ID: 969469199

View in Genome Browser
Species Human (GRCh38)
Location 4:7376984-7377006
Sequence TGGGATTCGGGCTGTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469191_969469199 14 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469190_969469199 19 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469193_969469199 -3 Left 969469193 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469189_969469199 20 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469199 Original CRISPR TGGGATTCGGGCTGTGAAAG TGG Intronic
900179147 1:1303740-1303762 TGGGGCTGGGGCTGAGAAAGGGG - Intronic
900299842 1:1971632-1971654 GGGGATTCAGGCTGGGAAAATGG - Intronic
900710751 1:4112030-4112052 GGTGATTCTGGGTGTGAAAGAGG + Intergenic
905300626 1:36984333-36984355 TGGGATGAGGGATGTGAATGTGG - Intronic
905570884 1:39004465-39004487 GGGGATTCTGGCTGTGAATTTGG + Exonic
905929549 1:41777470-41777492 TGGGTTTGGGGGTTTGAAAGAGG - Intronic
912921771 1:113875230-113875252 TAGGAATCCGGGTGTGAAAGTGG - Intergenic
915896839 1:159818394-159818416 TGGCATTTGGACTGAGAAAGGGG - Intergenic
915993441 1:160540557-160540579 TGGGACTCGGACTCTGAATGTGG + Intergenic
917928395 1:179807366-179807388 TGGGAAAGGGGCTGGGAAAGAGG + Intronic
921344347 1:214166622-214166644 TGAGATTATGGCTGTGAGAGAGG + Intergenic
921432491 1:215081724-215081746 GGGGATTCCCGCTGAGAAAGTGG + Intronic
921558346 1:216626534-216626556 TGGGATTTGGGGAGTGAAAGGGG - Intronic
922337095 1:224626762-224626784 TGGGGTTGGGGCTGTGAGATGGG - Intronic
923412636 1:233725359-233725381 TGGGATTCAAACTGTGAAATGGG - Intergenic
924205880 1:241710906-241710928 TGGGATTTGGGTTGGGAATGAGG + Intronic
1062886488 10:1020592-1020614 TGTGAATGGGGCTGTGAATGGGG - Intronic
1064987836 10:21228953-21228975 TGGGATGCAGGCTATGACAGAGG - Intergenic
1067189848 10:44059958-44059980 TGGTATTGTGGCTGTGAAATGGG + Intergenic
1068133119 10:52920177-52920199 TGGAGATAGGGCTGTGAAAGAGG + Intergenic
1076227597 10:128792807-128792829 TGGGATTCAGGATGGGGAAGGGG + Intergenic
1078994081 11:16679120-16679142 TGGCATTCGAGCTCTGAGAGTGG + Intronic
1079894377 11:26100431-26100453 TGGGAGTGGGGCTGAGCAAGCGG + Intergenic
1080115787 11:28620340-28620362 TGGGATTTAGTCAGTGAAAGAGG - Intergenic
1081831935 11:46121593-46121615 AGGGACTGGGGCTGGGAAAGCGG + Intergenic
1083647483 11:64180876-64180898 CTGGATGCGGGCTGTGAAAGAGG + Intergenic
1083779241 11:64909603-64909625 TGGGCTTGGGGCTATGGAAGGGG - Intronic
1088591689 11:111408884-111408906 TGGGATTCGTGCTGTGATCAAGG + Intronic
1088896603 11:114083348-114083370 TGGGTTTCGGGCAGGGAAGGAGG - Intronic
1089073008 11:115715938-115715960 TGGGATGGGGGCTGGCAAAGGGG - Intergenic
1089114812 11:116086149-116086171 TGGGATAGGGCCTGTGGAAGTGG + Intergenic
1089244375 11:117107766-117107788 TAGAATTAGGGCTGTGAAAATGG + Intergenic
1093481456 12:19608100-19608122 TGGTATTAGGGCCCTGAAAGAGG - Intronic
1100081378 12:90855471-90855493 TGGGATTAGTGCTGTGTACGAGG + Intergenic
1101735559 12:107460332-107460354 TGAGATTCTGGCTGGGAAAATGG + Intronic
1102603997 12:114054784-114054806 TGTGATTGGGGCTGTGTAAATGG - Intergenic
1102983178 12:117258528-117258550 TGGGGTCCTGGCTGTCAAAGAGG + Intronic
1103439350 12:120951195-120951217 TGGGATTCTGCCTGATAAAGGGG + Intergenic
1104476204 12:129072657-129072679 GGGGGTTCTGGGTGTGAAAGTGG - Exonic
1104586149 12:130049561-130049583 TGGGATTCTGGAGGTGAGAGAGG - Intergenic
1107175240 13:37392084-37392106 TGGGATGGGGGTTGGGAAAGTGG + Intergenic
1111252327 13:85618760-85618782 AGTCATTCGGTCTGTGAAAGGGG + Intergenic
1111997569 13:95180018-95180040 TGGGATTCATGCTATGAATGGGG - Intronic
1114112534 14:19487274-19487296 TGGGAATCTGGCTGTGAGTGAGG + Intergenic
1116554423 14:46285219-46285241 TGGGAATCTGGCTGTAAAATAGG - Intergenic
1117057371 14:51926699-51926721 TGGGATTCAGTCTGTGAGAATGG + Intronic
1117865197 14:60140955-60140977 TGGGATTTTGGCTATGTAAGTGG + Exonic
1120652394 14:87150458-87150480 TGGGCTTTGGGCACTGAAAGTGG - Intergenic
1121324855 14:93013930-93013952 TGGGATGGGGGCTGGGGAAGAGG - Intronic
1126568006 15:50119974-50119996 GGGGATTCTGGTTGTTAAAGCGG + Intronic
1127782265 15:62327549-62327571 TGGGAGTGGGGCTTTGGAAGAGG - Intergenic
1128077406 15:64836260-64836282 TAAGCTTCGGGCTGCGAAAGCGG - Intergenic
1130097068 15:80863801-80863823 TGGGCTAGTGGCTGTGAAAGAGG - Intronic
1131558006 15:93415835-93415857 TGGCATCCAGGCTGTGGAAGGGG + Intergenic
1132458412 16:36937-36959 TGGGACTCAGCCTGTGAACGGGG - Intergenic
1136283442 16:29227943-29227965 TGGGATTCGTGCTTTATAAGAGG - Intergenic
1137043740 16:35637964-35637986 TGGTTCTCAGGCTGTGAAAGGGG + Intergenic
1137268640 16:46887858-46887880 TCGGCTAAGGGCTGTGAAAGGGG + Intronic
1140635039 16:76902323-76902345 TGGGAGTCAGGCTGTGCCAGCGG - Intergenic
1141721481 16:85758321-85758343 TGGGACTGGGGCTGGGAAGGAGG + Intergenic
1144521186 17:15953190-15953212 TGGGATTTGGGCTGTGGTGGGGG + Intronic
1147431237 17:40371994-40372016 TGGGATTGGGGCTGGGGCAGGGG + Intergenic
1151595269 17:75074528-75074550 TGGGCTCCGGGCTGTGACAGTGG + Intergenic
1152649150 17:81483951-81483973 TGGAATTCGGGCTGCGGAAGGGG - Intergenic
1153187731 18:2503375-2503397 TGTGATTCAGGCTCTGAATGGGG + Intergenic
1153539368 18:6137188-6137210 TGGGACTCAGACTGTGAATGTGG - Intronic
1156774314 18:40768847-40768869 TGTGATTTCAGCTGTGAAAGAGG - Intergenic
1166355928 19:42227264-42227286 TAGGAATCTGGCAGTGAAAGAGG + Exonic
1168135149 19:54346057-54346079 TGGGTTTGGGGATGTGAAAAAGG - Intergenic
926162038 2:10495961-10495983 GGGGGTTCGGGTTGTGAACGTGG - Intergenic
926359305 2:12070583-12070605 TGGGAATAGGGCAGTGAGAGAGG - Intergenic
932046751 2:68357708-68357730 TGGGATTCAGTCTGTGAGATGGG - Intergenic
933295538 2:80486874-80486896 TGGGATCCGGGATCTGAAAAAGG - Intronic
934061264 2:88296292-88296314 TGGGGTTGGGGCTGAGAAACTGG + Intergenic
936521592 2:113215255-113215277 TGGGTTTCTTGCTGGGAAAGGGG - Intergenic
939994344 2:148906279-148906301 AGGGAACCAGGCTGTGAAAGTGG + Intronic
941221125 2:162782911-162782933 TGAGATTGGGGAGGTGAAAGTGG + Intronic
942073630 2:172337227-172337249 TGGAATTCAGGCTGAGAAATAGG + Intergenic
942229734 2:173849179-173849201 TGGGACTGAGGCTGTGAAAAGGG - Intergenic
942278930 2:174342208-174342230 TCGGGTTGGGGCTGCGAAAGCGG - Intergenic
942605248 2:177683597-177683619 TGGGATTCAGTCTGTGAGATGGG + Intronic
942817230 2:180066082-180066104 TGGGATTTGGGAAGTGGAAGTGG - Intergenic
944620570 2:201510559-201510581 AGGGATTGGGGCTGGGACAGGGG + Intronic
945741043 2:213661551-213661573 TGGGCTTCAGCATGTGAAAGTGG + Intronic
946908589 2:224439191-224439213 TGACATAGGGGCTGTGAAAGTGG - Intergenic
947679945 2:232021486-232021508 CGGGATCCAGGCTGTGAACGTGG + Intronic
947900841 2:233720185-233720207 TGGAAGTGGGGCTGTGAAGGTGG + Intronic
1168772942 20:427756-427778 TGGGATTCAGTCTGTGACTGGGG - Intronic
1169627634 20:7590267-7590289 AGGTATGCGGGCTCTGAAAGAGG + Intergenic
1170960885 20:21024756-21024778 TTGGATACAGGCTTTGAAAGTGG + Intergenic
1172217500 20:33246567-33246589 TGGGATTATGTCAGTGAAAGTGG + Intergenic
1172280393 20:33703722-33703744 AGGGATGCGGGCTGTGGGAGTGG + Exonic
1174556605 20:51400072-51400094 TGGGATGTGGGCTGTGAACAAGG - Intronic
1175824833 20:61931167-61931189 TGGGATGCCAGCTGTGAGAGTGG + Intronic
1178642227 21:34354054-34354076 TGCCATTCGGCCTGTGACAGGGG + Intergenic
1181591768 22:23889734-23889756 AGGGATTCGGGCTAGGAGAGGGG - Intronic
1181684983 22:24522188-24522210 TGGGAATCGGGCTGTGGCTGGGG + Intronic
1182205897 22:28626250-28626272 TGTGATATGGGCTGTAAAAGAGG - Intronic
1184245259 22:43232559-43232581 GGGGAGTCAGGCTGGGAAAGGGG - Intronic
1184412735 22:44334130-44334152 AGGGATGCGGGCTGAGCAAGGGG + Intergenic
1184421337 22:44384488-44384510 TGGGAGTGGGGGTGGGAAAGGGG + Intergenic
1184456280 22:44611555-44611577 AGGGATTAGGGATGTGGAAGAGG + Intergenic
949363022 3:3251999-3252021 TGGGATTCAGTCTGTGAGACAGG - Intergenic
950702784 3:14761674-14761696 GGAGACTTGGGCTGTGAAAGGGG + Intronic
956591912 3:70924212-70924234 TGGGGTACGGGATGTAAAAGTGG + Intergenic
961425743 3:126846132-126846154 TGGGAATGGGGCTTTGAAGGAGG - Intronic
962334393 3:134513534-134513556 TGGGATCTGGGCTGGGCAAGCGG + Intronic
965736178 3:171823475-171823497 GGGGAATCCGGCTGTGAAAGAGG - Intergenic
969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG + Intronic
969528405 4:7715866-7715888 TGGGATTTGTGCTGTGACAGAGG - Intronic
970812281 4:20108443-20108465 TGGGATGCAGGATGTGTAAGTGG - Intergenic
972187509 4:36549236-36549258 TGGGCTCAGGGCTCTGAAAGAGG - Intergenic
978170983 4:105669795-105669817 TGGGGTTAGGGGTGGGAAAGAGG - Intronic
981704048 4:147640683-147640705 TTGGATGTGGGCTATGAAAGAGG - Intronic
985563891 5:605612-605634 TGAGAGGCGGGCTGTGAGAGAGG + Intergenic
986292225 5:6409414-6409436 TGGGATCCTGGATGAGAAAGAGG + Intergenic
990125045 5:52505413-52505435 TAGGATTTGGTCTGTGAAAGTGG - Intergenic
990735237 5:58853386-58853408 TGGGATGAGGGCTGTGAAGGAGG - Exonic
991653688 5:68882141-68882163 TGGGATTTAGGTTGGGAAAGGGG - Intergenic
995009649 5:107242770-107242792 TGGGTTTTGGCCAGTGAAAGTGG - Intergenic
995131063 5:108631074-108631096 TGGGAAAGGGGCTGTGAAAGGGG - Intergenic
1002061223 5:176627197-176627219 TGGGCTACGTGCTGTGAGAGTGG - Intronic
1006622259 6:35374031-35374053 TGGGATTCAGCCAGTGAAAGTGG + Intronic
1007432549 6:41785154-41785176 TGGGATTCTGGTTGGGAAACAGG + Intronic
1008489607 6:52072494-52072516 TGGGATACAGCCTTTGAAAGGGG - Intronic
1013718337 6:112990916-112990938 TAGGATTTGGGCTATGGAAGTGG + Intergenic
1015196138 6:130526538-130526560 TGGGATTGGGGCAGAGGAAGAGG + Intergenic
1015613236 6:135048384-135048406 TGGGATTCAGCCTTTTAAAGAGG - Intronic
1016841604 6:148531559-148531581 TCGGGGTCGGGCTGTGAAGGCGG - Exonic
1018459616 6:163985394-163985416 TGGGACTTGGGTAGTGAAAGAGG + Intergenic
1019551250 7:1603732-1603754 TGGGATTCAGGCCGGGAGAGGGG + Intergenic
1022176376 7:27875355-27875377 TGGGATTGGGGCTGTAAAAATGG - Intronic
1022196870 7:28076976-28076998 TGGGTTTCGGGCTTTAAAATTGG - Intronic
1023329719 7:39101567-39101589 TGGGATTAGGGTGGGGAAAGGGG + Intronic
1023640735 7:42254290-42254312 TGGGCTTCAGGCTGTGAACTAGG - Intergenic
1023908772 7:44539682-44539704 TGGGATTCAGCCTCTGAATGAGG - Exonic
1024438122 7:49382472-49382494 TGGGATTCAATCTGTGAAATGGG + Intergenic
1024844612 7:53627935-53627957 TGGGATTAGTGCTGTTATAGAGG + Intergenic
1026319914 7:69259294-69259316 TGTGATGCGGGATGTGGAAGAGG + Intergenic
1028213965 7:88109153-88109175 TGGGATTCAGGCTGAAAAAAAGG - Intronic
1028262142 7:88679641-88679663 TGGGATTATGGGTGTGAAAAGGG + Intergenic
1028934633 7:96451463-96451485 TTGGATTCGGGAGGTGAAGGTGG - Intergenic
1029906744 7:104100519-104100541 TGGGATGAGTGCTGTGATAGAGG - Intergenic
1032883067 7:136110751-136110773 GGAGATTTGGGCTGTGACAGTGG + Intergenic
1035081725 7:156221868-156221890 TGGGCTTCGGGCTCTGGACGGGG + Intergenic
1036222704 8:6934151-6934173 TGGGTTTCAGGATGTGAAAGGGG - Intergenic
1041150098 8:54923103-54923125 TGGGCCTGGGGCTGAGAAAGAGG + Intergenic
1045118279 8:99007541-99007563 TTGGATTAGGGATGTTAAAGTGG + Intergenic
1048065148 8:130960157-130960179 AGGAATTGGGACTGTGAAAGAGG + Intronic
1048315034 8:133355547-133355569 TGGGATTGGGGATCTGAAGGAGG + Intergenic
1048896140 8:138993991-138994013 TGGCATTAGGGCTGTGACTGAGG + Intergenic
1052421964 9:28253941-28253963 TGGGATTCAGTCTGTGAAGTGGG + Intronic
1054732771 9:68717635-68717657 TGGGATTCGGGCTCTTATAAAGG - Intronic
1057196512 9:93118449-93118471 TGGGCTTCGGGCTGGCACAGCGG + Intergenic
1057500721 9:95594987-95595009 GGGGAGTGGGGCTGTGAGAGAGG + Intergenic
1059072129 9:111149008-111149030 TGGGATCCGGGATGTGAACTAGG - Intergenic
1060221160 9:121764835-121764857 TGGGATCAGGGCTGCGACAGAGG - Intronic
1061968305 9:134028919-134028941 AGGGACTCGGGCTGTGCAGGAGG - Intergenic
1185456470 X:313252-313274 TGGGACTTCGGATGTGAAAGGGG - Intronic
1187157698 X:16736454-16736476 TGGGGAGCTGGCTGTGAAAGGGG + Intronic
1187750129 X:22453919-22453941 TGGGATATGGGCTGTGTCAGTGG + Intergenic
1190689428 X:52901138-52901160 TGGGATTGGGGCTGGGACAGGGG + Intronic
1190696555 X:52954654-52954676 TGGGATTGGGGCTGGGACAGGGG - Intronic
1197621060 X:128749495-128749517 TGGGAATGGGGCTTTGAAGGAGG - Intergenic
1200213236 X:154356167-154356189 TGGGAGCCGGGCAGGGAAAGTGG - Intronic
1201017701 Y:9623098-9623120 TGGGATTTTGTCTGTAAAAGGGG - Intergenic