAGAGTGTGTGCAGGGG - Intronic
1057853519 9:98583889-98583911 TCAGGCCAGGGCTGGTCCACAGG - Intronic
1059625141 9:116055733-116055755 GCAGGCCATGGTGTGGACACAGG - Intergenic
1059637606 9:116186101-116186123 GCAGGCCAGGCATTGTGCTAAGG - Intronic
1060044226 9:120327290-120327312 GGAGACCAGGGTGTGTGCACTGG + Intergenic
1061777205 9:132973403-132973425 GCAGGCCAGCGTGTGTGCTGAGG + Intronic
1062471776 9:136709305-136709327 CCTGGCCAGGGTTTGAGCTCAGG + Intergenic
1203654168 Un_KI270752v1:7549-7571 GCTGGGCAGGGTTTCTTCACTGG + Intergenic
1189607167 X:42691565-42691587 GTAGGCCAGGGTGAGGGCACAGG + Intergenic
1189632068 X:42965223-42965245 GCAGGCAAGAGTGTGTGCAGGGG + Intergenic
1190596736 X:52059541-52059563 TGAGGCCAGGGTGCGTGCACTGG - Intergenic
1190612088 X:52194532-52194554 TGAGGCCAGGGTGCGTGCACTGG + Intergenic
1192033355 X:67538566-67538588 GCAGGCCAGTGTTTGCAGACTGG + Intergenic
1193081798 X:77413404-77413426 GAAGGCATGGGTTTGGGCACTGG - Intergenic
1194977674 X:100410155-100410177 GCAAGCCAGGCATGGTGCACGGG + Exonic
1196075293 X:111569186-111569208 ACAGGTCAGGGTTTGTTCCCTGG + Intergenic
1197499220 X:127223108-127223130 GCAGGCAAGAGCTTGTGTACAGG - Intergenic
1198419621 X:136457404-136457426 GCAGGCCAGATTTGGTCCACAGG + Intergenic
1200091022 X:153636012-153636034 ACAGGCCAGTGTATGAGCACTGG + Intergenic