ID: 969469198

View in Genome Browser
Species Human (GRCh38)
Location 4:7376972-7376994
Sequence CCGGCTCTGCACTGGGATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469186_969469198 22 Left 969469186 4:7376927-7376949 CCCCAGTGCACAAACCCTGGCCT No data
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469189_969469198 8 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469191_969469198 2 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469190_969469198 7 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469184_969469198 26 Left 969469184 4:7376923-7376945 CCAGCCCCAGTGCACAAACCCTG 0: 2
1: 0
2: 3
3: 24
4: 262
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469188_969469198 20 Left 969469188 4:7376929-7376951 CCAGTGCACAAACCCTGGCCTGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
969469187_969469198 21 Left 969469187 4:7376928-7376950 CCCAGTGCACAAACCCTGGCCTG 0: 1
1: 1
2: 0
3: 14
4: 208
Right 969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469198 Original CRISPR CCGGCTCTGCACTGGGATTC GGG Intronic