ID: 969469193

View in Genome Browser
Species Human (GRCh38)
Location 4:7376964-7376986
Sequence CCAGTGCAGAGCCGGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469193_969469199 -3 Left 969469193 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469193_969469201 29 Left 969469193 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 969469201 4:7377016-7377038 GCAAAGAGTTTATAGTCTCATGG 0: 1
1: 0
2: 1
3: 27
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469193 Original CRISPR CCAGTGCAGAGCCGGTCTTC AGG (reversed) Intronic