ID: 969469191

View in Genome Browser
Species Human (GRCh38)
Location 4:7376947-7376969
Sequence TTCAGGCTGCACGTGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469191_969469198 2 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469191_969469194 -6 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469191_969469199 14 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469191_969469196 1 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469191_969469195 -5 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469191 Original CRISPR TTCAGGCTGCACGTGACTGC AGG (reversed) Intronic