ID: 969469189

View in Genome Browser
Species Human (GRCh38)
Location 4:7376941-7376963
Sequence CTGCACGTGACTGCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469189_969469196 7 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469189_969469198 8 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469189_969469194 0 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469189_969469195 1 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469189_969469199 20 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469189 Original CRISPR CTGCACGTGACTGCAGGCCA GGG (reversed) Intronic