ID: 969469188

View in Genome Browser
Species Human (GRCh38)
Location 4:7376929-7376951
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469188_969469195 13 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469188_969469194 12 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469188_969469196 19 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469188_969469192 1 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469188_969469198 20 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469188 Original CRISPR GCAGGCCAGGGTTTGTGCAC TGG (reversed) Intronic