ID: 969469191

View in Genome Browser
Species Human (GRCh38)
Location 4:7376947-7376969
Sequence TTCAGGCTGCACGTGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469191_969469198 2 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469191_969469196 1 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469196 4:7376971-7376993 ACCGGCTCTGCACTGGGATTCGG No data
969469191_969469195 -5 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469195 4:7376965-7376987 CTGAAGACCGGCTCTGCACTGGG No data
969469191_969469194 -6 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469191_969469199 14 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469191 Original CRISPR TTCAGGCTGCACGTGACTGC AGG (reversed) Intronic
900094622 1:935237-935259 TGCGAGCTGCACGTGTCTGCCGG + Intronic
900483374 1:2910087-2910109 TTCAGGGTGCCTGTGAGTGCAGG + Intergenic
900483377 1:2910104-2910126 TGCAGGAGGCACGTGAGTGCAGG + Intergenic
902718530 1:18289405-18289427 ATCAGGCTGGAAGAGACTGCGGG - Intronic
902879465 1:19361521-19361543 TTCAGGAGGGAGGTGACTGCAGG + Intronic
903198864 1:21716520-21716542 TTCAGACTGCAGTTCACTGCAGG + Intronic
904880306 1:33691342-33691364 TTCATCCTGCACGGCACTGCTGG - Intronic
906011362 1:42529880-42529902 TTCAGTCTGCAGTTGACTGCAGG - Intronic
906508057 1:46394532-46394554 TTCCGGCTCCAGGTGACTGCCGG + Exonic
912345317 1:108958249-108958271 TTCAGACTGCAGTTGACTGTGGG - Intronic
912454557 1:109788930-109788952 TCCAGGCTGCTCGTGCCTCCAGG + Intergenic
916864869 1:168845606-168845628 TCCAGGATGCACCTGCCTGCAGG + Intergenic
918870282 1:189963688-189963710 TTCAGACTGCAGTTGACTGCAGG - Intergenic
920507583 1:206527380-206527402 TTCAGGCTCCACAAGACAGCAGG - Intronic
921667744 1:217893085-217893107 TTCAGACTGCAGGTGACCACAGG + Intergenic
922942414 1:229479033-229479055 TTCAGACTGCAGTTGACTGCAGG - Intronic
923024368 1:230193247-230193269 TTCAGGCTGCAGGAGGCTTCAGG - Intronic
923321557 1:232839296-232839318 TTCAGGCTGCAGGTATCTGTTGG + Intergenic
1068635024 10:59339032-59339054 TTCCAGCTCCAGGTGACTGCTGG + Intronic
1069182645 10:65382193-65382215 TTCAGGCCGTAGTTGACTGCAGG - Intergenic
1076900825 10:133336539-133336561 TCCAGGCTTCCCGTGACGGCGGG - Intronic
1079581072 11:22065611-22065633 TTGAGGCTGCACATGGCAGCAGG + Intergenic
1080938218 11:36884849-36884871 TTCAGGGTGCAGGTGGCTGATGG - Intergenic
1081115316 11:39192720-39192742 CTCAGGCTGCACAGGAGTGCTGG + Intergenic
1081866977 11:46365603-46365625 GTCAGGCTGAAGGTGACTCCTGG - Intronic
1089669540 11:120043989-120044011 TTGAGGCTGCACAGGACAGCAGG + Intergenic
1095651033 12:44609491-44609513 TTCAGACTGCATTTGACTGTGGG + Intronic
1097750626 12:63348606-63348628 TTCAGACTGCAGTTGACAGCAGG + Intergenic
1097767826 12:63545648-63545670 TTCAGGCTGCAGATGACTGAGGG - Intergenic
1097784189 12:63740710-63740732 TTCAGGCTGCAGATGACTGAGGG - Intergenic
1102644570 12:114395849-114395871 TCCAGGCTGCACGTTCTTGCTGG + Intronic
1107128593 13:36871043-36871065 TTCAGGCTGCAACTGACCTCTGG + Intronic
1108540393 13:51438882-51438904 GTCAGGCTGCAAGTGACAGTGGG - Intronic
1110901861 13:80834388-80834410 TTGAGGCTGCACAAGACAGCAGG + Intergenic
1116352728 14:43885796-43885818 TTCAGGCTTCATTTGAATGCTGG - Intergenic
1117814004 14:59578359-59578381 TTCAGGCTACAGTTGACTGTAGG + Intergenic
1119671744 14:76525291-76525313 CACTGGCTGCACGTGGCTGCAGG + Intergenic
1120897279 14:89544925-89544947 TTCAAGCTGCAGTTGACTGTAGG + Intronic
1121126796 14:91413061-91413083 TTCAGGCTGCTTGTGACCCCTGG - Intronic
1121281433 14:92701874-92701896 TTCAGGCCGCAGTTGACTTCAGG - Intergenic
1121453667 14:94025195-94025217 TTCACTCTGCATGTGACTACAGG - Intergenic
1121844676 14:97162309-97162331 CTCAGGCTGGATGTGACTACAGG - Intergenic
1125208991 15:37189372-37189394 TTCAGACTGCAGTTGACTTCAGG + Intergenic
1125596231 15:40888304-40888326 TTCAGACTGCTATTGACTGCAGG + Intergenic
1132134729 15:99324316-99324338 TTCAGACTGCAGTTGACTGTGGG + Intronic
1132421534 15:101673989-101674011 TTCAGACTGCAGTCGACTGCGGG - Intronic
1133327134 16:4948657-4948679 TTCAGGCTGGGCGTGGCGGCAGG - Intronic
1134792466 16:17001693-17001715 TTCAAGGTGCAGGTAACTGCCGG - Intergenic
1135294230 16:21265218-21265240 CTCAGGCTGCATGGGACTGGTGG - Intronic
1135709271 16:24701217-24701239 ATGAGGCTGCAGGGGACTGCAGG + Intergenic
1138676515 16:58655376-58655398 TCCAGGCTGCAATTAACTGCTGG + Intergenic
1139094606 16:63690406-63690428 TTCAGCCAATACGTGACTGCGGG + Intergenic
1142322317 16:89391413-89391435 TCCAGGCTGCACGGGATTGTGGG + Intronic
1145023977 17:19453698-19453720 TTCAGGATGAACGGGAATGCAGG + Intergenic
1146233665 17:31136424-31136446 TTCAGACTGCAGTTGACTGTGGG - Intronic
1150317052 17:64177901-64177923 TTCAGGCTGAACTTGAGTCCTGG - Intronic
1156270203 18:35523652-35523674 TCCAGGCTGCAAGTGACTTGGGG + Intergenic
1161232028 19:3179192-3179214 TTCAGCCTGCTCTTCACTGCAGG + Exonic
1164309712 19:24034930-24034952 TTCATGCTGCGCATGACGGCAGG - Intronic
925406288 2:3607161-3607183 GTCAGGCTGCCGCTGACTGCTGG + Intronic
928539027 2:32266939-32266961 TTCCAGCTGCAGGTGGCTGCTGG - Intergenic
929244860 2:39690246-39690268 TTGAGGGAGCACGTGACTGCAGG - Intronic
930479135 2:51925308-51925330 TTCAGACTGCAGTTGACTGCAGG + Intergenic
930725134 2:54674934-54674956 TCAAGGCTGCCCCTGACTGCAGG + Intergenic
935893294 2:107704288-107704310 TTCAGCCTGCACGTCATTGCTGG - Intergenic
937320277 2:120956758-120956780 TACAGGCTGCACGGCCCTGCAGG - Intronic
938750770 2:134327661-134327683 TTCAGACTGCAGTTGACTGTGGG + Intronic
938911064 2:135886454-135886476 TTCAGGCTCCACATGCCTGCCGG - Intergenic
939920911 2:148112007-148112029 TTTGGGCTGCAGTTGACTGCAGG + Intronic
942197337 2:173534568-173534590 TTCTGGCTCCACCTGACTCCAGG + Intergenic
943091545 2:183381435-183381457 TTCAGGCTGAAAGTATCTGCTGG + Intergenic
947553734 2:231068516-231068538 TTCAGTCTGTAGTTGACTGCAGG - Intronic
1168784793 20:528972-528994 TTCAGACTGCAGTTGACTGCGGG - Intronic
1170770551 20:19328765-19328787 TTCAGGCTGCAGGTCAAGGCTGG + Intronic
1172870165 20:38130822-38130844 GTGAGGATGCACGTGTCTGCAGG + Intronic
1173081404 20:39871549-39871571 TTCATGCTGCTAGTGACTGTGGG + Intergenic
1178981275 21:37267321-37267343 TTCCGGCTGCGCGTGACCCCAGG + Exonic
1179920737 21:44505919-44505941 CTCAGGCTGCTGGTGCCTGCTGG + Intronic
1181444477 22:22958353-22958375 TACAGGATGGACGTGAATGCTGG + Intergenic
1181494971 22:23282612-23282634 CTCAGGCTGCAGGTGACAGCAGG + Intronic
1181568361 22:23752924-23752946 TTCAGGCTGCACGGGACTAATGG + Exonic
1182951260 22:34378125-34378147 TCCAGGTTGTATGTGACTGCAGG + Intergenic
1183677675 22:39308841-39308863 TTCAGGCTGTGGCTGACTGCTGG - Intergenic
1184499144 22:44861461-44861483 TTCAGGCTCCCCCTGGCTGCCGG - Intronic
950358216 3:12429506-12429528 TCCAGGCTGCTCTTGAATGCTGG - Intronic
950626707 3:14252814-14252836 TTCAGGCTGCACGAGAAAGAGGG - Intergenic
952327963 3:32337833-32337855 TTCTGGCTGGACTTGGCTGCTGG - Intronic
954554497 3:51507255-51507277 TCCAGGCTGCCCCTGACTTCTGG - Intergenic
954602602 3:51881300-51881322 TTCAGGCTCCATCTGACTGGAGG - Intergenic
955554488 3:60121367-60121389 TTCAAACTGCAGTTGACTGCAGG - Intronic
955887723 3:63618596-63618618 TCCAGGCTGCACTTGCCTGTAGG - Intergenic
957542815 3:81596795-81596817 TTCATTCTCCATGTGACTGCTGG - Intronic
957699064 3:83686227-83686249 CTGAGGCTGCACCTGAATGCTGG - Intergenic
963549662 3:146703252-146703274 TTCTGGCTCCAGTTGACTGCAGG - Intergenic
966682033 3:182651951-182651973 CTAAGGCTGCACTTGACTGCAGG + Intergenic
967784212 3:193472174-193472196 TTCTGACTGCAGTTGACTGCAGG - Intronic
967908935 3:194525211-194525233 TTCAGGTAGCACTTGTCTGCTGG + Intergenic
969469191 4:7376947-7376969 TTCAGGCTGCACGTGACTGCAGG - Intronic
979818505 4:125141018-125141040 TTTAGACTGCAGTTGACTGCAGG - Intergenic
982347601 4:154378049-154378071 TTCAGTCTGCAGGTGCCTGTAGG + Intronic
985717607 5:1471502-1471524 GACAGTCTGCACGTGGCTGCAGG + Intronic
987308946 5:16664479-16664501 TTCAGGCAGCACCTGGCTTCAGG + Intronic
990344006 5:54853572-54853594 TTCTAGCTGCATGTGACTGGTGG + Intergenic
996919226 5:128748058-128748080 TTCAGGCCGCAGTTGACTGCAGG - Intronic
996945512 5:129062418-129062440 TTCAGACTACAGTTGACTGCAGG + Intergenic
1001591556 5:172869039-172869061 TTCAAACTGCACCTGACAGCAGG - Intronic
1002356398 5:178632776-178632798 TTCTGACTGCAGTTGACTGCGGG - Intergenic
1002458324 5:179358813-179358835 TTCTGGCTTCTGGTGACTGCTGG - Intergenic
1003961532 6:11213506-11213528 GGCAGGCTGCTCGTGACTGGAGG + Exonic
1004069583 6:12286798-12286820 TTGAGGCTACACTTGAATGCTGG - Intergenic
1006917988 6:37608242-37608264 TTCAGGCTGCCTTTGACTCCAGG + Intergenic
1006925505 6:37652121-37652143 TCTAGGCTGCTGGTGACTGCGGG + Exonic
1007766061 6:44160777-44160799 TTCAGACTGCAGTTGACAGCGGG - Intronic
1007792489 6:44319340-44319362 TTCAGGCTGCATGTGAGGGTAGG + Intronic
1012160331 6:95877072-95877094 TTCAGGCTGCAGTTGACTCCAGG - Intergenic
1015746036 6:136510630-136510652 TTCAGACTGTAGTTGACTGCAGG - Intronic
1019648025 7:2141393-2141415 TTCAGGCTGCAGCTGGCTGCTGG - Intronic
1022257152 7:28670339-28670361 TTCTGACTGCAGTTGACTGCAGG + Intronic
1022686450 7:32601825-32601847 TTCAGACTGCAGTTGACTGCAGG + Intergenic
1024225656 7:47324926-47324948 CTCATGCTGCACTTGACTGGAGG - Intronic
1031020435 7:116621627-116621649 TTCAGACTGCACTTGACTGCAGG - Intergenic
1035310157 7:157962609-157962631 TGCAGGCTGCACCTGACCCCGGG - Intronic
1037877265 8:22554264-22554286 TGCAGGCTGCCCGTGCCTGCCGG - Intronic
1041500809 8:58536145-58536167 TTTAGACTGCAGTTGACTGCAGG + Intergenic
1042321635 8:67481781-67481803 TTCATGCAGCACATAACTGCGGG + Intronic
1042769756 8:72366740-72366762 TTCAGACTACAGTTGACTGCAGG - Intergenic
1043196068 8:77293178-77293200 TTCAGACTGCAAGTGACTGTGGG - Intergenic
1044839530 8:96326102-96326124 CTCAGGCTGCACTTGTCTGCTGG + Intronic
1046868746 8:119180535-119180557 TTCAGACTGCAGTTGACTGTGGG - Intronic
1048514394 8:135092856-135092878 TTCAGGCTGCAGGTGTGTTCAGG + Intergenic
1049301886 8:141875091-141875113 TTCAGGCTGGAAGTGGCTGCAGG + Intergenic
1051038618 9:12779115-12779137 TTCAGACTGCAGTTGACTGTAGG + Intronic
1056859582 9:90167780-90167802 TTCAGGCTGCAGGTTCCTACTGG + Intergenic
1059498909 9:114733869-114733891 TTCAGACTGCAGTAGACTGCAGG - Intergenic
1061964333 9:134004589-134004611 TCCAGGCTGCACGTGACCTGCGG - Intergenic
1187631091 X:21173260-21173282 TTCAGACTGCAGTTGACTGTGGG - Intergenic
1189165905 X:38860928-38860950 TCCAGGCTGCATTTGCCTGCAGG - Intergenic
1189472428 X:41324384-41324406 TCCAGGCTGCAAGTGACTCATGG + Intergenic
1192282970 X:69703674-69703696 TTCAGGCGGTACGTGTCTTCTGG + Intronic
1201464413 Y:14264715-14264737 TTCAGGGTGGAAGTCACTGCTGG - Intergenic