ID: 969469189

View in Genome Browser
Species Human (GRCh38)
Location 4:7376941-7376963
Sequence CTGCACGTGACTGCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469189_969469194 0 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469189_969469199 20 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469189_969469196 7 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469189_969469195 1 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469189_969469198 8 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469189 Original CRISPR CTGCACGTGACTGCAGGCCA GGG (reversed) Intronic
900180729 1:1309877-1309899 CAGCACGTGACTTGAGGGCAGGG - Intronic
900212070 1:1461030-1461052 CTGCACGAAACCGCAGGGCAGGG - Intronic
900230149 1:1552577-1552599 CTGCAAGTGACTGCTCTCCATGG + Intronic
900875196 1:5337574-5337596 CTGCAACTGACTGCAGGGCTTGG - Intergenic
901404791 1:9038811-9038833 CTGCAGGTGAGGACAGGCCAGGG - Exonic
901787541 1:11634623-11634645 CTTCACGACATTGCAGGCCATGG + Intergenic
902089468 1:13892143-13892165 CTGCATGTGTTTGCTGGCCAAGG + Intergenic
902232619 1:15037268-15037290 CAGCACGTCACTGAAGGCTATGG - Intronic
902687099 1:18085294-18085316 CTGCAGATGACTGCAGCCCCTGG - Intergenic
903557149 1:24202354-24202376 CTGCACGTGCCTGCTGGCTTTGG - Intergenic
904841621 1:33375536-33375558 CTGCGCCACACTGCAGGCCATGG - Exonic
909612474 1:77567252-77567274 CTGAACTTGACTGGTGGCCATGG - Intronic
911450959 1:98060080-98060102 CTGCACGTGAATGCAGAGTATGG + Intergenic
913961128 1:143338863-143338885 CTGCACGCGACTGCTGGGAAAGG + Intergenic
914055482 1:144164436-144164458 CTGCACGCGACTGCTGGGAAAGG + Intergenic
914123664 1:144801926-144801948 CTGCACGCGACTGCTGGGAAAGG - Intergenic
916025597 1:160830818-160830840 CTGCACGTGGGTGGGGGCCAGGG - Intronic
921159852 1:212465082-212465104 TTGCAGGTGACTGCAGGGCCTGG + Intergenic
922245177 1:223789072-223789094 CTGCATGTCACTGTAGGTCATGG + Exonic
1062935514 10:1383168-1383190 CTGCACGTGGTTCCAGGCAAGGG - Intronic
1063714884 10:8516786-8516808 CTGTAACTGTCTGCAGGCCAGGG + Intergenic
1065928692 10:30459286-30459308 TTGCAGATGACTGCAGTCCAGGG + Exonic
1068600418 10:58950964-58950986 ATGCAGGTGACTGGAGCCCATGG - Intergenic
1069721718 10:70554020-70554042 CTTCACGGGGCTGCAGCCCACGG + Intronic
1070796377 10:79219298-79219320 CAGCACGTGCCAGCAGGGCAGGG - Intronic
1072658634 10:97348340-97348362 CTGCAAGTGACTGCTGCCCTTGG + Intergenic
1074291494 10:112140942-112140964 TTGCATGTGACTGCTGTCCAGGG - Intergenic
1074323132 10:112421962-112421984 CTTCACGTAATTGCAAGCCAGGG - Exonic
1075267095 10:121010425-121010447 CTGCAAGTGTTTGAAGGCCATGG - Intergenic
1076710881 10:132333471-132333493 CTCCAGGTGACTCCAGACCAAGG + Exonic
1078068853 11:8095485-8095507 CCGCTGGTGCCTGCAGGCCACGG - Exonic
1083808050 11:65086852-65086874 GAGCATGTGACTGCAGACCAAGG - Intronic
1084321781 11:68377336-68377358 GAGCCCCTGACTGCAGGCCAAGG + Intronic
1086829310 11:91540259-91540281 CTGCACTTGTCTTCAGGCCTGGG - Intergenic
1088812275 11:113399857-113399879 CTGCACCTAGCTGCACGCCACGG + Exonic
1089010727 11:115129615-115129637 CTGGAGGTGACTACAGCCCACGG - Intergenic
1091049869 11:132357659-132357681 CTGCAGGAGAGTCCAGGCCAAGG + Intergenic
1092028799 12:5266108-5266130 CTGCTAGTGAGTACAGGCCAGGG + Intergenic
1096489578 12:52006507-52006529 CTGCAGGAGACTCCAGGGCAGGG - Intergenic
1096575089 12:52547819-52547841 CTGCACTTGACCACAGGCCAAGG + Intronic
1097056599 12:56253757-56253779 CTGCACATGGCTGCAATCCATGG - Exonic
1099859120 12:88206343-88206365 CTGCACAGGACAGCAGGCCCTGG + Intergenic
1101482043 12:105107704-105107726 CAGCACGTGACTTCCGGCCCCGG - Exonic
1105949658 13:25218193-25218215 CTGTACGTGACTTAAGGGCAGGG - Intergenic
1110379830 13:74837461-74837483 CTGCTGGAGACTGCATGCCAAGG + Intergenic
1113569967 13:111346520-111346542 GTGCCCGTGGCTGCCGGCCAGGG - Intergenic
1113737785 13:112690415-112690437 CCGCACGAGGCTGCAGTCCATGG - Exonic
1118710842 14:68518356-68518378 CTGCCTGTGACTGCAGGCCCCGG + Intronic
1119779056 14:77266153-77266175 CTTCAGGTGAGTGCAGGCCAAGG - Exonic
1122745035 14:103892442-103892464 CTGCACGCCTCTCCAGGCCAGGG + Intergenic
1123502546 15:20903066-20903088 CTGCAGGTTATTCCAGGCCAAGG - Intergenic
1123559794 15:21476733-21476755 CTGCAGGTTATTCCAGGCCAAGG - Intergenic
1123596030 15:21914032-21914054 CTGCAGGTTATTCCAGGCCAAGG - Intergenic
1124688088 15:31799205-31799227 CTGTGCGGGCCTGCAGGCCATGG + Intronic
1125169409 15:36749375-36749397 CTGCAGGTGAATCCAGGGCAGGG - Intronic
1126508981 15:49444665-49444687 CTGCTGCTGACTGCAGACCAAGG + Intronic
1127262061 15:57333584-57333606 CAGCACATGACTGAAGGGCAGGG - Intergenic
1127898069 15:63320541-63320563 CTTCACCTGAGTGGAGGCCAGGG + Intergenic
1128639465 15:69325387-69325409 GTGCACCTGGCTGCAGGCCCAGG - Intronic
1129241921 15:74257019-74257041 CTGCCCTTGCCTGCAGGGCATGG - Intronic
1202968137 15_KI270727v1_random:203895-203917 CTGCAGGTTATTCCAGGCCAAGG - Intergenic
1132750383 16:1454861-1454883 CTGCACGTGCCCCCAGGCCGTGG + Intronic
1133008521 16:2897676-2897698 CTGCAGGGGACAGCAGGGCATGG - Intronic
1133989389 16:10692773-10692795 CTGCAAGTTCCTGCATGCCAGGG - Intronic
1135611567 16:23872089-23872111 CTTCTTGTGACTGCAGGCCTTGG + Intronic
1135846927 16:25927373-25927395 CTGCCAGTGTCTGAAGGCCATGG - Intronic
1136268691 16:29135669-29135691 TTCCACATTACTGCAGGCCATGG - Intergenic
1139850748 16:69950632-69950654 ACCCACGTGACTACAGGCCAGGG - Intergenic
1140372792 16:74422004-74422026 ACCCACGTGACTACAGGCCAGGG + Intergenic
1141068352 16:80932095-80932117 CTGCAGGAGACTGGGGGCCAGGG + Intergenic
1143179176 17:4973621-4973643 CTGCACCTGGCTGCTGCCCAGGG - Exonic
1143578150 17:7807295-7807317 CTGCATGTGGGTGCGGGCCATGG + Exonic
1144952966 17:19004021-19004043 CTGCACCTGAGAGAAGGCCATGG + Exonic
1149646359 17:58244462-58244484 CTGCACCTGAATGCAGGGCTCGG - Intronic
1150210050 17:63436871-63436893 CTCCACCTGCCTCCAGGCCAGGG - Intronic
1150446365 17:65229821-65229843 CTGGAAGTGAATGGAGGCCAGGG + Intergenic
1151338151 17:73452485-73452507 ATGCATGTGTGTGCAGGCCAGGG + Intronic
1152535814 17:80949805-80949827 CAGCACATGTCTGCAAGCCAAGG - Intronic
1153851936 18:9102890-9102912 CTGCACGGGCCTGCAGGCGGCGG + Intronic
1155273671 18:24165670-24165692 CTGCTGGCGTCTGCAGGCCATGG - Intronic
1157121088 18:44911799-44911821 CAGCACTTGACTACATGCCAGGG + Intronic
1160046036 18:75388188-75388210 CTGTATGTGACTGCAGGGAATGG + Intergenic
1160629173 18:80233413-80233435 CCCAAGGTGACTGCAGGCCATGG + Intronic
1165365895 19:35364402-35364424 CTGCACGGGTCTGCAGCCCGGGG + Intergenic
1168103117 19:54151597-54151619 CTGCACGTGGCTGGAGGAGATGG + Intronic
1168240550 19:55086853-55086875 CCGCGCCTGGCTGCAGGCCAAGG + Exonic
1168244293 19:55103427-55103449 CTGCACGTGGCTGCTGCCAAGGG - Exonic
1202694965 1_KI270712v1_random:117113-117135 CTGCACGCGACTGCTGGGAAAGG + Intergenic
925165514 2:1713481-1713503 CTGCGGGTGACTGCAGGCTGGGG + Intronic
925888104 2:8410994-8411016 CTGCACTTTTCTGCAGGGCAAGG - Intergenic
927980840 2:27374186-27374208 CTGGACTTGACTGCAGTACAAGG + Intronic
929557703 2:42935996-42936018 CTGCAGGAGACTGCAGGAGATGG + Intergenic
929762950 2:44821053-44821075 CTGTGCGTGACTGCAGCTCAAGG + Intergenic
933812070 2:86039024-86039046 CTGGAGGTGACTGCAGGCTGTGG - Intronic
934276134 2:91574161-91574183 CTGCACGCGACTGCTGGGAAAGG + Intergenic
936154544 2:110039674-110039696 CTGCAGGTGCCTGCTGGGCAGGG + Intergenic
936190139 2:110331740-110331762 CTGCAGGTGCCTGCTGGGCAGGG - Intergenic
936232344 2:110713930-110713952 CTGCACATGAGTGCAGTCCCTGG + Intergenic
939129093 2:138212797-138212819 CAGCTCCTGAGTGCAGGCCAAGG - Intergenic
944201357 2:197110801-197110823 CTGCACATGACAGCTGTCCATGG - Exonic
1172776689 20:37411620-37411642 CCGCAAGGGACCGCAGGCCACGG - Intergenic
1175525119 20:59628475-59628497 CTGCACGTGAATGGAGGCTTTGG + Intronic
1175910113 20:62401242-62401264 CTGCACATGGGTGCAGGGCAGGG + Intronic
1179452698 21:41476383-41476405 CTGAAGGTGTCTACAGGCCATGG + Intronic
1179490902 21:41741052-41741074 CTGCACCTGGCTGCCGCCCACGG - Exonic
1180073202 21:45449014-45449036 CTGCCCCTGACAGGAGGCCACGG - Intronic
1181126872 22:20707952-20707974 CTGCATGTGGCGGCAGGGCAGGG + Exonic
1181494973 22:23282618-23282640 CTGCAGGTGACAGCAGGGCAAGG + Intronic
1183927108 22:41214081-41214103 CACCAAGTGACTGAAGGCCAGGG + Intronic
1184248490 22:43247622-43247644 CAGGTGGTGACTGCAGGCCAAGG - Intronic
1185082835 22:48719154-48719176 CTGCGGGTGTGTGCAGGCCAGGG - Intronic
1185261234 22:49865026-49865048 CTGCAAGTGACGGCAGCCCCGGG + Intronic
949359989 3:3221494-3221516 CTGGGGCTGACTGCAGGCCAGGG + Intergenic
949761769 3:7478817-7478839 GTGCAGGTGACTGCATGCCTGGG - Intronic
950426633 3:12927959-12927981 CTGCACTGTACAGCAGGCCATGG + Intronic
950496917 3:13339431-13339453 CTGCAAGTCACTGCTGGCGAAGG + Intronic
953907964 3:46877838-46877860 CTGCAGGTGAGTGGGGGCCAGGG + Intronic
953981203 3:47414035-47414057 CTGCTGGTGACTGGCGGCCAGGG - Exonic
954581248 3:51704018-51704040 CTGCAGGAGGGTGCAGGCCATGG - Exonic
961403709 3:126664562-126664584 CTGCAAGTCACTGCTGGCGAAGG - Intergenic
967016691 3:185488712-185488734 CCTCCAGTGACTGCAGGCCAAGG + Exonic
969469189 4:7376941-7376963 CTGCACGTGACTGCAGGCCAGGG - Intronic
969469933 4:7381782-7381804 CTGCACATGGCTGCAGTCCAGGG - Intronic
976001264 4:80375447-80375469 CTGCACATGACTTCATTCCAGGG + Intronic
977683106 4:99816743-99816765 CTGCCAGTGCCTCCAGGCCAGGG + Intergenic
985731853 5:1553856-1553878 CTGAGAGTGACAGCAGGCCACGG + Intergenic
986768407 5:10949313-10949335 CTGAACGTGTCTGAAGGCTATGG + Intergenic
989169741 5:38462344-38462366 CTGAAGGTGACAGCGGGCCAGGG - Intronic
992477410 5:77117337-77117359 CTGAACATGACTGAATGCCAGGG - Intergenic
992726392 5:79612169-79612191 CTGCACGTGAGTTCAGGCAAGGG + Intronic
999109907 5:149110146-149110168 CTGCACCTGAATTAAGGCCAAGG + Intergenic
1000961358 5:167605150-167605172 TTCCCCATGACTGCAGGCCATGG + Intronic
1001044028 5:168357508-168357530 ATGCACGTGCGTGCATGCCAGGG + Intronic
1004912351 6:20299309-20299331 CTGCACTCAACTGCAAGCCAGGG - Intergenic
1005995583 6:30929238-30929260 CTGCCCATTACTGCAGGCTAGGG + Intergenic
1007809776 6:44477532-44477554 CTGCACATGTCTGCTGGGCAAGG + Intergenic
1010458572 6:76086900-76086922 CTGAGGTTGACTGCAGGCCAGGG + Intergenic
1012377303 6:98577996-98578018 CTGCATGTGATTCCAGGCAATGG + Intergenic
1012556407 6:100518114-100518136 CTGGACGTGGCTGCAAACCAGGG - Exonic
1018663890 6:166115337-166115359 CTGCAAGTGACTGCAGACGTGGG + Intergenic
1021153185 7:17176897-17176919 TTTCACGTGACTAAAGGCCATGG - Intergenic
1021921896 7:25494195-25494217 CTGCAGGTGACTGGAGGTAACGG + Intergenic
1026795415 7:73363377-73363399 CTGCACGTGCCTCCAGCACAAGG - Intergenic
1034494745 7:151412731-151412753 CTGCAGGTGGCTGCAGGACTGGG - Intergenic
1034499271 7:151439652-151439674 CTGCTCCTGACTGCAGGGCGAGG + Intronic
1036179259 8:6568812-6568834 CTGCCCCTGCCTGCAGGCCTTGG + Intronic
1036182146 8:6594707-6594729 CTGCAGGGGACTGCAGGGGAAGG + Intronic
1036760956 8:11508267-11508289 GTGCATGTGTCTGCAAGCCACGG - Intronic
1037891136 8:22624278-22624300 CTACAGGAGGCTGCAGGCCAAGG - Exonic
1038798188 8:30727686-30727708 CGGCTCCTGCCTGCAGGCCATGG + Exonic
1040787225 8:51179926-51179948 CAGCCCGGGACTGCAGCCCAGGG - Intergenic
1041717322 8:60943953-60943975 CTGGACGTTGCTGCAAGCCAAGG - Intergenic
1045012392 8:97969538-97969560 CTACATGTGACTGCAATCCAAGG - Intronic
1045638417 8:104220471-104220493 CTGCAAGTGACTGCTGGGGATGG - Intronic
1048459477 8:134609523-134609545 CTGTACGTCACTGCAGACCAAGG - Intronic
1053433197 9:38057746-38057768 CTGCAGGTTTCTCCAGGCCACGG - Intronic
1059436556 9:114280591-114280613 CTGTATGTGGCTGGAGGCCACGG + Intronic
1060407987 9:123382126-123382148 CTGCTCGTGCCTGCAGCCCCGGG + Exonic
1061802911 9:133121801-133121823 CTGCACCTGACTACAGGCTCAGG + Intronic
1062153394 9:135032959-135032981 CAGCCCGTGACCCCAGGCCAGGG + Intergenic
1186481567 X:9899997-9900019 CTGCACGTGACAGCTGTTCAGGG - Intronic
1187199005 X:17116986-17117008 CAGCTCTTGACTGGAGGCCATGG - Intronic
1196937164 X:120741447-120741469 CTGAAAGTGACCGCAGGCCTTGG - Intergenic