ID: 969469192

View in Genome Browser
Species Human (GRCh38)
Location 4:7376953-7376975
Sequence GTCACGTGCAGCCTGAAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469178_969469192 28 Left 969469178 4:7376902-7376924 CCCACCCAGCCCACGGATGTTCC 0: 1
1: 0
2: 2
3: 12
4: 119
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469184_969469192 7 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469182_969469192 19 Left 969469182 4:7376911-7376933 CCCACGGATGTTCCAGCCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 103
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469181_969469192 23 Left 969469181 4:7376907-7376929 CCAGCCCACGGATGTTCCAGCCC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469186_969469192 3 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT 0: 1
1: 1
2: 3
3: 23
4: 241
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469180_969469192 24 Left 969469180 4:7376906-7376928 CCCAGCCCACGGATGTTCCAGCC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469179_969469192 27 Left 969469179 4:7376903-7376925 CCACCCAGCCCACGGATGTTCCA 0: 1
1: 0
2: 1
3: 18
4: 146
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469183_969469192 18 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469176_969469192 30 Left 969469176 4:7376900-7376922 CCCCCACCCAGCCCACGGATGTT 0: 1
1: 0
2: 1
3: 19
4: 199
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469177_969469192 29 Left 969469177 4:7376901-7376923 CCCCACCCAGCCCACGGATGTTC 0: 1
1: 0
2: 5
3: 34
4: 389
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469188_969469192 1 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data
969469187_969469192 2 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469192 4:7376953-7376975 GTCACGTGCAGCCTGAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469192 Original CRISPR GTCACGTGCAGCCTGAAGAC CGG Intronic
No off target data available for this crispr