ID: 969469199

View in Genome Browser
Species Human (GRCh38)
Location 4:7376984-7377006
Sequence TGGGATTCGGGCTGTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969469193_969469199 -3 Left 969469193 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469189_969469199 20 Left 969469189 4:7376941-7376963 CCCTGGCCTGCAGTCACGTGCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469191_969469199 14 Left 969469191 4:7376947-7376969 CCTGCAGTCACGTGCAGCCTGAA 0: 1
1: 0
2: 1
3: 22
4: 116
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
969469190_969469199 19 Left 969469190 4:7376942-7376964 CCTGGCCTGCAGTCACGTGCAGC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 969469199 4:7376984-7377006 TGGGATTCGGGCTGTGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969469199 Original CRISPR TGGGATTCGGGCTGTGAAAG TGG Intronic