ID: 969471419

View in Genome Browser
Species Human (GRCh38)
Location 4:7391551-7391573
Sequence TGAAGTCCACACTCAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969471419_969471425 1 Left 969471419 4:7391551-7391573 CCAGGAACTGAGTGTGGACTTCA 0: 1
1: 0
2: 3
3: 18
4: 180
Right 969471425 4:7391575-7391597 GGTTCTTTTCCTTCTGGGGAAGG 0: 1
1: 0
2: 4
3: 36
4: 274
969471419_969471424 -3 Left 969471419 4:7391551-7391573 CCAGGAACTGAGTGTGGACTTCA 0: 1
1: 0
2: 3
3: 18
4: 180
Right 969471424 4:7391571-7391593 TCAGGGTTCTTTTCCTTCTGGGG 0: 1
1: 0
2: 1
3: 43
4: 356
969471419_969471428 22 Left 969471419 4:7391551-7391573 CCAGGAACTGAGTGTGGACTTCA 0: 1
1: 0
2: 3
3: 18
4: 180
Right 969471428 4:7391596-7391618 GGGTACCCTCAGTCCCTCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 169
969471419_969471422 -5 Left 969471419 4:7391551-7391573 CCAGGAACTGAGTGTGGACTTCA 0: 1
1: 0
2: 3
3: 18
4: 180
Right 969471422 4:7391569-7391591 CTTCAGGGTTCTTTTCCTTCTGG 0: 1
1: 0
2: 5
3: 33
4: 341
969471419_969471423 -4 Left 969471419 4:7391551-7391573 CCAGGAACTGAGTGTGGACTTCA 0: 1
1: 0
2: 3
3: 18
4: 180
Right 969471423 4:7391570-7391592 TTCAGGGTTCTTTTCCTTCTGGG 0: 1
1: 0
2: 5
3: 46
4: 400
969471419_969471426 2 Left 969471419 4:7391551-7391573 CCAGGAACTGAGTGTGGACTTCA 0: 1
1: 0
2: 3
3: 18
4: 180
Right 969471426 4:7391576-7391598 GTTCTTTTCCTTCTGGGGAAGGG 0: 1
1: 0
2: 5
3: 32
4: 373
969471419_969471429 23 Left 969471419 4:7391551-7391573 CCAGGAACTGAGTGTGGACTTCA 0: 1
1: 0
2: 3
3: 18
4: 180
Right 969471429 4:7391597-7391619 GGTACCCTCAGTCCCTCTGAGGG 0: 1
1: 0
2: 0
3: 26
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969471419 Original CRISPR TGAAGTCCACACTCAGTTCC TGG (reversed) Intronic
900385901 1:2410563-2410585 TGAAGCCAACACTCACTCCCTGG + Intronic
901356726 1:8656378-8656400 TGAATTTCTCACTCAATTCCAGG + Exonic
902116760 1:14127760-14127782 TGAAGCCCACACTGTGTGCCAGG + Intergenic
903352503 1:22726323-22726345 TTAAGTCCCCACTAAGTGCCAGG + Intronic
904260865 1:29286936-29286958 TGAAGGCCAGGCTCAGATCCAGG - Intronic
904818410 1:33222565-33222587 TGAAATCCACACTCTTTGCCAGG + Intergenic
904870528 1:33615048-33615070 TCAAGTCCCCACTCTGTGCCCGG + Intronic
905868384 1:41388757-41388779 TGAGGTCCACACTCAGCTTGCGG + Intergenic
906095554 1:43221599-43221621 TGAAAACCACAGTGAGTTCCAGG - Intronic
906959995 1:50414431-50414453 TGAAGTCCAGGCCCAGTTTCTGG + Intergenic
907306919 1:53518388-53518410 TGATGTCCACGCACAGTCCCTGG + Intronic
908182924 1:61623998-61624020 TGATGACCAGACTCAGTACCTGG + Intergenic
908413153 1:63886575-63886597 CAATCTCCACACTCAGTTCCTGG + Intronic
908777153 1:67651227-67651249 TGAAGTCCCCACTCAGAAGCAGG + Intergenic
908932545 1:69334391-69334413 TGAATACCACACGCATTTCCTGG - Intergenic
909857366 1:80553494-80553516 TGAAGTCAAGACACATTTCCAGG - Intergenic
911675605 1:100655199-100655221 TGAAATCCAGACTCACTTCCTGG - Intergenic
915375189 1:155388178-155388200 TGAAATGCAAAATCAGTTCCTGG - Intronic
919249924 1:195041176-195041198 TGCAGTTCACACCAAGTTCCTGG + Intergenic
920911363 1:210220450-210220472 GGAAGTGTCCACTCAGTTCCTGG - Intergenic
921079736 1:211729470-211729492 CGGAGGCCACCCTCAGTTCCTGG + Intergenic
922773200 1:228200754-228200776 TTAAGACCACATTCAGGTCCGGG + Intergenic
924684869 1:246278540-246278562 TGAAGTCTACCCACAGTTCCTGG - Intronic
924934573 1:248757148-248757170 TCAAGTCCACACTCAAAACCAGG - Intergenic
1063157598 10:3394843-3394865 ACAAGTCCACACTCAGGTACTGG + Intergenic
1063365022 10:5485448-5485470 TGAAGTCCAAGCTCACGTCCTGG + Intergenic
1063433134 10:6008480-6008502 TGAAGACCTCATTGAGTTCCTGG + Intergenic
1065619678 10:27568304-27568326 TGGAATCCACATTCACTTCCAGG - Intergenic
1068385154 10:56317205-56317227 GGAAGTTCTCACTCAGGTCCTGG - Intergenic
1068870758 10:61941601-61941623 TGAAAGCCACAGTCAGTTACTGG - Intronic
1069228302 10:65972460-65972482 TGAAGTCGTGTCTCAGTTCCAGG - Intronic
1069309423 10:67015656-67015678 TGAAGTTCATACTCTGTTCTAGG - Intronic
1071995474 10:91143932-91143954 TGTTGACCACATTCAGTTCCTGG - Intergenic
1073874471 10:107906329-107906351 TGAAGTCCACACTGAATAGCTGG + Intergenic
1074705164 10:116123763-116123785 TGAATTCAACACTAAGTTCTGGG + Intronic
1075573866 10:123564284-123564306 TGAATTCCACACCAATTTCCTGG + Intergenic
1075693379 10:124416511-124416533 TGACGCCCATACTCAGGTCCTGG + Intronic
1077857389 11:6142370-6142392 TGAAGACTACCCTCAGTTCATGG - Intergenic
1078087200 11:8241206-8241228 TGAAGACGACACTTAGTTTCTGG - Intronic
1078094293 11:8287114-8287136 TGCTCTCCACACTCTGTTCCTGG + Intergenic
1081393743 11:42560585-42560607 TGAAGTCCAGACTTTCTTCCTGG + Intergenic
1081623907 11:44635331-44635353 TGAGGTCAACACCCATTTCCTGG + Intergenic
1086238447 11:84660255-84660277 TGACCTTTACACTCAGTTCCTGG - Intronic
1089143759 11:116309408-116309430 TGCAATCCACACTCAGGTACAGG + Intergenic
1090470615 11:126977948-126977970 TGGTGTCCTCACTCAGTTTCTGG + Intronic
1091334120 11:134753912-134753934 GGAGGTCCACACTCAGCTCCTGG - Intergenic
1092343305 12:7694613-7694635 TCAAGGCCATACACAGTTCCTGG + Intronic
1095135365 12:38594699-38594721 TGGAGTCCACCCTCAGCTCAAGG + Intergenic
1102009159 12:109607423-109607445 AGAAGCCCACACTCAGGTGCAGG + Intergenic
1103210012 12:119158700-119158722 TGAAGTCCAGTCTGGGTTCCTGG - Exonic
1106810231 13:33351452-33351474 TGAAGTCCAAGCCCACTTCCTGG + Intergenic
1110468636 13:75831971-75831993 TGAAGTGCCCAATTAGTTCCTGG + Intronic
1110492121 13:76121760-76121782 TGAAGTCCTTTATCAGTTCCAGG - Intergenic
1116007947 14:39316803-39316825 AGAGGTCCACACACAGTCCCAGG + Intronic
1117921282 14:60727468-60727490 TGAAATCCACACCAAGATCCAGG + Intergenic
1118640832 14:67790732-67790754 TGAAGTCCTCACCCAGTTCAGGG - Exonic
1120557249 14:85944242-85944264 TTAAGTCCATACTGGGTTCCAGG + Intergenic
1120584725 14:86298058-86298080 TGAAGTCAACACTGAGTGGCAGG + Intergenic
1120650478 14:87126359-87126381 TGAAGTCTATACTCTCTTCCTGG - Intergenic
1121328469 14:93035200-93035222 TGAAGTCCACAGCGAGTGCCTGG - Intronic
1121704295 14:95979877-95979899 TGACGTCTGCACACAGTTCCAGG - Intergenic
1121973581 14:98382091-98382113 GGAAGTCCACAGTCAGTTGTGGG + Intergenic
1123633498 15:22278859-22278881 TGAATTTCTCACTCAATTCCAGG - Intergenic
1125614245 15:40995638-40995660 TGGACTCCACTCTCAGTTCCCGG - Intronic
1125726407 15:41870445-41870467 GGAAGTCCTCACCCAGGTCCAGG - Exonic
1126050487 15:44680525-44680547 TCAAGTCCAGACTCTCTTCCTGG + Intronic
1131383265 15:91981763-91981785 TGATGTCCACACTCTGTGGCAGG - Intronic
1131886808 15:96924548-96924570 TGTAGGCCACCCTTAGTTCCAGG - Intergenic
1132951080 16:2562832-2562854 GGAAGTCCAGAGTCAGTGCCAGG - Intronic
1132963269 16:2637338-2637360 GGAAGTCCAGAGTCAGTGCCAGG + Intergenic
1134144878 16:11752875-11752897 TGAGATCCAGACTCAATTCCAGG + Intronic
1134183888 16:12068134-12068156 TGAAGTCCATATTCAGAACCAGG - Intronic
1135816316 16:25637315-25637337 AGGAGGCCTCACTCAGTTCCTGG - Intergenic
1136506786 16:30709563-30709585 TGAAGTCCAAATGCAGGTCCAGG - Exonic
1137939252 16:52666879-52666901 TGAAGTACAGAGTGAGTTCCAGG + Intergenic
1141572235 16:84941131-84941153 TGAAGTCCACACACACAGCCTGG + Intergenic
1144436395 17:15246665-15246687 TCCAGGCCACACTCAGTTCCTGG + Intronic
1146518647 17:33509223-33509245 TAAAGTCCAAAGTCAGTTCTAGG - Intronic
1147884424 17:43675226-43675248 TGGAGTCCACACTCAGGTTGGGG + Intergenic
1148772425 17:50075186-50075208 TGAAGTCCTCAGTCAGTTGGTGG - Intronic
1156704572 18:39864106-39864128 AGAACTCCAAACTCAGTGCCAGG + Intergenic
1157491412 18:48126457-48126479 TGGAGTCCACAATCAGTTCCAGG - Intronic
1157615753 18:48986887-48986909 TGTGGTCCCCACTCAGTCCCTGG - Intergenic
1158899644 18:61950687-61950709 TGAAATTCACACCCAGTGCCAGG - Intergenic
1159104009 18:63985152-63985174 TGAGGTACACACCCAGGTCCTGG + Exonic
1160154290 18:76421599-76421621 AGAATTCCACACTAAGTTCCTGG + Intronic
1164501056 19:28820621-28820643 TGAAGCCCAAACTCATTTCCAGG - Intergenic
1165222481 19:34328170-34328192 TCAAGTTCACACTCATTTGCTGG - Intronic
1165390678 19:35536964-35536986 TGATGCCCACAGTCAGCTCCCGG - Exonic
1167595260 19:50424030-50424052 TGAAGTGCTCACTCTGTGCCTGG - Intronic
1167981171 19:53276899-53276921 AGAAGCCAACTCTCAGTTCCAGG - Intergenic
1168666982 19:58211574-58211596 TGAAGTCCACAGCCACATCCTGG - Exonic
925367652 2:3322023-3322045 TGAATTCCACCCTCACTTCACGG + Intronic
927645772 2:24875960-24875982 AGAAGTCCACACTCCTTTCTGGG - Intronic
930304605 2:49662917-49662939 TGGAGACCACACTCAGACCCTGG - Intergenic
934553903 2:95277539-95277561 TGAAGTCAGCACCCAGCTCCAGG - Exonic
935207041 2:100905146-100905168 TCAAGTCCTAACTCAGTTGCTGG + Intronic
936730019 2:115370923-115370945 TGAAGAAGACACTCAATTCCAGG - Intronic
940041592 2:149367339-149367361 TGGAGGCCACCTTCAGTTCCTGG + Intronic
941903937 2:170703363-170703385 TCAAGTTCAAACTCAGTTCTTGG + Intergenic
943321914 2:186455064-186455086 TCAAGTCTATATTCAGTTCCAGG + Intergenic
944888436 2:204089731-204089753 TGTATTCCACACTCAGTTACTGG + Intergenic
944916540 2:204366426-204366448 TGTAATTCACACTCAGTACCAGG - Intergenic
947571593 2:231240005-231240027 TGAAGTCCACACTATGCGCCAGG - Exonic
948210738 2:236191389-236191411 TGATGTCCATCCTCACTTCCTGG + Intergenic
1169403506 20:5303776-5303798 TGAAGTACACGTTCATTTCCAGG - Intronic
1170462468 20:16590060-16590082 TGAAGTCGACACTTTGTTGCTGG - Intergenic
1172449616 20:35012758-35012780 CGACTTCCATACTCAGTTCCTGG + Intronic
1173171030 20:40724086-40724108 TGGAGTCCAGACTCAAATCCAGG + Intergenic
1173890447 20:46504704-46504726 TGAAGTTCACAGTCAGGTCCTGG + Exonic
1175326305 20:58130843-58130865 TGAAACCCACACTCAGATCCAGG + Intergenic
1175736980 20:61393887-61393909 TTAAGTGCACACTCTTTTCCAGG - Intronic
1178799050 21:35774997-35775019 TGGAGTCCTCACTCAGTCCCTGG + Intronic
1180931950 22:19598276-19598298 TGCAATCCACTCTCTGTTCCTGG - Intergenic
1181903580 22:26175015-26175037 TGAAGTCCAGCCTCAGATCCAGG + Intronic
1183021976 22:35034556-35034578 TGTATTCCACACTCTGTTCTTGG + Intergenic
1185267596 22:49912413-49912435 GGAAGTCCACAGGCAATTCCGGG - Intronic
951867314 3:27322714-27322736 TGAAGTCCAAACTGATTCCCAGG - Intronic
954592950 3:51799624-51799646 TGAAGTTTAAACTCGGTTCCTGG + Intergenic
957461711 3:80530169-80530191 TGAAGTGCTGAGTCAGTTCCTGG - Intergenic
961247688 3:125470550-125470572 TGAAGTCCACCCTCACCTCTTGG + Intronic
962824167 3:139083783-139083805 GGTAGTCCACACTCAGCTTCTGG + Intronic
962970708 3:140399123-140399145 TGTTGTCCACACACAATTCCTGG + Intronic
966204000 3:177387420-177387442 TGGAGTGCATACTCTGTTCCTGG + Intergenic
969471419 4:7391551-7391573 TGAAGTCCACACTCAGTTCCTGG - Intronic
969852768 4:9974385-9974407 TGAAATCCCCTGTCAGTTCCAGG - Intronic
969872646 4:10114518-10114540 TGCAGTCCACATTGACTTCCAGG - Intronic
970242424 4:14023342-14023364 TGAAGGCCTCAGTCACTTCCTGG - Intergenic
970677014 4:18462795-18462817 TGAAGGCCTCCCTCAGGTCCTGG + Intergenic
971939078 4:33190467-33190489 TCAAGTCCTCACCCAGTACCAGG - Intergenic
973571782 4:52247684-52247706 TGATATCCAGATTCAGTTCCTGG - Intergenic
974155922 4:58072396-58072418 TGGAGGCTGCACTCAGTTCCTGG + Intergenic
976014202 4:80530905-80530927 TGACTTCCACACTCAGGTCTTGG - Intronic
980766416 4:137311537-137311559 TGAAGTCAACAATCAGTTTGGGG - Intergenic
985559938 5:579949-579971 AGGACTCCTCACTCAGTTCCGGG + Intergenic
985901818 5:2802109-2802131 TGCTGTCCAGACGCAGTTCCAGG - Intergenic
986357904 5:6946955-6946977 TGATGTCCCCACACAGTGCCTGG + Intergenic
987450686 5:18080180-18080202 TGAAGTCCACATTGAAATCCTGG + Intergenic
992158192 5:73975252-73975274 TGAGGTCCCTACTCAGTTGCTGG + Intergenic
997285417 5:132674724-132674746 TGTAGTCCTGACTCAGATCCTGG + Intronic
998352339 5:141509636-141509658 AGAAGTCCACACTCTGGCCCTGG - Intronic
998477385 5:142433197-142433219 TGCAGCCCACACTCAGCTGCAGG + Intergenic
1002795170 6:466085-466107 TGAAGACCACACTCAAGTCCAGG - Intergenic
1003799685 6:9649694-9649716 TGAAGTCCACACTTTGTTCCTGG + Intronic
1004053685 6:12113125-12113147 GGGAGTCCACACTCACTTACAGG - Intronic
1005898926 6:30200641-30200663 TGTAGTCCTGACCCAGTTCCAGG + Intronic
1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG + Intergenic
1007290311 6:40780739-40780761 TGTAGGCCACTCTCAGCTCCTGG - Intergenic
1008109781 6:47478844-47478866 TGAAGTCCAAACCCAGTCCTCGG - Intronic
1009524513 6:64727754-64727776 TGAAGTCCATACTATGTTCTAGG - Intronic
1012447067 6:99317582-99317604 TGAAGCCCAGACTCAAATCCAGG - Intronic
1018748346 6:166780192-166780214 TGAAGTCCAGCCCCAGTGCCTGG + Intronic
1018994680 6:168701898-168701920 AGCACTCCACACCCAGTTCCAGG - Intergenic
1019380273 7:718040-718062 TGGAGGCCACCCTCAGCTCCTGG - Intronic
1019611125 7:1937206-1937228 AGAATTCCACACTCAGTGCCCGG + Intronic
1019984621 7:4646641-4646663 TGGAGGCCACCCTCAGGTCCTGG - Intergenic
1021578451 7:22127007-22127029 TGAAGTCCTCACTGATTCCCAGG + Intronic
1022117881 7:27278053-27278075 TGAACTCTTCACTCACTTCCTGG + Intergenic
1022836691 7:34123604-34123626 TGAACTCCACTCTCATCTCCTGG + Intronic
1024454270 7:49585099-49585121 AGATGTGCACACACAGTTCCAGG + Intergenic
1028825828 7:95272677-95272699 TGAAGTACACACACAGTTCATGG - Intronic
1030164340 7:106538542-106538564 TGAAGTGCACCCACAGTTCTTGG - Intergenic
1031563798 7:123269618-123269640 TGAAATCCACACTGGGTTCTTGG + Intergenic
1032165820 7:129543901-129543923 AGGAGTCCACACCCAGCTCCCGG + Intergenic
1032348618 7:131139741-131139763 TGAGGTCCACACAGACTTCCTGG - Intronic
1033733607 7:144201210-144201232 TGAAGTCCAAACTCAGTAGCAGG - Intergenic
1033749443 7:144349762-144349784 TGAAGTCCAAACTCAGTAGCAGG + Intergenic
1034984364 7:155498173-155498195 GGAAATCCTCACTCAATTCCAGG - Intronic
1037690503 8:21177684-21177706 TGAACTAGAAACTCAGTTCCCGG - Intergenic
1037828700 8:22176127-22176149 TGACTTCCTCTCTCAGTTCCAGG + Exonic
1040115027 8:43607450-43607472 TGAAGTGCACATTCATTTCACGG + Intergenic
1040387861 8:46925758-46925780 TGCAGGACACCCTCAGTTCCTGG - Intergenic
1040712309 8:50204330-50204352 TGTAGTCAACACTCAGTATCTGG + Intronic
1043034259 8:75177370-75177392 TGCATTCTACTCTCAGTTCCAGG - Intergenic
1043693454 8:83187327-83187349 TGAAGTTCTCACTCAGGTCATGG - Intergenic
1046456196 8:114465625-114465647 TGAAGTTCACACTCAGCATCAGG - Intergenic
1047195344 8:122715883-122715905 TGGATTCCACCCTCAGGTCCTGG - Intergenic
1052570480 9:30215131-30215153 GGTAGTTCACATTCAGTTCCTGG - Intergenic
1052672830 9:31580247-31580269 TGAAGTGCCCACTAAGGTCCAGG - Intergenic
1054580535 9:66908252-66908274 TGAATTCCACAGTCACGTCCTGG - Exonic
1055598829 9:77894006-77894028 TGAAGTCCTCAAGCAGTGCCTGG - Intronic
1056246425 9:84699974-84699996 TAAAGTCCCCATTGAGTTCCAGG + Intronic
1056334013 9:85548254-85548276 TGAATTTCATACTCAGTTGCAGG - Intronic
1056575485 9:87853212-87853234 TGCAGTGCCCACACAGTTCCCGG - Intergenic
1057632215 9:96729119-96729141 TGAATTCCACAGTCACATCCTGG - Intergenic
1057642955 9:96844980-96845002 TGAATTCCACAGTCACGTCCTGG + Exonic
1057823350 9:98352271-98352293 TGATGTCCACACACAATACCTGG - Intronic
1058798547 9:108521941-108521963 TGCAGAGCACACTCAGTTCAAGG - Intergenic
1061054464 9:128215077-128215099 TGAGCTCCTCACTCACTTCCGGG - Intronic
1061747142 9:132748815-132748837 TGAAGTACACACTAATTTCTTGG + Intronic
1186542920 X:10419275-10419297 TGAAGACCACCCTCAGTTCCTGG - Intergenic
1188627264 X:32300337-32300359 AGAAGTCCACATGCATTTCCTGG + Intronic
1190561047 X:51685462-51685484 TAAAGTCCACACTTTATTCCAGG + Intergenic
1190563244 X:51707859-51707881 TAAAGTCCACACTTTATTCCAGG - Intergenic
1191953422 X:66618639-66618661 TGAGGTACACACTCTGTGCCAGG - Intronic
1192146356 X:68685599-68685621 TGAAGTCTATACTCCGTGCCAGG + Intronic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1197174875 X:123474838-123474860 TGGATTCCAGGCTCAGTTCCTGG - Intronic
1197285369 X:124588766-124588788 TGAAGTCCTGTATCAGTTCCAGG + Intronic
1198328007 X:135593445-135593467 TAAAGATCACACTCAGGTCCTGG + Intergenic
1198339145 X:135697466-135697488 TAAAGATCACACTCAGGTCCTGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic