ID: 969469190

View in Genome Browser
Species Human (GRCh38)
Location 4:7376942-7376964
Sequence GCTGCACGTGACTGCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469190_969469198 7 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469190_969469194 -1 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469190_969469199 19 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469190_969469195 0 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469190_969469196 6 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469190 Original CRISPR GCTGCACGTGACTGCAGGCC AGG (reversed) Intronic
900165492 1:1242819-1242841 GCTGCAGGTGAGTCCGGGCCGGG - Exonic
900296988 1:1956850-1956872 CCTGCACGTGGCTCCAGGCAGGG + Intronic
903336004 1:22625196-22625218 ACTGCACGTTACTGCATGCCAGG + Intergenic
903687149 1:25140224-25140246 TCTGGACTTGACTGCAGGCCTGG + Intergenic
908029802 1:59987217-59987239 TCTGGAGGTGACTGCAAGCCAGG - Intergenic
908100522 1:60786332-60786354 GCTGCACCTGGCTGAAGGCTGGG + Intergenic
917722639 1:177800630-177800652 GCTGCACCTGCCTGAAGGCTTGG - Intergenic
924044396 1:240012389-240012411 GTTGCAGGTGACTGCAGTCAAGG - Intergenic
924416221 1:243859494-243859516 GCTGCACGTTACAGTAGTCCGGG + Intergenic
1062901943 10:1153088-1153110 GCTGACGGTGAGTGCAGGCCGGG - Intergenic
1062935515 10:1383169-1383191 GCTGCACGTGGTTCCAGGCAAGG - Intronic
1063382082 10:5591778-5591800 GCAGCAGGTGAAAGCAGGCCCGG - Intergenic
1064184835 10:13152594-13152616 GCATCACATGACAGCAGGCCTGG + Intergenic
1067432929 10:46255829-46255851 GCTGCATCTGCCTGCTGGCCTGG + Intergenic
1067440330 10:46305608-46305630 GCTGCATCTGCCTGCTGGCCTGG - Intronic
1069936588 10:71921742-71921764 TCTGACTGTGACTGCAGGCCTGG - Intergenic
1071639808 10:87295369-87295391 GCTGCAGATGACTACAGCCCTGG - Intergenic
1071655426 10:87442583-87442605 GCTGCAGATGACTACAGCCCTGG + Intergenic
1074206625 10:111288366-111288388 GCTGAACTTGAATTCAGGCCTGG - Intergenic
1074277915 10:112022484-112022506 GCTTCAGGTGACTGCAGACCTGG + Intergenic
1074323133 10:112421963-112421985 GCTTCACGTAATTGCAAGCCAGG - Exonic
1075564251 10:123492204-123492226 GCTGCACCTGCCGGCAGGCCTGG - Intergenic
1075565979 10:123504714-123504736 GCTGCAGGTGACTGGTGCCCTGG - Intergenic
1076864152 10:133159237-133159259 GCTGCACCTGACTGCTGACTCGG + Intergenic
1076903106 10:133349643-133349665 GCTGCACGCTGCTGCAGGCAGGG - Intronic
1077087751 11:763171-763193 GGGGCAGGTGAATGCAGGCCAGG - Intronic
1077116133 11:885433-885455 GCTCCACGTACCTGCAGGCCGGG - Intronic
1078397370 11:10993067-10993089 GCTTCAGATGACTGCAGCCCTGG - Intergenic
1080304580 11:30822438-30822460 GCTTCAGATGACTGCAGCCCTGG + Intergenic
1083578673 11:63811314-63811336 GCTGCACTTGACTCCAGCCTGGG - Intergenic
1086829311 11:91540260-91540282 TCTGCACTTGTCTTCAGGCCTGG - Intergenic
1088700300 11:112405592-112405614 CCTTCAGGTGACTGCAGCCCTGG - Intergenic
1089253452 11:117181197-117181219 CCTGCACATGTCTGCCGGCCAGG + Intronic
1090865847 11:130699786-130699808 GCTGCACGTGATTTCTGGGCAGG + Intronic
1096489579 12:52006508-52006530 GCTGCAGGAGACTCCAGGGCAGG - Intergenic
1097110193 12:56652301-56652323 GCGGCACGCGCCTGCAGTCCCGG + Intergenic
1097198639 12:57259428-57259450 CCTGCACGTGTCTGCAGCCCTGG - Intronic
1097820390 12:64122762-64122784 GTGGCACGTGCCTGCAGTCCCGG + Intronic
1099618993 12:84976408-84976430 TCTGCACTGGAGTGCAGGCCTGG + Intergenic
1103167922 12:118786288-118786310 GCTTCAGATGACTGCAGCCCTGG + Intergenic
1103521989 12:121542287-121542309 GCTTCAGCTGACTGCAGCCCAGG + Intronic
1105949659 13:25218194-25218216 GCTGTACGTGACTTAAGGGCAGG - Intergenic
1108088283 13:46818441-46818463 GCTGCAAGTCTCTGCAGGACTGG + Intergenic
1113809684 13:113130695-113130717 GCTGCAGGTGACTGCACTCCGGG - Intronic
1116763438 14:49042293-49042315 GCTGAATGTTACTGCATGCCAGG - Intergenic
1117372964 14:55095664-55095686 ATGGCACGTGACTGCAGTCCTGG - Intergenic
1121074430 14:91055966-91055988 TCTTCAGGTGACTGCAGTCCTGG + Intronic
1122745034 14:103892441-103892463 GCTGCACGCCTCTCCAGGCCAGG + Intergenic
1125532192 15:40420958-40420980 ACAGCACTTGGCTGCAGGCCAGG - Intronic
1126115096 15:45200888-45200910 GCTTCACATCATTGCAGGCCCGG + Exonic
1127898068 15:63320540-63320562 GCTTCACCTGAGTGGAGGCCAGG + Intergenic
1130296935 15:82653969-82653991 GCTTCAAGTGACTGCAGTTCTGG - Intergenic
1131999425 15:98163854-98163876 GCTGCATGGAACTGCAGCCCTGG + Intergenic
1132371877 15:101305261-101305283 GCCGCACGTGCCTCCTGGCCGGG - Exonic
1133031694 16:3014144-3014166 GCTACACCTGGCTGCAGGGCTGG + Exonic
1141068351 16:80932094-80932116 GCTGCAGGAGACTGGGGGCCAGG + Intergenic
1141848841 16:86630348-86630370 GCTGCCCGTGAGGGAAGGCCGGG - Intergenic
1142216386 16:88831997-88832019 AGGGCACGTCACTGCAGGCCAGG - Exonic
1144853604 17:18256510-18256532 GCTGCGCGTGAGTGCTGGCCGGG - Exonic
1144854434 17:18260280-18260302 GCTGCACATGGCTAGAGGCCCGG - Intergenic
1146367876 17:32243592-32243614 CCTTCAGGTGACTGCAGCCCTGG - Intronic
1146725137 17:35150124-35150146 GCTGCACGTCTTTGAAGGCCTGG - Exonic
1147424464 17:40339403-40339425 GCGGCAGCTGTCTGCAGGCCTGG - Intronic
1150446364 17:65229820-65229842 GCTGGAAGTGAATGGAGGCCAGG + Intergenic
1155666456 18:28315413-28315435 CCTCCAGGTAACTGCAGGCCTGG + Intergenic
1160348586 18:78154612-78154634 GCTGCACCTGAGTGCCTGCCAGG + Intergenic
1161436679 19:4267731-4267753 GCTGCCCGTTGCTGCAGTCCGGG - Exonic
1161479712 19:4504437-4504459 GCTGTAGGAGCCTGCAGGCCCGG - Exonic
1162818253 19:13208724-13208746 GCTGCAAGTGACCCCAGGCTGGG - Intronic
1165365894 19:35364401-35364423 CCTGCACGGGTCTGCAGCCCGGG + Intergenic
1167318249 19:48779107-48779129 CCTTCACATGACTGCAGTCCTGG + Intergenic
925165513 2:1713480-1713502 CCTGCGGGTGACTGCAGGCTGGG + Intronic
925342038 2:3144694-3144716 GCTCCATGGGACTTCAGGCCTGG - Intergenic
926004909 2:9366069-9366091 GCTGCAGGTGCCAGCAGGACAGG - Intronic
926370872 2:12177610-12177632 CCTGCACGGGACTGCAGCCCGGG - Intergenic
927473403 2:23393840-23393862 GCCCCACCTGACTGCTGGCCCGG + Intronic
928178767 2:29053102-29053124 CCAGCACGTGGCTGCAGGCTGGG - Exonic
929244859 2:39690241-39690263 GGAGCACGTGACTGCAGGTGAGG - Intronic
929455401 2:42061449-42061471 GCTGTAGCTGGCTGCAGGCCAGG + Intergenic
930028027 2:47041334-47041356 TCTGCAAGTGCCTGCAGGCAGGG - Intronic
931462672 2:62462167-62462189 GATGCACTTGAGTGCAGGACTGG - Intergenic
931537860 2:63298768-63298790 GTTGCACTTGGCTGCAGCCCTGG + Intronic
931651035 2:64468992-64469014 GCTTCAAGTGACTGCAGCTCTGG - Intergenic
932910910 2:75805324-75805346 GCTGCTCCTGCCTGGAGGCCTGG - Intergenic
933183360 2:79251740-79251762 CCTGGACATGACTGCAGCCCTGG + Intronic
935414786 2:102803904-102803926 GCTGCATGTGCCTGCAGGTGTGG - Intronic
936154543 2:110039673-110039695 GCTGCAGGTGCCTGCTGGGCAGG + Intergenic
936190140 2:110331741-110331763 GCTGCAGGTGCCTGCTGGGCAGG - Intergenic
938168793 2:129056844-129056866 TCTGCCCGTGGCTGCAGTCCAGG - Intergenic
938841984 2:135173030-135173052 GCTGCAGTTACCTGCAGGCCAGG - Intronic
940108839 2:150128208-150128230 GCTGCTCGTGATAGCTGGCCTGG + Intergenic
945934694 2:215891395-215891417 ATTGCAGGTGACTGCAGCCCTGG - Intergenic
946337526 2:219048556-219048578 GCTGCAGATGGCTGCAGCCCTGG - Intergenic
947534188 2:230930582-230930604 GTGGCACGTGTCTGCAGTCCTGG - Intronic
948402344 2:237692826-237692848 GCTCCCTGTGACTCCAGGCCAGG - Intronic
1170590101 20:17765252-17765274 GCTGCAATGGACTCCAGGCCAGG + Intergenic
1172248644 20:33463515-33463537 GCCCCACGTGAGTGCTGGCCGGG + Intergenic
1172578382 20:36027302-36027324 GCTGCAGGTGATTCCAGCCCTGG + Intronic
1172763137 20:37336144-37336166 GCTGCACAGGACTGCAGTCCTGG + Intergenic
1175108484 20:56630311-56630333 GCTGCCCCTGCCCGCAGGCCCGG + Intronic
1175911999 20:62409461-62409483 GATGCTCCTGACTGCAGGCCTGG + Intergenic
1175997697 20:62818832-62818854 GCTCCAGGTGACCTCAGGCCTGG - Intronic
1176064773 20:63188755-63188777 GGTGCAGCAGACTGCAGGCCTGG - Intergenic
1176425839 21:6547723-6547745 CCTGCTTCTGACTGCAGGCCTGG + Intergenic
1178485889 21:33020085-33020107 GCTGCACTTTACCGCAGCCCTGG + Intergenic
1178673532 21:34612793-34612815 GTTGCTCATGGCTGCAGGCCTGG + Intronic
1179701330 21:43156040-43156062 CCTGCTTCTGACTGCAGGCCTGG + Intergenic
1179821278 21:43938859-43938881 GCTTCAGGTGACTGCATCCCCGG - Intronic
1184690558 22:46115439-46115461 GCTGCCTCTGACTGCAGGGCTGG - Intergenic
1185261233 22:49865025-49865047 TCTGCAAGTGACGGCAGCCCCGG + Intronic
949359988 3:3221493-3221515 GCTGGGGCTGACTGCAGGCCAGG + Intergenic
949761770 3:7478818-7478840 TGTGCAGGTGACTGCATGCCTGG - Intronic
950583436 3:13878022-13878044 GTTGCAGGTGACTTCGGGCCAGG - Intronic
950772675 3:15324541-15324563 GCTGCACCAGATTCCAGGCCTGG - Intronic
952867487 3:37863548-37863570 GCTGCACCTGACCTCAGTCCAGG - Intronic
953907963 3:46877837-46877859 GCTGCAGGTGAGTGGGGGCCAGG + Intronic
954917803 3:54163832-54163854 GCTGCACCTGACATCATGCCTGG - Intronic
956860099 3:73314455-73314477 GCTGCTGGTGACTGCAGACTTGG + Intergenic
965680654 3:171247974-171247996 GCTGAAGATGACTGCAGGCTGGG + Intronic
966682036 3:182651956-182651978 GCTGCACTTGACTGCAGGGGAGG + Intergenic
968189050 3:196654206-196654228 ACTCCAGGTGACTGGAGGCCTGG + Intronic
968309957 3:197675123-197675145 GCTGCGAGCGGCTGCAGGCCCGG - Exonic
968506463 4:973395-973417 CCAGCACGGGGCTGCAGGCCGGG + Exonic
969469190 4:7376942-7376964 GCTGCACGTGACTGCAGGCCAGG - Intronic
969469934 4:7381783-7381805 GCTGCACATGGCTGCAGTCCAGG - Intronic
971424228 4:26500774-26500796 GTGGCACGTGCCTGCAGTCCCGG - Intergenic
972944183 4:44233590-44233612 GTTCCACCTGACAGCAGGCCAGG - Intronic
975588317 4:75973897-75973919 CCTGCACATCACTGCATGCCTGG + Intronic
982586796 4:157251753-157251775 GCTGCATGTCACTGCAGGGATGG + Intronic
991511103 5:67376976-67376998 TCTGCACATGTCTGCAGGACAGG - Intergenic
992726391 5:79612168-79612190 GCTGCACGTGAGTTCAGGCAAGG + Intronic
996056447 5:118988278-118988300 GCTGCAGGTGACCGCGGGGCTGG - Exonic
1001591555 5:172869034-172869056 ACTGCACCTGACAGCAGGCCTGG - Intronic
1002621455 5:180491513-180491535 GCTGCGCGTGCATGCAGGGCGGG - Intergenic
1004151138 6:13120993-13121015 GCTGCACCTGTCTGAATGCCCGG - Intronic
1007091772 6:39189303-39189325 ACTGCGGGTGACTGGAGGCCGGG - Exonic
1007417496 6:41700623-41700645 GCTGCGGGAGACTGCAGGGCTGG + Intronic
1012556408 6:100518115-100518137 GCTGGACGTGGCTGCAAACCAGG - Exonic
1018170533 6:161140056-161140078 GCTCCTCCTGACTGCGGGCCAGG - Intronic
1018663889 6:166115336-166115358 CCTGCAAGTGACTGCAGACGTGG + Intergenic
1019200989 6:170315036-170315058 ACTGAACCTGACTGCAAGCCAGG - Intronic
1019357852 7:590336-590358 GCTGAACATGGCTGCAGGCCTGG + Intronic
1019496146 7:1341499-1341521 CCTGCCCGTCAGTGCAGGCCGGG - Intergenic
1019630463 7:2046217-2046239 GGTGCCTGTGAGTGCAGGCCTGG - Intronic
1020509570 7:9036665-9036687 GCTGCACGTGACTTCTGGAGTGG + Intergenic
1021744663 7:23726572-23726594 GCTGCACTGCACTCCAGGCCTGG + Intronic
1021940796 7:25677265-25677287 GCTGCCCGTGACTGCAGAGCGGG - Intergenic
1023454520 7:40323781-40323803 CCACCACTTGACTGCAGGCCAGG - Intronic
1026197595 7:68186289-68186311 GCTGCATCTGAGTCCAGGCCTGG - Intergenic
1027407484 7:77877246-77877268 GCTGCACGTGCCACCATGCCTGG + Intronic
1030006696 7:105127324-105127346 GCCGCACCTGCATGCAGGCCTGG + Intronic
1032520272 7:132538510-132538532 GCTGCCCTGGACTCCAGGCCTGG + Intronic
1034091944 7:148371795-148371817 GCTGCACATGTCTGCAGCCTGGG - Intronic
1034494746 7:151412732-151412754 TCTGCAGGTGGCTGCAGGACTGG - Intergenic
1035043881 7:155951605-155951627 GCTGCTGGTGACTCAAGGCCGGG + Intergenic
1035045559 7:155963237-155963259 GGTCCACGTGTCTGCAAGCCTGG - Exonic
1035131704 7:156660753-156660775 GATACGAGTGACTGCAGGCCAGG + Intronic
1035703220 8:1653217-1653239 GCTGCCCGTGTCTCCAGGCCTGG - Intronic
1035819024 8:2571780-2571802 GCTTCATGTGACTGCAGTCTGGG - Intergenic
1036619081 8:10411215-10411237 GCTGCAGGTGATAGCATGCCTGG - Intronic
1040778290 8:51073772-51073794 CCTGCAGGTGACTGCTGGACTGG + Intergenic
1040787226 8:51179927-51179949 GCAGCCCGGGACTGCAGCCCAGG - Intergenic
1046074136 8:109296973-109296995 GCTTCAGATGACTGCAGCCCTGG + Intronic
1048321919 8:133406668-133406690 GCTGCTCCTGACTCCAGGCAGGG - Intergenic
1057530005 9:95836861-95836883 GCTCCACGTGTCAGCAGGGCAGG + Intergenic
1060407986 9:123382125-123382147 ACTGCTCGTGCCTGCAGCCCCGG + Exonic
1062638042 9:137501673-137501695 TCTGCACGTTCCTGCAGGCACGG - Exonic
1186699794 X:12078015-12078037 GCTACAGGTGACTGTAGCCCTGG - Intergenic
1190458788 X:50650482-50650504 GTGGCACGTGCCTGCAGTCCCGG - Intronic