ID: 969469194

View in Genome Browser
Species Human (GRCh38)
Location 4:7376964-7376986
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469182_969469194 30 Left 969469182 4:7376911-7376933 CCCACGGATGTTCCAGCCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 103
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469183_969469194 29 Left 969469183 4:7376912-7376934 CCACGGATGTTCCAGCCCCAGTG 0: 1
1: 0
2: 0
3: 23
4: 147
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469191_969469194 -6 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469188_969469194 12 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469184_969469194 18 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469189_969469194 0 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469186_969469194 14 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT No data
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469187_969469194 13 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data
969469190_969469194 -1 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type