ID: 969471714

View in Genome Browser
Species Human (GRCh38)
Location 4:7392973-7392995
Sequence GGGCCAGGGAGCCAGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 997
Summary {0: 1, 1: 0, 2: 5, 3: 96, 4: 895}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969471714_969471719 -9 Left 969471714 4:7392973-7392995 CCAGCACCCTGGCTCCCTGGCCC 0: 1
1: 0
2: 5
3: 96
4: 895
Right 969471719 4:7392987-7393009 CCCTGGCCCATTTGGTGACATGG 0: 1
1: 0
2: 0
3: 11
4: 169
969471714_969471722 -3 Left 969471714 4:7392973-7392995 CCAGCACCCTGGCTCCCTGGCCC 0: 1
1: 0
2: 5
3: 96
4: 895
Right 969471722 4:7392993-7393015 CCCATTTGGTGACATGGCTTTGG No data
969471714_969471724 -2 Left 969471714 4:7392973-7392995 CCAGCACCCTGGCTCCCTGGCCC 0: 1
1: 0
2: 5
3: 96
4: 895
Right 969471724 4:7392994-7393016 CCATTTGGTGACATGGCTTTGGG No data
969471714_969471725 6 Left 969471714 4:7392973-7392995 CCAGCACCCTGGCTCCCTGGCCC 0: 1
1: 0
2: 5
3: 96
4: 895
Right 969471725 4:7393002-7393024 TGACATGGCTTTGGGAGAATAGG 0: 1
1: 0
2: 2
3: 25
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969471714 Original CRISPR GGGCCAGGGAGCCAGGGTGC TGG (reversed) Intronic
900161824 1:1227561-1227583 CGGGCAGGGAGCCGAGGTGCAGG - Intronic
900243163 1:1626311-1626333 GGGCCCGTGAGCCAGCGTGGGGG - Intronic
900420994 1:2555894-2555916 GGTGCAGGGAGCCAGGAAGCTGG + Intronic
900421679 1:2558527-2558549 TGGCCATGGAGAGAGGGTGCAGG - Intronic
900464823 1:2820592-2820614 GGGCCAGGGGTCCAGGGGTCGGG + Intergenic
900479897 1:2893018-2893040 GGGCCAGGCAGCAAAGCTGCTGG - Intergenic
900527369 1:3135816-3135838 GGCCCAGGGAGCCACGGGGAAGG - Intronic
900531774 1:3157386-3157408 AGGCCTGGGAGCCTGGGGGCAGG - Intronic
900598706 1:3493955-3493977 GGGCCAGGGAGCGGGGGTTCAGG + Intronic
900792556 1:4689939-4689961 AGGCCAGGGAGCCTGGCTGAGGG - Intronic
901142444 1:7043920-7043942 GGGCCAGGCAGCCAGGGGAGAGG + Intronic
902397202 1:16138909-16138931 TGGCCAGTGAGTCAGGGTGGTGG - Intronic
902531492 1:17093639-17093661 GGGCCAGGGGGCCATCCTGCTGG - Exonic
902615356 1:17620663-17620685 AGGGCAGGGAGCCGGGGTTCTGG + Intronic
902861855 1:19252212-19252234 GGGAAAGGCAGCCAGGGTGGCGG - Intronic
902940794 1:19799357-19799379 GGGACAGGGAGACAGGAGGCGGG + Intronic
903218177 1:21854568-21854590 TGGCAGGGGACCCAGGGTGCAGG - Intronic
903538178 1:24081194-24081216 GGGCCAGGGGCCTGGGGTGCAGG + Intronic
903664110 1:24996206-24996228 GGGCCAGGAGGCCAGGCAGCAGG - Intergenic
903815376 1:26060777-26060799 GGCCCAGGGACCCAGGGAGAAGG + Intronic
903946575 1:26967793-26967815 GGGGCAGGGAGCCAGAGGGTGGG - Intergenic
904236684 1:29121574-29121596 GGGCCGGGGCCCCAGGGTCCCGG - Exonic
904278251 1:29398183-29398205 GGGCCTGGGTTCCAGCGTGCTGG + Intergenic
904602967 1:31683840-31683862 GGGAAATGGAGGCAGGGTGCAGG - Intronic
904859890 1:33528145-33528167 GGGCCAGACAGCCAAGGTTCAGG + Intronic
905252629 1:36659328-36659350 TGCCCAGGGACCCAGGGTACAGG - Intergenic
905402972 1:37716541-37716563 GAGACAGGGAGGCAGGGGGCTGG + Exonic
905446121 1:38029519-38029541 GGAGCCGGGAGCCAGGGAGCGGG + Intergenic
905653043 1:39669148-39669170 GCTCCAGGAAACCAGGGTGCTGG + Intronic
905796471 1:40819068-40819090 GGGCAAGGTAGGCCGGGTGCTGG + Intronic
906132493 1:43468953-43468975 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
906322090 1:44823207-44823229 GGGGCAGGGAGGCAGGGCTCAGG - Intronic
906831120 1:49033021-49033043 GGGCCTGGGAACAAAGGTGCTGG - Intronic
906913460 1:49982390-49982412 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
906928405 1:50143763-50143785 GGGCCAGGAAATCCGGGTGCAGG + Intronic
907319602 1:53594329-53594351 GGGCCTGGCAGGCAGGGTGGTGG - Exonic
907369701 1:53992813-53992835 GGGCCAGGGCAGCAGGGGGCTGG + Intergenic
907370749 1:54001808-54001830 GAGCCAGGGAGGCTGGGAGCTGG + Intergenic
907388190 1:54139465-54139487 GGGCCAGGGGCCCAGGGGGAAGG + Exonic
907546178 1:55261832-55261854 GGCCCAGGGATCCAGGTTGTAGG + Intergenic
908104332 1:60825742-60825764 GGGTCACAGAGCCAGGATGCAGG + Intergenic
908274556 1:62456747-62456769 ATCCCAGAGAGCCAGGGTGCTGG - Intronic
908661780 1:66444979-66445001 GGGCCAGGCAGCCAGAGCTCAGG - Intergenic
910247281 1:85153167-85153189 GAGCCAGGGAGCAAGGGAGAAGG + Intergenic
910475562 1:87602455-87602477 GGGCCTGGCACCCAGGGTGAGGG + Intergenic
912062238 1:105687247-105687269 GGGCCAGTGAGGCAGGGGGATGG + Intergenic
912528929 1:110306207-110306229 GGGCCAGGAAGCCAAGGTCTAGG - Intergenic
912548309 1:110466866-110466888 GGGGCAGGGTGCCCAGGTGCAGG - Intergenic
913168712 1:116212714-116212736 GGGCAAGGGAGCCTGGGGGTGGG + Intergenic
915109389 1:153553424-153553446 GAGCCAGGGAGAATGGGTGCAGG - Intergenic
915302990 1:154962045-154962067 GGCCCAGGTAGCCCGGGGGCCGG + Intronic
915321208 1:155057404-155057426 GGGCTAATGAGCCAGGGTGAGGG - Intronic
915440932 1:155945080-155945102 GTTCCAGGGAGCCAGGGCCCAGG - Intergenic
915519834 1:156435724-156435746 GGGCGAGGGCGCGAGGGTCCTGG - Intergenic
915531483 1:156504891-156504913 GGGCCAGGGTGCCTGGGGCCAGG + Intergenic
915625020 1:157109150-157109172 GGGCCATGGAGAGAGGGTCCTGG + Intergenic
916360163 1:163959170-163959192 GTGCCAGGGTGCCAGGGAGGGGG + Intergenic
917979513 1:180260319-180260341 GTGCCAGACAGCCAGGGTGTAGG + Intronic
918316656 1:183328214-183328236 GAGCCAGGAAGCCAGGGTCCTGG - Intronic
918467620 1:184837345-184837367 GGCCTAGGGAGACAGAGTGCTGG + Intronic
920098929 1:203504741-203504763 TGGCCAGCGAGCCAGGGAGTAGG - Intronic
920171608 1:204075325-204075347 GAGCCGGGGAGCCAGGGAGCGGG - Intronic
920174196 1:204089946-204089968 GGGCCATGGTGCCAGAGGGCAGG + Intronic
921067003 1:211630521-211630543 TGGCCAGGAAGCCTGGCTGCTGG - Intergenic
921944840 1:220879543-220879565 GGGCGGGGGAGCCAGGGAGACGG - Exonic
922233353 1:223704976-223704998 GGGCTGGTGGGCCAGGGTGCTGG - Intronic
922372917 1:224929593-224929615 GCGCAAGGGATCCTGGGTGCCGG - Intronic
922416549 1:225427837-225427859 GGGCCGGGGACCCTGGGCGCGGG - Intronic
922767041 1:228161596-228161618 GGGCCAAGGAGGGAGGCTGCAGG - Intergenic
923010291 1:230083101-230083123 GGAGCAGGGAGCCAGGATGATGG + Intronic
923010308 1:230083184-230083206 GGAGCAGGGAGCCAGGATGATGG + Intronic
923206151 1:231760827-231760849 GGCCCAGGGGGCCTGAGTGCTGG + Intronic
923629842 1:235642601-235642623 GGGGCAGGGGGCCAGGGAGAGGG + Intronic
1062806908 10:429210-429232 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062806919 10:429232-429254 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062806930 10:429254-429276 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062806941 10:429276-429298 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062806952 10:429298-429320 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062806963 10:429320-429342 GGGTGAGGCAGCCAGGGTCCGGG - Intronic
1062806972 10:429342-429364 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062806983 10:429364-429386 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062806994 10:429386-429408 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062807006 10:429409-429431 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062807016 10:429430-429452 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062807026 10:429451-429473 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062807036 10:429472-429494 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062807046 10:429493-429515 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062807056 10:429514-429536 GGGGGAGGCAGCCAGGGTCCGGG - Intronic
1062827565 10:583969-583991 AGGCGCGGGGGCCAGGGTGCTGG + Intronic
1062841975 10:679264-679286 GGCACAGGGAGCACGGGTGCGGG - Intronic
1062842030 10:679437-679459 GGTGCAGGGAGCCTGGGTGTGGG - Intronic
1063121822 10:3109898-3109920 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1063623275 10:7667403-7667425 TGTCCAGGGAGGCAGGGTGTGGG - Intergenic
1063836378 10:10019070-10019092 GGATCAGGGAGCCAGTGTGTGGG - Intergenic
1063974132 10:11401854-11401876 AGGACTGGGAGGCAGGGTGCTGG + Intergenic
1064251066 10:13706917-13706939 GGAGCAGGGAGCGAGGGTGGGGG - Intronic
1066402548 10:35090143-35090165 GGGTCGGGGAGCCGGGCTGCAGG - Intronic
1067189782 10:44059512-44059534 GGGTCAGGGATGCAGGGTGTTGG + Intergenic
1067847969 10:49738117-49738139 GGGCTAGGGGTCCAGGGTGTGGG - Intronic
1068792903 10:61046822-61046844 TGTCCCGGGAGCCAGGGTGGTGG + Intergenic
1068886136 10:62098790-62098812 GGGCCAGGGGACCATGGGGCTGG - Intergenic
1069034157 10:63630332-63630354 CGGCCGGGCAGCTAGGGTGCTGG + Intergenic
1069837776 10:71319827-71319849 GGGCTGGGAAGCCTGGGTGCTGG - Intronic
1070608224 10:77914595-77914617 GAGCCAGGGAGCAAGGCTGCGGG - Intronic
1070693102 10:78542312-78542334 GGGCCAGGGAGTTGGGGTGAGGG - Intergenic
1070769810 10:79075663-79075685 GGGCCAGGCAGCCGGAGTCCTGG - Intronic
1070783530 10:79150517-79150539 AGGCCTGGGAGCCAGGAGGCTGG + Intronic
1070808206 10:79283266-79283288 AGGCCCTGGAGCCAGGCTGCTGG + Intronic
1071957007 10:90770649-90770671 GGGCCAGGGCGACAGGGGGCTGG - Intronic
1072082514 10:92045838-92045860 AGGCCAGGGCCCCTGGGTGCGGG + Intergenic
1072637129 10:97185444-97185466 GAGCCAGGGAGCCAGGGGCGGGG + Intronic
1072657212 10:97338280-97338302 CAGGCAGGGAGCCAGTGTGCTGG - Intergenic
1072718855 10:97768712-97768734 TGCCCAGAGAGCCATGGTGCAGG + Intronic
1072765101 10:98088791-98088813 AGGCCAGGGATCCAGGGAGTTGG - Intergenic
1072955636 10:99885612-99885634 GGGCCTGGGGGCCTGGCTGCAGG + Intronic
1073249824 10:102114642-102114664 GGGGCCGGGGGCCAGGGGGCCGG + Intronic
1073266588 10:102231456-102231478 GCGGCCGGGAGCCAGGGTCCGGG + Intronic
1073330773 10:102668764-102668786 GGGCCTGGGAGCCCGGGAGCAGG + Intergenic
1073376806 10:103042256-103042278 GGGCCCGGGAGCAATGGTGCAGG - Intronic
1074909738 10:117897036-117897058 GAGCCCGGGAGCCAGGGCACCGG + Intergenic
1075055836 10:119217764-119217786 CGGCCAGGGAAGCAGGGTGCAGG - Intronic
1075255897 10:120925949-120925971 AGGCCAGGCAGCCAGATTGCCGG - Intergenic
1075483401 10:122800409-122800431 GGGCAGGGGAGCCTGGGGGCAGG + Intergenic
1075526151 10:123188966-123188988 TGGCCGGGGAGCCAGGGGGCTGG + Intergenic
1075566030 10:123504968-123504990 GGGCCAGAGTCCCAGGGTGGTGG + Intergenic
1075619382 10:123914628-123914650 GGGCCCGGGTGCCAGGCTTCTGG - Intronic
1075664066 10:124218446-124218468 GGACCTGGGAGTCAGGGAGCTGG - Intergenic
1075823586 10:125334696-125334718 AGGCCTGGGAGCCAGGGAGTTGG - Intergenic
1075949359 10:126463543-126463565 GGGCCAGGGCGCAAGGGTTGTGG - Intronic
1076094019 10:127715462-127715484 GCGCCAGGGAGCCAGGGGTCAGG - Intergenic
1076273682 10:129178398-129178420 GGAGCAGGGTGCCAGGATGCTGG - Intergenic
1076727708 10:132421247-132421269 GGGCCGGGGCCGCAGGGTGCAGG - Intergenic
1076840052 10:133041391-133041413 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076840071 10:133041447-133041469 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076840099 10:133041518-133041540 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076840264 10:133041978-133042000 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076875220 10:133212637-133212659 GGTCCAGGGAGGCAGGGTTGGGG - Intronic
1076885522 10:133260728-133260750 CAGCCAGAGAGCCAGGGTCCTGG - Intergenic
1077096610 11:801725-801747 GTGCCAGGGACACAGGGAGCAGG + Intronic
1077124488 11:926257-926279 GGGGGTGGGGGCCAGGGTGCGGG + Intronic
1077198925 11:1295816-1295838 AGGCCAGTGAGTCAGGGTGGGGG + Intronic
1077221981 11:1421940-1421962 GGGCCCGGGAGAGAGGGGGCAGG + Intronic
1077483029 11:2825398-2825420 GTGCCAGGGGCCCCGGGTGCTGG + Intronic
1077539319 11:3139192-3139214 GGGCCTGAGAGCCAGGGAGGTGG + Intronic
1077545006 11:3165355-3165377 GGCCCAGGGAGCCCGGAGGCGGG + Intronic
1077638437 11:3859662-3859684 GGGGGAGGGAGGCAGGGTTCTGG - Intronic
1078328701 11:10401343-10401365 GGGACTGGGATCCAGGGTGGAGG - Intronic
1078393063 11:10953129-10953151 GGGCCAGGGTGCCAGATGGCTGG + Intergenic
1080827627 11:35861339-35861361 GGGCCTGGGGGCCTGGCTGCGGG - Intergenic
1081539233 11:44018048-44018070 GAGCCAGGGATCCAGGGGACTGG + Intergenic
1081742736 11:45452255-45452277 TGGCCTGTGAGCCAGGGAGCAGG - Intergenic
1081759121 11:45564732-45564754 GGACCAGAGAGCCAGGGGGAGGG + Intergenic
1081910353 11:46696246-46696268 GGGACAGGGAGCCTGGGAGAGGG - Intronic
1081913803 11:46718415-46718437 GGGGCAGGCAGCCAGGGAGAAGG + Intergenic
1082005279 11:47415727-47415749 AGCCCAAGGATCCAGGGTGCAGG + Exonic
1082177920 11:49082933-49082955 GGGCAAGGGCTCCAGGCTGCAGG + Intergenic
1082764144 11:57153382-57153404 GAGCCATGGAGCCATGATGCTGG - Intergenic
1083153065 11:60805662-60805684 GAGCCAGGAAGTCAGGGTGCTGG - Intergenic
1083163131 11:60867775-60867797 TGGCCAGGGAGGCAGGGGCCAGG - Intronic
1083187674 11:61026982-61027004 GGGGAAGGGAGCCAGGGAGGGGG - Intergenic
1083330727 11:61897251-61897273 TGGCCAGAGCCCCAGGGTGCAGG + Intergenic
1083480005 11:62937977-62937999 GGGCCAGGGAGTCAGGGTCAAGG - Intronic
1083673122 11:64310923-64310945 GAGCCAGCCGGCCAGGGTGCGGG + Intronic
1083741092 11:64712193-64712215 GGGCCTGTGAGACAGGGGGCGGG - Intronic
1083879261 11:65540111-65540133 CGGCCAGGGCGGCAGGCTGCCGG + Exonic
1083882673 11:65556127-65556149 TGGCCAGGGAGCCTGGGAGATGG + Intronic
1084007837 11:66332557-66332579 GGGCCAGGGCCCCAGGGGGCAGG + Exonic
1084063508 11:66690403-66690425 GAGCCAGGGAGTGGGGGTGCTGG + Intronic
1084161267 11:67351705-67351727 GGGTCAGGGAGACAGGCAGCAGG + Exonic
1084163875 11:67366159-67366181 GGGCCTGGAAGCCAGATTGCAGG + Intronic
1084204874 11:67585377-67585399 GGGCCAGGGGCCCAGGGGCCTGG + Intronic
1084319159 11:68363958-68363980 GGGCGCGGGGGCGAGGGTGCGGG + Intronic
1084514812 11:69631003-69631025 GAGCCAGGGAGCCTGGGACCTGG + Intergenic
1084605473 11:70169454-70169476 GGGCCTGGGAGGGAGGGTGCAGG - Intronic
1085400414 11:76232581-76232603 GGGGCAGGGAGACAGGGAGGAGG - Intergenic
1085461566 11:76697011-76697033 GGGCCAGAGACCCACGGGGCGGG - Intergenic
1085474776 11:76783071-76783093 GGGGCAGGGATCCGGGATGCAGG + Intronic
1085621110 11:78038542-78038564 GGGCTGGGGAGCCAGTGAGCGGG - Intronic
1086061708 11:82706777-82706799 GGGTCAAGGAGGCAGGGAGCTGG - Intergenic
1086091360 11:83008159-83008181 TGGCCAGGGAGCCAGAGGTCAGG + Intronic
1086687798 11:89752927-89752949 GGGCAAGGGCTCCAGGCTGCAGG - Intergenic
1086718053 11:90086967-90086989 GGGCAAGGGCTCCAGGCTGCAGG + Intergenic
1087803525 11:102530649-102530671 GGGCCAGGCTGCCAGGCAGCAGG + Exonic
1089096437 11:115923569-115923591 GGGCTAGGGAGGCAGGGGGATGG - Intergenic
1089254709 11:117188185-117188207 AGGCCAGGGAGTGAGGGCGCTGG - Intronic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1089734602 11:120541065-120541087 GGGGCAGGGCCCCAGGCTGCAGG - Intronic
1090028259 11:123185680-123185702 GGGCCAGGCAGGCAGAGTCCGGG - Intronic
1090387131 11:126363882-126363904 GGGGCAGGGCGACACGGTGCCGG - Intronic
1090799200 11:130160069-130160091 GGGCCGGGGACCCGGGGCGCTGG + Intronic
1090839072 11:130473731-130473753 GGGCCACGGAGGCCGGCTGCTGG + Exonic
1090852086 11:130579498-130579520 GAGCCAGGGAGCCAGAGAGAAGG - Intergenic
1090919925 11:131198432-131198454 GGGCCAGGCAGCAAGGGGGCAGG + Intergenic
1091086744 11:132728182-132728204 GGCCAGGGGAGACAGGGTGCGGG - Intronic
1091386573 12:99796-99818 GGGACAGGGAGGCAGAGGGCAGG - Intronic
1091395145 12:149822-149844 GGGCGTGAGAGCCAGGCTGCAGG + Intronic
1091590279 12:1838726-1838748 GGGACAGGGGGTCAGGCTGCTGG - Intronic
1091760461 12:3084054-3084076 AGGCTTGGGAGCCAGGGTGGAGG + Intronic
1092082054 12:5724409-5724431 GGCCCAGGGAGACATGGTCCAGG - Intronic
1092119678 12:6035086-6035108 GAGCCAGGCAGCCAGGGAGGAGG + Intronic
1092143790 12:6201022-6201044 GCGCCAGGAAGGGAGGGTGCGGG + Intronic
1092287015 12:7134496-7134518 GGGCCTGGGAGCCTGGGTCTTGG + Intronic
1092294807 12:7189663-7189685 GGGGCGGGGAGCCAGGGGGCGGG - Intronic
1092528481 12:9325414-9325436 GGGTCAGGGAGCAAGGTAGCTGG + Intergenic
1092802406 12:12183142-12183164 GGGCCAGGGAGTCAGAGAGATGG - Intronic
1092831912 12:12452507-12452529 GGCACTGGGGGCCAGGGTGCGGG + Intronic
1092938243 12:13383916-13383938 AGGCCAGGGAAGCGGGGTGCAGG - Intronic
1096181584 12:49554146-49554168 GAGCCAGTGAGACAGGCTGCAGG + Intronic
1096500864 12:52063195-52063217 ACGACGGGGAGCCAGGGTGCTGG - Intergenic
1096795815 12:54076983-54077005 GGTCCAGGGAGCCAGGAGACTGG + Intergenic
1097078636 12:56413257-56413279 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1098050252 12:66445712-66445734 GGAGTAGGGAGCCAGGGTGCAGG - Intronic
1098519681 12:71421157-71421179 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
1099322089 12:81162805-81162827 GGGCCAAGGAGGTAGGGGGCTGG + Intronic
1099359440 12:81681558-81681580 AGGCCAGGGAGCAAAGGTGCAGG - Intronic
1099970550 12:89495676-89495698 GGACCAGGGAGTCAGGGGGAAGG + Intronic
1100788648 12:98106450-98106472 GGGCCAAGGAGCCGGTGTGGCGG + Intergenic
1101490871 12:105208308-105208330 GAGCCAGGGACTGAGGGTGCAGG - Intronic
1101570629 12:105950510-105950532 GGCCCAGGGAGCCAGAGAGAAGG - Intergenic
1101581692 12:106047636-106047658 GGACCATAGAGCCAGGGTGTTGG - Intergenic
1101672459 12:106888746-106888768 AGGCCAGGGACCAAGGCTGCAGG + Intronic
1101746174 12:107543615-107543637 GGGCGAGGGAGGCAGTATGCAGG + Intronic
1102001142 12:109558729-109558751 TGACCAGGGAGCCAGGCTTCAGG - Intronic
1102029068 12:109729695-109729717 GGCCCAGGGAGCGGGGGTGGCGG - Intronic
1102035424 12:109768381-109768403 GGCCAAGGGACCCAGAGTGCTGG - Exonic
1103136711 12:118513751-118513773 GGGCCAGGGAGCAAGGGGCGGGG + Intergenic
1103601984 12:122060092-122060114 GGGCCGGGGAGGCTGGGAGCCGG + Exonic
1103856415 12:123973406-123973428 GGGGCCGGGGGCCAGGGAGCGGG + Exonic
1104554576 12:129788019-129788041 GGGCCAGGATGCCTGGGTGGGGG - Intronic
1104624244 12:130338846-130338868 GGGCCGGGGTGCGGGGGTGCAGG + Intronic
1104860790 12:131922357-131922379 GGCCCAGGTAGGGAGGGTGCTGG - Exonic
1104893607 12:132151598-132151620 GGACCCGGCAGGCAGGGTGCCGG - Exonic
1104893780 12:132152208-132152230 GGGCCAGGGTGCGAGGGTCTGGG + Intronic
1104969690 12:132525623-132525645 GGGCCGGGGTGCTGGGGTGCCGG + Intronic
1104972093 12:132535461-132535483 CTGTCAGGGAGCCAGGCTGCAGG - Intronic
1105332547 13:19431768-19431790 GTGCCATGGGGCCAGGATGCTGG - Intronic
1105879138 13:24588009-24588031 GTGCCATGGGGCCAGGATGCTGG + Intergenic
1105920699 13:24961043-24961065 GTGCCATGGGGCCAGGATGCTGG - Intergenic
1105948958 13:25212656-25212678 AGGACAGGGACCCAGGGTGAGGG - Intergenic
1106308842 13:28535326-28535348 GGGCCAAGGAAGCAGGGGGCTGG - Intergenic
1107402984 13:40087207-40087229 AGGCCAGGAAGCTAGGCTGCTGG - Intergenic
1107460209 13:40594628-40594650 GCGTCAGGGAGCGAGGGTTCTGG + Intronic
1108226294 13:48293233-48293255 GGGTCAGGGAGCCAATGTGAAGG + Intergenic
1109152064 13:58858883-58858905 GGGACCGGGCGCCAGGGAGCAGG + Intergenic
1113485013 13:110646938-110646960 GGCCCCAGGAGACAGGGTGCTGG - Intronic
1113629907 13:111875091-111875113 GGGTGACGGAGCCAGAGTGCGGG + Intergenic
1113744750 13:112736104-112736126 GGACCATGGTGCCAGGATGCGGG + Intronic
1113812875 13:113153166-113153188 GGGCCAGTGAGGCCCGGTGCGGG + Intergenic
1113908549 13:113831320-113831342 GGCCCTGGGAGCCAGGGCTCAGG + Intronic
1113961439 13:114128476-114128498 GGGCCAGGGAGGCACAGTCCAGG + Intronic
1114049689 14:18913058-18913080 TGGCCAGGCAGGCAGCGTGCAGG - Intergenic
1114112871 14:19488872-19488894 TGGCCAGGCAGGCAGCGTGCAGG + Intergenic
1114547254 14:23512174-23512196 GGGCTGGGGAGCTGGGGTGCAGG + Intergenic
1114714294 14:24808055-24808077 GTGGCAGGCAGCCAGGGTGGAGG + Intergenic
1115473911 14:33796207-33796229 GGGCCTGGGTGCAAGGGTTCTGG - Intronic
1118163949 14:63317697-63317719 TGGCCAAGAAGCCAGGCTGCAGG - Exonic
1118331124 14:64816834-64816856 GGGGCAGGGAGAATGGGTGCTGG + Intronic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1119036114 14:71231571-71231593 GGGCCGAGGTGCCAGGGGGCTGG - Intergenic
1119257249 14:73208980-73209002 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
1119407455 14:74407500-74407522 GGGCAGGGGAGTCAGGATGCAGG + Exonic
1119472213 14:74907216-74907238 GGGCCAGGCTGCCAGGGAGCAGG - Intronic
1119727146 14:76928381-76928403 AGGCCTGGGAGACAGGGTGGAGG - Intergenic
1120208103 14:81607943-81607965 GGCCCATGGAGCCAGTGAGCTGG - Intergenic
1121127615 14:91417979-91418001 GAGCCCGGGAGCCCGGGCGCGGG + Intergenic
1121447371 14:93987617-93987639 GAGGAAGGGAGCCAGGCTGCTGG - Intergenic
1121505218 14:94472066-94472088 GGGACAGATAGCCAGGGTCCTGG + Intronic
1121517205 14:94560686-94560708 GTGCAAGGGTGCAAGGGTGCAGG + Intergenic
1121630279 14:95416780-95416802 GGGCCAGGGATCGAGGGTCCAGG - Intronic
1121781965 14:96627804-96627826 GGGCCAGGCACCCCAGGTGCAGG + Intergenic
1121791458 14:96702598-96702620 GGGCCTGGGAGCCAGGCTCTGGG + Intergenic
1122143094 14:99674028-99674050 GGGGCCAGGGGCCAGGGTGCAGG + Intronic
1122261481 14:100525783-100525805 AGGCCAAGGACCCAGGGGGCAGG - Intronic
1122401103 14:101467909-101467931 GGGACAGGGATACAGGATGCAGG - Intergenic
1122531629 14:102431916-102431938 TGGCCAGCGAGCCAAGGAGCAGG + Exonic
1122595472 14:102887370-102887392 GGGCCAGGGACTCAGGGTAGAGG + Intronic
1122634979 14:103125578-103125600 GAGCCAGGAAGCCTGGGTTCTGG + Intronic
1122693875 14:103543622-103543644 GGGCCAGGAAGCCAGGCCGAGGG - Intergenic
1122786056 14:104163748-104163770 GGGCCTGGGCCCCAGGATGCAGG - Intronic
1122790206 14:104181182-104181204 GGGGCAGGGAGCCAGGCTTGGGG + Intergenic
1122797430 14:104212962-104212984 GGCCCTGGGAGCCTAGGTGCCGG - Intergenic
1122827035 14:104375367-104375389 AGGACGGGGAGACAGGGTGCGGG + Intergenic
1122827059 14:104375438-104375460 AGGACGGGGAGACAGGGTGCGGG + Intergenic
1122827082 14:104375509-104375531 AGGACGGGGAGACAGGGTGCAGG + Intergenic
1202840191 14_GL000009v2_random:114380-114402 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1202904628 14_GL000194v1_random:61011-61033 GCTTCAGGGACCCAGGGTGCTGG + Intergenic
1123968248 15:25480339-25480361 GGGCTAGGGAGTCAGGGGGTGGG + Intergenic
1124067180 15:26355156-26355178 GGGCCAGGGACCAAGGGAGCTGG - Intergenic
1124154913 15:27217452-27217474 GGGCCAGGAAGCCAGGGCAGTGG - Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1125718038 15:41830812-41830834 GGGCCAAGGAGGCAGGGGGCTGG - Intronic
1126109997 15:45169410-45169432 AGGGCTGGGAGTCAGGGTGCAGG + Intronic
1126348026 15:47717273-47717295 GGGCCGCGGCGCCAGGGTGGGGG + Intronic
1126849036 15:52786625-52786647 GGGGGAGGGAGCCTGAGTGCTGG - Intronic
1126993974 15:54418487-54418509 GGGCAGGGCAGACAGGGTGCGGG - Intronic
1127292133 15:57580394-57580416 AGGCCAGGGAGCCTGGGCTCTGG - Intergenic
1128103949 15:65029376-65029398 GGGCCAGGGATCCGGGGACCCGG - Intronic
1128757869 15:70195701-70195723 CAGCCAGGGAGCCAGGCTGTGGG - Intergenic
1128772397 15:70292073-70292095 AGGCCAAGAGGCCAGGGTGCAGG - Intergenic
1128965212 15:72051706-72051728 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1129057552 15:72831945-72831967 AGGTCAGGGAGCCAGGGGCCAGG - Intergenic
1129247846 15:74290749-74290771 GGACCTGGGTGCTAGGGTGCAGG + Intronic
1129412270 15:75356513-75356535 GGGGCAGGAAGCCAGGTTGCTGG + Exonic
1129450274 15:75647668-75647690 GCGCCAGCGAGCGAGGGCGCTGG + Intronic
1129518373 15:76170687-76170709 GGGCCTGGGATACAGGATGCAGG + Intronic
1129663129 15:77564551-77564573 GAGCCAGGGAGCCAGGGCAGAGG - Intergenic
1129750126 15:78056865-78056887 GGGCCAGGTAGTCAGGGAGCTGG - Intronic
1130555954 15:84922674-84922696 GGGCTAGGAAGCCACGGTGAGGG - Intronic
1131096108 15:89655238-89655260 AGGCTGGGGAGCAAGGGTGCCGG + Intronic
1131108519 15:89750391-89750413 TGGCCAGGTGGCCAGGCTGCCGG + Intronic
1131367360 15:91852742-91852764 GGGCCACAGAGCCAGGGGACGGG + Intergenic
1131530548 15:93187683-93187705 AGGCCAGGGAGCCAGGCCTCAGG - Intergenic
1131640024 15:94282867-94282889 GGGCCAGAGAACCAAGCTGCTGG - Intronic
1132152873 15:99474991-99475013 GGGCCAGGGAGCCACGGCCAGGG - Intergenic
1132410824 15:101577179-101577201 GGGCCAGGGATGCAGAGAGCCGG - Intergenic
1132518444 16:376656-376678 GGGCCAGGGGGCACCGGTGCAGG + Exonic
1132537452 16:489744-489766 GGCCCAGGGAACCTGGGTGGAGG + Intronic
1132567801 16:631229-631251 GGGCCGCCGAGCCAGGGGGCCGG - Exonic
1132576407 16:666372-666394 GGGAGAGGGGGCCTGGGTGCTGG + Intronic
1132576514 16:666823-666845 GCCCCAGGGATCCAGGGTGGTGG + Intronic
1132745341 16:1434013-1434035 GAGCCAGGGAGCCCGAGTCCAGG + Intergenic
1132765764 16:1533460-1533482 AGGCCAGGGATGCCGGGTGCGGG - Intronic
1132844576 16:1993898-1993920 GGGCCAGGAAGCCAAGGTAAAGG - Exonic
1132983744 16:2752853-2752875 GGGTGAGGGAGCCAGCGAGCCGG + Intronic
1133027960 16:2996880-2996902 GGGACAGGGAGGCAGGGGCCAGG - Intergenic
1133215612 16:4290529-4290551 GGGCCAGAGAGAGAGGGTGCAGG - Intergenic
1133978641 16:10617840-10617862 GGGAGAGGGAGCAAGGGAGCAGG + Intergenic
1134092335 16:11398293-11398315 GGACCAGGGACCCATGGTGAGGG - Intronic
1134974810 16:18562010-18562032 GGGCCAGGGCGCGGGGCTGCTGG - Exonic
1135208195 16:20499989-20500011 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1135210704 16:20523711-20523733 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1136059068 16:27712301-27712323 GGGCCTGGGACCCAGGATGCAGG - Intronic
1137022293 16:35440667-35440689 GGCTCAGGGAGTCAGGGAGCTGG + Intergenic
1137669879 16:50272727-50272749 GGAGCAGGGGTCCAGGGTGCTGG + Intronic
1137692845 16:50441433-50441455 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1137787594 16:51151359-51151381 GGGCCGGGGAGCCGGGGAGGGGG - Intronic
1138438401 16:57019968-57019990 ATTCCAGAGAGCCAGGGTGCAGG + Intronic
1138519721 16:57563994-57564016 GGGCCAAGGAGGGTGGGTGCCGG + Intronic
1138527852 16:57619400-57619422 GGGCCAGGCAGGCAGGGTTAGGG + Intronic
1138998179 16:62477960-62477982 GGGCCAAGGAGGCAGGGGGCTGG - Intergenic
1139346464 16:66306918-66306940 AGGGGAGGGAGCCTGGGTGCGGG + Intergenic
1139469560 16:67170829-67170851 TGGCCAGGAAGCCAGGGTCTTGG - Intronic
1139754592 16:69132401-69132423 GGGCGAGGGCGCGAGGGAGCGGG - Intronic
1139852427 16:69959331-69959353 AGGCCAGGGAGTCAGGGAGCTGG - Intronic
1139852445 16:69959371-69959393 GGGCCAGGGGGGCAGGCAGCAGG + Intronic
1139881398 16:70182239-70182261 AGGCCAGGGAGTCAGGGAGCTGG - Intronic
1139881416 16:70182279-70182301 GGGCCAGGGGGGCAGGCAGCAGG + Intronic
1140371093 16:74413225-74413247 GGGCCAGGGAGGTAGGCAGCAGG - Intronic
1140371109 16:74413265-74413287 AGGCCAGGGAGTCAGGGAGCTGG + Intronic
1140811735 16:78585327-78585349 GGGGCTGGCAGCCAGGGTGATGG - Intronic
1141079350 16:81036443-81036465 GAGCCAGGGAACCAGGGAACTGG - Intronic
1141254132 16:82385217-82385239 GGGCCAGTGAACCATGGTGGGGG + Intergenic
1141438105 16:84012449-84012471 GGGCCTGGGAGCCAGGGGCCTGG + Intronic
1141655408 16:85413337-85413359 GGGCCATGGAGGGAGGGTCCAGG + Intergenic
1141659716 16:85435421-85435443 GGGAGAGGGAGGGAGGGTGCAGG - Intergenic
1141697629 16:85627669-85627691 GGGCCGGGGGGCCGGGGGGCCGG - Intronic
1141700113 16:85638632-85638654 GGGGGTGGGAGCCAGGGTGGAGG - Intronic
1141810272 16:86371342-86371364 GGCTCAGGGAGCAAGGGTGAGGG - Intergenic
1142174830 16:88640315-88640337 AGGACAGGGAGCCAAGGTACAGG - Exonic
1142202024 16:88765619-88765641 AGACCAGGGAGCCAGGCTCCAGG - Intronic
1142317580 16:89357838-89357860 GGTACTGGAAGCCAGGGTGCTGG + Intronic
1142364357 16:89642070-89642092 GTGCCAGGGAGCGACGGGGCTGG + Intergenic
1142609752 17:1102301-1102323 GGGCCGGGGAGACAGGGTAGTGG + Intronic
1142760705 17:2040477-2040499 GGGAGAGGGAGGCAGGGTGGGGG - Intronic
1142976644 17:3648555-3648577 GGAGCAGGGAGCCACGGTCCTGG + Intronic
1143258958 17:5584224-5584246 GGGCCAGGCAGGGAGGGTGAGGG + Intronic
1143276387 17:5714492-5714514 GGGCCAGGGAGAGACGGAGCAGG - Intergenic
1143582237 17:7834193-7834215 GGGCTGGGGAGCGGGGGTGCGGG + Intergenic
1143619975 17:8075238-8075260 GGGGCAGGAGGCCAGGGAGCTGG - Intronic
1143620862 17:8079645-8079667 GGGACAGGGACGCGGGGTGCGGG + Intronic
1144640110 17:16932268-16932290 GGGCCAGGGAGACAGGGGCAAGG + Intronic
1144695410 17:17301083-17301105 GGGCCAAGGAGGCAGGGGGCTGG - Intergenic
1144828165 17:18118129-18118151 GGGGTGGGGAGCCAGGCTGCCGG - Intronic
1144872130 17:18378006-18378028 GAGCCAGGGAGCTAGGGTGGGGG + Intronic
1145285843 17:21505590-21505612 GGGCCCGGAGGCCAGGGGGCTGG - Intergenic
1145741795 17:27281025-27281047 GGGCCAGGGAGACAGAGTGCTGG + Intergenic
1145796228 17:27656821-27656843 GGGCCGGGGTGGCAGGGGGCGGG - Intergenic
1146086872 17:29838229-29838251 GGACCAGGGTGCCAGGGGGCTGG - Intronic
1146168816 17:30616385-30616407 TGGGCAGGGATCCAGGGTGTAGG + Intergenic
1146170747 17:30631063-30631085 TGGGCAGGGATCCAGGGTGTAGG - Intergenic
1146344194 17:32047082-32047104 TGGGCAGGGATCCAGGGTGTAGG - Intronic
1146479866 17:33196585-33196607 GGGCCATGGAGCCTGGGTCACGG + Intronic
1146588845 17:34110314-34110336 AGGATAGGGAGCCAGGGCGCTGG + Intronic
1146709219 17:35026472-35026494 ACCCCAGGGAGCCAGGATGCAGG - Exonic
1146820122 17:35978087-35978109 GGGACAGGGAGCCCAGGGGCAGG - Intronic
1147189451 17:38730282-38730304 GGGCCGGGGACCGAGGGGGCGGG + Exonic
1147211275 17:38873882-38873904 AGGCCAAGGTGCCAGGCTGCAGG + Intronic
1147257966 17:39193480-39193502 GGGCCAGGCACTGAGGGTGCCGG - Intronic
1147341604 17:39755899-39755921 GGGCCAGGGGGCCAGGGTACTGG + Intergenic
1147406752 17:40217920-40217942 GGGCGATGGAGCCAGGGAGATGG - Intergenic
1147449341 17:40494098-40494120 GTGCCAGAGGGCCTGGGTGCTGG + Intronic
1147559299 17:41499181-41499203 GGGGCAGATGGCCAGGGTGCCGG + Intergenic
1147930392 17:43977069-43977091 AGGCCAGGAAGGCAGGGTGGGGG - Intronic
1147969947 17:44213884-44213906 GGGCCAGACAGCCAGGATCCTGG - Intronic
1147986126 17:44308663-44308685 GGGGGAGGGAGCGAGGGGGCCGG + Exonic
1148138608 17:45312014-45312036 GGGCTATGGAGGCAGGGGGCAGG - Intronic
1148190668 17:45676651-45676673 GAGCCAGGGTGCCAGGGGGTTGG - Intergenic
1148239141 17:45988484-45988506 GGGCCCTGGAACCAGGATGCAGG - Intronic
1148667926 17:49388519-49388541 GGGCAGGGGTGCCAGTGTGCTGG + Intronic
1148737150 17:49871274-49871296 GGGCCAGGGAGCCAGGTGTGAGG - Intergenic
1148774531 17:50088119-50088141 GGGCTGGGGAGCCTGGGGGCTGG - Intronic
1148871692 17:50662232-50662254 GTGCCAGGCAACCTGGGTGCTGG + Intronic
1149486521 17:57046626-57046648 GAGCCAGGGAGCCGGTGGGCCGG - Intergenic
1150210043 17:63436857-63436879 AGGCCAGGGATCCAGGAAGCGGG - Intronic
1150790053 17:68196250-68196272 GCGCCAGGAAGCCAGTGCGCCGG + Intergenic
1150812412 17:68367279-68367301 GACCCTGGGAGCCAGGGTGCAGG + Intronic
1150952742 17:69821557-69821579 GGGCCAAGGTGCCAGGGAGCTGG - Intergenic
1151449017 17:74186007-74186029 GGCCCGGGGGGCCAGGGTTCAGG + Intergenic
1151494005 17:74448886-74448908 GGGCCACGGAGAGAGGCTGCTGG - Intronic
1151732630 17:75920405-75920427 GGGCCAGGGACTCTGGGAGCAGG + Exonic
1152107609 17:78340203-78340225 TGGCCAGTCAGTCAGGGTGCTGG + Intergenic
1152251509 17:79215051-79215073 AGGGCAGGGAGCCAGGGGGTGGG - Intronic
1152298944 17:79484470-79484492 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298957 17:79484499-79484521 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298964 17:79484514-79484536 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298977 17:79484543-79484565 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298984 17:79484558-79484580 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152494941 17:80664450-80664472 GGCGCAGGGAGCGAGGCTGCAGG - Intronic
1152507759 17:80762407-80762429 TGGCGAGGGCCCCAGGGTGCAGG + Intronic
1152549297 17:81021351-81021373 GTGGCCGGGAGCCAGGGAGCCGG - Intergenic
1152590396 17:81208809-81208831 GGGCCCGGGACCCAGGAGGCTGG + Intronic
1152612410 17:81322353-81322375 GGCACCGGGAGCCAGGCTGCGGG - Intronic
1152997117 18:418005-418027 GGCCCAAGAAGCCAGGGTGAGGG + Intronic
1153808697 18:8733143-8733165 GTGCCTGGGAGCCAGGGCGCAGG + Intronic
1154412513 18:14149059-14149081 GGGCCTGTGAGGCAGGGTGAAGG - Intergenic
1155170713 18:23265153-23265175 GGGCAAGGAAACCTGGGTGCTGG - Intronic
1155274344 18:24171757-24171779 GGGCCAGGGAGACAGGGCATAGG - Intronic
1155965780 18:32034094-32034116 GGCACAGGAAGCCAAGGTGCTGG - Intronic
1156150363 18:34234177-34234199 GGGACTGGGAGCCATGGAGCAGG - Intergenic
1156355232 18:36334956-36334978 GGGGCACACAGCCAGGGTGCTGG - Intronic
1156400341 18:36733891-36733913 GAGCCAGAGAGCCGGGGAGCGGG + Intronic
1156498244 18:37540252-37540274 GGGCCAGGGAGCCAGTGGACGGG - Intronic
1157223229 18:45841637-45841659 GTGAGAGGGAGCCAGGCTGCCGG + Intronic
1157557315 18:48621382-48621404 CAGCCAGGAGGCCAGGGTGCTGG + Intronic
1158387457 18:57012021-57012043 GGACCAGGGAGGGAGGCTGCTGG + Intronic
1158836305 18:61334290-61334312 GGACCAGAGAGCCAGGCTCCGGG + Intronic
1158954007 18:62523153-62523175 GGTTCTGGGAGCCCGGGTGCGGG - Exonic
1160007315 18:75076861-75076883 GGGCCCTGGAGCCTGGCTGCTGG - Intergenic
1160201665 18:76801612-76801634 GGGCGAGGGAGGCAGGGAGAGGG - Intronic
1160376941 18:78420771-78420793 GGGCCATGTAGCAAGAGTGCCGG - Intergenic
1160534461 18:79584801-79584823 GGGGCCGGGAGCCAAGCTGCAGG + Intergenic
1160607893 18:80066064-80066086 GGGCCCGGGAGTGAGTGTGCAGG + Intronic
1160699241 19:498130-498152 GGGTCAGAGAGGCAGGGCGCGGG - Intronic
1160734929 19:658149-658171 TGGCCAGGCAGCCAGGGTAGGGG + Intronic
1160749444 19:727097-727119 GGGGCAGGGACCCAGGGTCAGGG + Intronic
1160919260 19:1512209-1512231 GAGCCAGGGAAACAGGGTCCAGG - Intronic
1160921612 19:1523516-1523538 GGGACAGGGACCCAGGAGGCAGG - Intergenic
1161102075 19:2426251-2426273 GAGCCAGTGAGCTAGGGTGGAGG - Exonic
1161223832 19:3133128-3133150 GGGCCCTGGATCCAGGGAGCCGG + Intergenic
1161285044 19:3464395-3464417 GGGCCAGGGAGCCGGGGTGGGGG - Intronic
1161346317 19:3770460-3770482 GGACCAGAGAGACAGGCTGCTGG - Exonic
1161397453 19:4052208-4052230 CGGCCAGGGAGGCAGGGTGGGGG + Intronic
1161400892 19:4065900-4065922 GGGCCAGCCCGCCAGGGGGCGGG - Intronic
1161457002 19:4374612-4374634 GGGCCAGGAGGCCAGGGAGGAGG - Intronic
1161478675 19:4499904-4499926 GTGCCAGGCAGCCAGCATGCAGG + Intronic
1161537903 19:4831361-4831383 CGGGGAGGAAGCCAGGGTGCTGG + Intronic
1161587034 19:5111172-5111194 GGGACAGGGAGCCATGTGGCTGG - Intronic
1162295676 19:9811618-9811640 GGGCCTGGGAGCCAGAGAACAGG + Exonic
1162432064 19:10635079-10635101 GGGCCAGGGTGCCAGGGGCCAGG + Intronic
1163154261 19:15431604-15431626 GAGCCAGGGAGCCAGGGACAGGG + Intronic
1163173548 19:15549253-15549275 GCCCCAGGGAGCCAGCGAGCAGG + Intronic
1163305058 19:16472452-16472474 GGGTGAGGGGGGCAGGGTGCGGG - Intergenic
1163532998 19:17861678-17861700 AAGCCAGGGACCCAGGGAGCGGG + Intronic
1163762779 19:19146317-19146339 CTGCCAGGGGGCCAGGGTGGGGG + Exonic
1163826680 19:19528139-19528161 GGGGCAGGGATCCAGGTGGCCGG - Exonic
1163827372 19:19531121-19531143 AGGCCAGGTAGGCAGAGTGCAGG - Intronic
1163845808 19:19637596-19637618 GAGCCTGGGAGCCTGGGGGCAGG + Intronic
1164607841 19:29612868-29612890 GCACCAGGCAGCCAGAGTGCCGG + Intronic
1164618343 19:29679758-29679780 AGGCCAGGGAGCCAGGCGGGGGG + Intergenic
1164718666 19:30415161-30415183 GGGAGAGGGAGACAGGGGGCAGG - Intronic
1164737489 19:30552663-30552685 GTGCCATAGAGCCAGGGTCCTGG + Intronic
1165762058 19:38327193-38327215 GGGCCTGGTGGCCATGGTGCTGG + Exonic
1165803352 19:38566020-38566042 GGGCCGGGGAGAGAGAGTGCAGG + Intronic
1166106375 19:40600103-40600125 GGCCCCGGGGGCCAGGGGGCCGG + Exonic
1166156118 19:40912501-40912523 GGGCCCTGGATCCAGGGAGCTGG + Intergenic
1166299409 19:41905684-41905706 GGGGCAGGGAGACAGAGAGCTGG - Intronic
1166855555 19:45781252-45781274 GGGCCAGAGGGGCAGGGTGCTGG + Intronic
1167151653 19:47713613-47713635 GGGACAGGGTGGCAGGGAGCAGG - Intronic
1167154586 19:47730281-47730303 GGCCAATGGAGCCAGGGGGCAGG - Intronic
1167244679 19:48365793-48365815 GGAGGTGGGAGCCAGGGTGCTGG - Exonic
1167423196 19:49415649-49415671 GGGCTTCGGGGCCAGGGTGCTGG - Intronic
1167574181 19:50309827-50309849 GGTCCAGGGAGGAAGGGGGCTGG - Exonic
1168155448 19:54471598-54471620 GAGCCAGGGAACCAGGGGTCCGG - Exonic
1168339018 19:55613410-55613432 GGGCCAGGGAGCCAAGAGGAAGG + Intronic
1168642406 19:58038933-58038955 GTGCCAGGCAGCCACGCTGCAGG + Intronic
925114300 2:1365567-1365589 GAGCCAGCGAGCCAGCCTGCCGG - Intronic
925165699 2:1714333-1714355 GAGCGAGTGGGCCAGGGTGCCGG - Intronic
925181478 2:1819827-1819849 GGGGCAGAGAGGCAGGGAGCTGG + Intronic
925194666 2:1913443-1913465 GGGACAGGGAGGAAGGGGGCAGG - Intronic
925312161 2:2892529-2892551 GGGCCAGGGATCCGGAGTGCAGG - Intergenic
925640628 2:5983023-5983045 GGGAAAGGGAGCCAGGGCTCCGG - Intergenic
925741450 2:7008796-7008818 TGGCCAGGGAGCCGGGGCTCTGG + Intronic
925874503 2:8300489-8300511 AGGCCAAGGAGCCAACGTGCAGG + Intergenic
925999785 2:9321441-9321463 GGACCAGGGATCCTGGGTGGGGG - Intronic
926190012 2:10721501-10721523 GGGCCCGAGAGCCGGGGAGCAGG - Intergenic
926337413 2:11875065-11875087 GGGACAGGGGGGCAGGGTGCTGG - Intergenic
926558346 2:14387058-14387080 GGGGAAGAGAGCCAGGGTGATGG + Intergenic
926573975 2:14560007-14560029 TGGCCAGGCACCCATGGTGCTGG - Intergenic
927149261 2:20186346-20186368 GGGAGTGGGAGCCAGGGTGGAGG - Intergenic
927670743 2:25066621-25066643 AGGTCAGAGAGCCAGCGTGCTGG - Intronic
927729931 2:25462277-25462299 GGGACAGGGAGCAAGGGGACGGG + Intronic
927917682 2:26947351-26947373 TGGCCAGTCAGCCAGGGGGCAGG - Exonic
927939203 2:27093136-27093158 GGGGCAGGCTGCCAGGTTGCTGG + Intronic
927971341 2:27307747-27307769 GGGGCACGGAACCAGGGTGGCGG - Exonic
928023899 2:27724269-27724291 CAGGCAGGGAGCCTGGGTGCAGG - Intergenic
928412752 2:31067141-31067163 AGGCCAGGGAGGCTGGGTGATGG - Intronic
928470331 2:31568839-31568861 GGGCCAAGGCGGCAGGGGGCTGG + Intronic
929134971 2:38614981-38615003 GGGGCAGGGGTCAAGGGTGCTGG - Intergenic
929599931 2:43198631-43198653 GGGCCAGGGAGGCTGGGTCAGGG - Intergenic
929605071 2:43228049-43228071 GGCCCAGGGAGCCAGAGTCCAGG + Intergenic
929666002 2:43834295-43834317 GGGGCTGGGACCCAGGCTGCAGG - Intronic
930071294 2:47368951-47368973 GGGCCTGGGGGGAAGGGTGCGGG - Intronic
930724216 2:54666937-54666959 CAGCCAAGGAGCCAGGCTGCCGG - Intronic
930890056 2:56374223-56374245 TGGCCAGTGAGGCTGGGTGCAGG + Intronic
931258273 2:60594328-60594350 GGGCCAGAGAGACAGGGCTCTGG + Intergenic
931258704 2:60598117-60598139 GGTCCAGGCACCCAGGGAGCAGG + Intergenic
931549278 2:63424579-63424601 GGGCCAGAGAGCGAAGCTGCAGG + Intronic
932420436 2:71598344-71598366 GGGACATGGAGCCTGGGTCCTGG - Intronic
932885365 2:75544237-75544259 GCGCTAGGGGGCCAGGGTGATGG - Intronic
933813528 2:86048196-86048218 GGGCCCAGGAGGCAGGGTGAGGG + Intronic
933886129 2:86720465-86720487 GGGCTAGGGCGCCATGGGGCAGG + Exonic
933924052 2:87076241-87076263 GGGCTAGGGCGCCATGGGGCAGG - Intergenic
933994615 2:87659096-87659118 GGGACAGAGAGCCAGGGAACAGG + Intergenic
934525254 2:95047990-95048012 GGGCCAGGGCACCAGGGAGGAGG - Exonic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
934606708 2:95700650-95700672 GATCCACGGAGCCAGGGTGGAGG - Intergenic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
935170794 2:100610310-100610332 GGGACAGGGAGCCACAGGGCGGG + Intergenic
936299241 2:111291817-111291839 GGGACAGAGAGCCAGGGAACAGG - Intergenic
936516762 2:113185913-113185935 GGGGCAGGGGGCCAAGGTGCAGG - Exonic
936540106 2:113342783-113342805 GAGCCACGGAGCCAGGGTGGAGG - Intergenic
937164102 2:119795472-119795494 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
937262428 2:120595166-120595188 GGCTCTGGGAGTCAGGGTGCAGG - Intergenic
937293201 2:120794338-120794360 GGGTCAGGCAGCCAGGGAGCTGG + Intronic
937364793 2:121253760-121253782 GGGCCAGGGATCACGGCTGCAGG + Intronic
937412871 2:121691493-121691515 GGGCCAGAGGGCCAGGAGGCAGG + Intergenic
937915159 2:127095366-127095388 CCGCCAGGGAGGCATGGTGCAGG - Intronic
937958707 2:127438425-127438447 GGGCCATGGAGCCAGGTGGCGGG + Intronic
938114255 2:128592474-128592496 GGGCCAAGAAGCCAGAGAGCAGG + Intergenic
938224680 2:129605831-129605853 GGGCTTGTGAGCCAGGGAGCTGG - Intergenic
938288542 2:130137498-130137520 TGGCCAGGCAGGCAGCGTGCAGG + Intergenic
938427046 2:131201393-131201415 TGGCCAGGCAGGCAGCGTGCAGG - Intronic
938467990 2:131535436-131535458 TGGCCAGGCAGGCAGCGTGCAGG - Intergenic
940293471 2:152099132-152099154 CGGGCAGGGAGCCTGGGCGCCGG - Intergenic
940991241 2:160098824-160098846 GGGCCAGAAGTCCAGGGTGCAGG + Intergenic
941420897 2:165281967-165281989 TGGGCAGGGAGCAGGGGTGCAGG - Intronic
942114417 2:172713525-172713547 GGGCCGAGGAGGCAGGGGGCTGG + Intergenic
942279071 2:174342729-174342751 CGGCCAAGGCGCCTGGGTGCCGG + Intergenic
943129290 2:183837493-183837515 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
944679689 2:202065646-202065668 GTGTCAGGGAGCCTGGGTGTGGG - Intergenic
945655650 2:212619960-212619982 GGGACAGGGTGGCAGGGTGAGGG - Intergenic
946310307 2:218879480-218879502 GGGCCTGAGAGCCAGAGGGCAGG - Intergenic
946391106 2:219417595-219417617 GGGCGGGGGACCCAGGGGGCAGG + Intergenic
946418027 2:219550356-219550378 AGGCCAGGGGACCAGGGTGAGGG - Exonic
947711431 2:232318613-232318635 AGGCCAGCGCGGCAGGGTGCTGG + Intronic
947932272 2:233973881-233973903 GAGCCCTGGAGCCACGGTGCGGG + Intronic
947952722 2:234161903-234161925 GAGACAGGGTGCCAGGGTGTCGG + Intergenic
948027761 2:234791438-234791460 GTGCCCGGGAGGCAGGATGCTGG - Intergenic
948463118 2:238139609-238139631 GGCCCGGGCAGCCACGGTGCAGG - Intronic
948712933 2:239836508-239836530 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
948907590 2:240987109-240987131 GCGCCATGGAGCCAGGGTGTTGG + Intronic
1168841944 20:915273-915295 AGGAGAGGGAGCAAGGGTGCGGG - Intronic
1168852165 20:984514-984536 GCTCCAGGTACCCAGGGTGCTGG - Intronic
1169632407 20:7647782-7647804 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1170226285 20:13995272-13995294 GAGCCAGGGAGCGAGGGGGCTGG - Intronic
1170568200 20:17618345-17618367 GGACCAGGTAGCCAGGGGACGGG + Intronic
1170602789 20:17854432-17854454 TTGTCAGGAAGCCAGGGTGCAGG + Intergenic
1170604297 20:17864081-17864103 AGCCCAGGCAGGCAGGGTGCGGG + Intergenic
1171468945 20:25354364-25354386 GGGGCAGGGAGGCAGGGAGGGGG + Intronic
1172013746 20:31861270-31861292 GGGCGCGGGAGGCAGGGTTCAGG + Exonic
1172184210 20:33021255-33021277 TGGCCACGGAGCCAGGGAGATGG - Intronic
1172271053 20:33656152-33656174 GGCCCAGGGAGCCAGGCTGGTGG + Intergenic
1172299273 20:33837474-33837496 GGGCAAGGGAGCCAGGCTAGGGG + Intronic
1172406700 20:34695056-34695078 GGGCACTGGAGCCAGGCTGCAGG + Intergenic
1172522386 20:35576424-35576446 GGGCAAGGGGGCCAGGATGGAGG - Intergenic
1172693629 20:36807126-36807148 GGGCCAGGGCAGCAGGGTGTGGG + Intronic
1172843580 20:37916285-37916307 GGGGCAGGGAGCCAGGAGCCGGG - Intronic
1173185282 20:40835858-40835880 GCACCTGGGGGCCAGGGTGCTGG - Intergenic
1173207664 20:41007349-41007371 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1173294144 20:41740688-41740710 GGGGCAGGGAGGGAGGGGGCAGG - Intergenic
1173502632 20:43565294-43565316 GGACCAGGGAGGCCGGGTCCTGG + Intronic
1173778820 20:45736225-45736247 GGGACCGGGAGCCATGGAGCAGG - Intergenic
1174049201 20:47755892-47755914 GTGCCAGGGAGCCGGAGTGGAGG - Intronic
1174139667 20:48404073-48404095 GGGGCAGGAAGTCAGGGGGCAGG + Intergenic
1174284128 20:49460247-49460269 GGCCAAGGGAGCCAGGGTAGGGG + Intronic
1174365528 20:50054114-50054136 GGGCCAGGGAGGCAGTGGGATGG + Intergenic
1174418878 20:50386289-50386311 GGACCAGGGTGCCTGGGGGCAGG - Intergenic
1174957797 20:55119749-55119771 AGGCCAGGAAGGGAGGGTGCAGG - Intergenic
1175524600 20:59624825-59624847 GTGAAAGGGAACCAGGGTGCAGG - Intronic
1175604239 20:60299259-60299281 GGACCAGGAATGCAGGGTGCGGG + Intergenic
1175669623 20:60890756-60890778 GGGTCAGGGAGTCAGGGTGGGGG + Intergenic
1175974128 20:62701899-62701921 GGTGCAGGGAGCCGGGATGCAGG + Intergenic
1176033266 20:63024047-63024069 GGGCCAGGGAGGGTGGGGGCCGG - Intergenic
1176061868 20:63176015-63176037 GGGCCAGGGAGGCCGGCTCCCGG - Intergenic
1176191383 20:63811764-63811786 GGGCAGGTGAGCCATGGTGCAGG + Intronic
1176623998 21:9075778-9075800 GCTTCAGGGACCCAGGGTGCTGG + Intergenic
1176740474 21:10596769-10596791 GTGCCATGGGGCCAGGATGCTGG + Intronic
1176860497 21:14009197-14009219 GGGCCTGTGAGGCAGGGTGAAGG + Intergenic
1178915064 21:36701442-36701464 GGGCCGGGGAGCCGCGGGGCTGG - Intronic
1179580493 21:42340340-42340362 GGGGCTGGGAGACAGGGTGCCGG + Intergenic
1179798830 21:43801013-43801035 GGGACAGGGAGGCAGGGCGCAGG + Intronic
1180004117 21:45012100-45012122 GGGGCAGTGAGCCGAGGTGCTGG - Intergenic
1180061484 21:45387415-45387437 AGGCCTGGCAGCCGGGGTGCGGG + Intergenic
1180099096 21:45576076-45576098 GGCCCAGGGGGCCGGGGTGGAGG - Intergenic
1180106000 21:45618544-45618566 GTGGCAGGGTGCCAGGGCGCCGG + Intergenic
1180163285 21:46007388-46007410 GGGCCTGGGGGCCACGGAGCAGG - Intergenic
1180468169 22:15635434-15635456 TGGCCAGGCAGGCAGCGTGCAGG - Intergenic
1180606623 22:17063891-17063913 GGACCAGGGAGCCATCGTGAGGG - Intergenic
1180784139 22:18537473-18537495 GGCCCAGGGATCCTGGGTGTGGG - Intergenic
1180845127 22:18976635-18976657 TGGACCGGGAGACAGGGTGCAGG - Intergenic
1180954855 22:19737021-19737043 TGCCCAGGGGTCCAGGGTGCCGG + Intergenic
1181056338 22:20262109-20262131 TGGACCGGGAGACAGGGTGCAGG + Intronic
1181127707 22:20711522-20711544 GGCCCAGGGATCCTGGGTGTGGG - Intronic
1181167116 22:20989726-20989748 GGCACGGGGAGCCAGGGCGCAGG + Intronic
1181241041 22:21476825-21476847 GGCCCAGGGATCCTGGGTGTGGG - Intergenic
1181309801 22:21938417-21938439 CGGGCAGGGAGCCAGGGCGGAGG + Intronic
1181387775 22:22558032-22558054 GGGAAAGGGAGACAGGGTGGGGG + Intronic
1181387792 22:22558068-22558090 GGGGAAGGGAGACAGGGTGGGGG + Intronic
1181387867 22:22558267-22558289 GGGGAAGGGAGACAGGGTGGGGG + Intronic
1181494027 22:23277890-23277912 GGGCCAGGATGCCAGGAAGCTGG - Intronic
1181501073 22:23315792-23315814 GGCCCTGGGAGACAGGGTGAAGG + Exonic
1181639555 22:24189495-24189517 GGGCTAAGGAGCCTGGGCGCTGG - Intergenic
1181729162 22:24832028-24832050 GAGCCAGGGAGCCAGGATTCCGG - Intronic
1181964746 22:26648413-26648435 GGAGCAGGGAGCCTGGGGGCAGG + Intergenic
1181967482 22:26667063-26667085 TGGCCAGGGAGCCAGGTGGCTGG + Intergenic
1182103052 22:27670954-27670976 GGGCAAGAGAGGCAGGGTCCTGG - Intergenic
1182300641 22:29335011-29335033 GGGCGAGGGAACCTGGGGGCAGG - Intronic
1182316097 22:29448475-29448497 AGGCCAGGGAGGCAGGGCCCAGG - Intergenic
1182445529 22:30387344-30387366 GGGCCAGGGGTCCCGGGCGCGGG + Exonic
1182902648 22:33911186-33911208 GGACCAGGGAGCCTAGGTTCTGG + Intronic
1183271555 22:36865574-36865596 GGACCAGGAGGCCAGGGGGCGGG - Intronic
1183301525 22:37061318-37061340 GGGCCAGGGGGCCTGGGTGGAGG - Intronic
1183324744 22:37185157-37185179 GGGCCAGGGAGCTGAGGTGGAGG - Intronic
1183437663 22:37804880-37804902 GGGCTAGGGAGCCTCGGTGCGGG - Intergenic
1183539970 22:38424097-38424119 GGCCCAGAGAACCAGGGGGCTGG - Intergenic
1183742981 22:39678627-39678649 GGGGCAGGAAGCCAGGGTGCTGG + Intronic
1184054323 22:42034108-42034130 GGGCCAGGGCGGCAGGGGGCTGG + Intronic
1184071706 22:42151094-42151116 GGGCAAGGGAGGAAGGGTACAGG - Intergenic
1184105133 22:42363010-42363032 GGGCCCAGGAGGCAGGTTGCTGG - Intergenic
1184117763 22:42431966-42431988 GGGCCAGGAGGCCAGACTGCTGG + Intronic
1184213560 22:43051490-43051512 GGGCCTGGGGGACAGGGTGCAGG + Intronic
1184271847 22:43388811-43388833 AAGCCAGGGATCCAGGGTGGGGG + Intergenic
1184286093 22:43472488-43472510 GGGTCTGGGATCCAGGCTGCTGG + Intronic
1184291846 22:43501563-43501585 GCGCCAGGGTGCCGAGGTGCTGG + Intronic
1184386834 22:44181464-44181486 AGGCCAGGCTGACAGGGTGCTGG + Intronic
1184390399 22:44200331-44200353 GGTCCAGGCAGGCAGGGAGCTGG - Intronic
1184616080 22:45639672-45639694 GGGCCAGGGAGACAGCGTCTTGG + Intergenic
1184880849 22:47303403-47303425 GGGACAGGCAGCCTGAGTGCAGG - Intergenic
1185093092 22:48786794-48786816 GGGCTGGGGAGCCTGGGAGCGGG - Intronic
1185161961 22:49235536-49235558 AGCCCAGGGAGCCAGGTTCCAGG - Intergenic
1185269004 22:49919621-49919643 GGGCCGGGGAGCCAGGACTCCGG - Intronic
1185385690 22:50530506-50530528 GGGCCAGGTAGTCCGAGTGCCGG + Exonic
1185402317 22:50625510-50625532 GGGCCAGGGATCTAGGGCTCCGG + Intronic
949478022 3:4467133-4467155 GCGGCAGGGAGCCAGGAGGCCGG - Exonic
950107041 3:10394855-10394877 GAGCCAGGGGGCCAGGATGGCGG - Intronic
950995799 3:17494714-17494736 GTGCCAGGGAGACTGGGTTCGGG - Intronic
952809283 3:37387059-37387081 GGGCCAAGGGGCCTGGGGGCTGG - Intronic
952885368 3:38008488-38008510 GGGCCCCTGAGCCAGGGCGCGGG + Exonic
953387281 3:42513751-42513773 CGGCCAGGCGGCCAGGCTGCAGG + Exonic
953404637 3:42654390-42654412 GGGCCAGGCCGCCTGCGTGCCGG - Intronic
953910892 3:46892613-46892635 GGGTCAGAGAGCCTGGCTGCAGG - Intronic
954132159 3:48566415-48566437 GGGCCCAGGGGTCAGGGTGCTGG + Intronic
954149555 3:48650602-48650624 GAGCCAGGCAGTCAGGGTACAGG + Intronic
954318381 3:49813595-49813617 GATTCAGGGAGCCAGGGTCCTGG - Exonic
954613900 3:51959862-51959884 GGGGCAGGGAGAGAGGGGGCAGG - Intronic
954681833 3:52350132-52350154 GGGCCAGGGAGGCACAGGGCTGG + Intronic
954702315 3:52456619-52456641 GGGCCAGGGAGGGGAGGTGCAGG - Intronic
954803669 3:53202526-53202548 GGGCCAGGGTGCCTGGTTGTTGG - Intergenic
957054984 3:75435860-75435882 GAGCGAGGGATCCAGGGTGTGGG + Intergenic
957665399 3:83218755-83218777 GGGCCAAGGCGGCAGGGGGCTGG + Intergenic
958020401 3:87988044-87988066 GGTCCAGGGAGTTAGGGTTCTGG - Intergenic
958548539 3:95588564-95588586 GGGACTGGGCGCCAGGGAGCAGG + Intergenic
959073400 3:101724959-101724981 GAGCGCGGGAGCCAGGGCGCCGG - Intronic
960047485 3:113211959-113211981 GGGCCCGGGGGCCAGCGTGGTGG - Exonic
961004194 3:123393735-123393757 ATGTCAGGGAGGCAGGGTGCAGG - Intronic
961164148 3:124751901-124751923 GGGGCAGGGTGGCAGGGTGGCGG - Intergenic
961446994 3:126985531-126985553 GGACCAGGTAGCCTGGGAGCTGG - Intergenic
961447495 3:126987742-126987764 GGGCCAGGGAGCCTGGGAAGGGG + Intergenic
961453895 3:127014985-127015007 GAGCCAGGGAGCCCTGGAGCTGG - Intronic
961454240 3:127016323-127016345 GGGGCTGGGAGCCAGGGCGAGGG + Intronic
961626127 3:128264913-128264935 GGGCCAGGCAGCCAGAGGGGAGG - Intronic
961657985 3:128453772-128453794 GGGCTTGGGAGCACGGGTGCTGG - Intergenic
961743024 3:129045982-129046004 GGACCCGGGAGCCGGGGTCCAGG + Intergenic
961808097 3:129503495-129503517 GGAACAGGGAGCCAGTGAGCTGG - Intronic
962618322 3:137150668-137150690 GGGCCGGGGAGACAGGATGATGG + Intergenic
962786002 3:138768735-138768757 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
963720068 3:148851877-148851899 GGGCCCTGGAGCCAGGGACCTGG + Intronic
964282181 3:155079503-155079525 GGGCCGGGGAGACGGGGGGCGGG - Intronic
964743236 3:159988766-159988788 AGGCCGGGGACCCAGGGTGGTGG + Exonic
965117917 3:164515331-164515353 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
965220161 3:165918472-165918494 GGGACTGGGCGCCAGGGAGCAGG + Intergenic
966124183 3:176556354-176556376 GGGCCAGGGAGAGAACGTGCTGG + Intergenic
966727110 3:183117742-183117764 TGGTGAGGGAGCCAAGGTGCTGG + Intergenic
966874521 3:184314764-184314786 GGGCCAGGGCGCCGGGGCGGCGG - Intronic
966874526 3:184314772-184314794 GGGCCGCGGGGCCAGGGCGCCGG - Intronic
966879497 3:184342004-184342026 AGGCCAGGGAGCACAGGTGCAGG - Intronic
967829933 3:193909946-193909968 GGGGCAGGCAGCCATGGTGAAGG + Intergenic
968044324 3:195615361-195615383 GGGGCACGGAGCGGGGGTGCAGG + Intergenic
968060109 3:195721420-195721442 GGGGCACGGAGCGGGGGTGCAGG + Intronic
968075271 3:195812723-195812745 GGGAGCTGGAGCCAGGGTGCAGG + Intergenic
968487256 4:868647-868669 GAGCCGTGGAGCCAGGCTGCCGG + Exonic
968505156 4:968052-968074 GGGGGTTGGAGCCAGGGTGCGGG + Intronic
968610006 4:1552609-1552631 GGGCCTGGGAGCCAGTGGCCAGG + Intergenic
968618323 4:1592451-1592473 GGCCGAGGGGGCCAGGGGGCAGG + Intergenic
968619825 4:1599068-1599090 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619846 4:1599134-1599156 GGCCAGGGGATCCAGGGTGCTGG + Intergenic
968619868 4:1599200-1599222 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619887 4:1599266-1599288 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968651053 4:1760478-1760500 GGGCCAGGGGGCCAGGCTGATGG + Intergenic
968747040 4:2365496-2365518 GGGCCAGGGAGGCAGGGCCGGGG - Intronic
968813872 4:2811947-2811969 GGGCCTGACACCCAGGGTGCAGG + Intronic
968872411 4:3248594-3248616 GGCCCAGGGCGCCTGGGGGCTGG + Exonic
968983886 4:3865159-3865181 GGCCCAGGTAGCCACGGTCCAGG + Intergenic
969230481 4:5826933-5826955 GGCCCAGGGAGTCGGGGAGCAGG - Intronic
969263263 4:6046875-6046897 GGGCCAGGGCGCCAGCTGGCAGG - Intronic
969426446 4:7127221-7127243 GGCCCAGGAAGGCAGGGCGCAGG - Intergenic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
969604918 4:8197646-8197668 GGGCCGGGGAGCCTGGAGGCTGG + Intronic
970347766 4:15169996-15170018 GGGCCAGGCTTCCAGGGTGAAGG - Intergenic
971127586 4:23771382-23771404 GGGCCAGGGTGCCGGGGTGAGGG - Intronic
972106406 4:35494220-35494242 GGGCCAGGGAAGCAGAGAGCTGG - Intergenic
972358332 4:38303413-38303435 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
972640905 4:40924047-40924069 GGGTCAGGGAGCCTGGCTTCGGG + Intronic
973759650 4:54104241-54104263 GGGCCTGGGAGCCGGGGGCCGGG - Intronic
975428068 4:74253855-74253877 GGTCCATGGAGCCAGGCTGGTGG - Intronic
976106800 4:81627691-81627713 GAGACAGGGAGCCAGGGAGGGGG + Intronic
978229971 4:106386112-106386134 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
980450081 4:132959036-132959058 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
982281303 4:153685066-153685088 GGGTTAGGGAGCCAGGGTCCTGG - Intergenic
982358240 4:154491809-154491831 GAGGCAGGGAGTCAGGGCGCTGG + Intergenic
983940227 4:173529397-173529419 GGGCCCGGGCGCCCGGGGGCTGG - Exonic
984009445 4:174353334-174353356 GTGCCAGGGAGGCAGGGAGCAGG + Intergenic
984901601 4:184591257-184591279 GGGCCAGGTGGCAAGGGTGAGGG + Intergenic
985679040 5:1246452-1246474 GGGACCTGGAGCCGGGGTGCAGG - Intergenic
985871142 5:2557582-2557604 GAGTCAGGGGGCCAGGATGCAGG + Intergenic
985969867 5:3366387-3366409 GGACCGGGTGGCCAGGGTGCTGG - Intergenic
986236974 5:5919990-5920012 GGGACAGGGAGCTAGGGAACAGG + Intergenic
986342636 5:6804139-6804161 GGAACAGGAAGCCAGGGTTCCGG - Intergenic
986428414 5:7657267-7657289 GGGCTGAGGAGGCAGGGTGCTGG + Intronic
986658715 5:10040267-10040289 GGGCTGGGGAGACAGGGTGATGG - Intergenic
986969107 5:13311311-13311333 AGGCCTGAGAGCCTGGGTGCTGG + Intergenic
988197282 5:28020586-28020608 GTGGCAGGGTGCCAGGGTGAAGG + Intergenic
989105318 5:37857654-37857676 AGGACAGGAAGGCAGGGTGCAGG + Intergenic
990243000 5:53834451-53834473 GGGCCTGGCAGCCAGGGGTCTGG - Intergenic
990616105 5:57510046-57510068 CGGGGAGGGAACCAGGGTGCTGG + Intergenic
991970149 5:72133048-72133070 GGACCATGGACCCAGGGTGGAGG - Intronic
992074929 5:73183701-73183723 GAACCAGGGGGCCAGGGGGCAGG - Intergenic
992527972 5:77630169-77630191 GGGGCAGGGCGCCGGGGTCCGGG + Exonic
994450003 5:99929662-99929684 GGGCCAAGGAGGCAGGAGGCTGG + Intergenic
994498123 5:100538860-100538882 AGGCCAGGGAGCGGGGGTGGGGG + Intronic
994692439 5:103034919-103034941 GGGCCAGAGTGGCAGGGGGCTGG + Intergenic
995611266 5:113913008-113913030 GAGCCAGGGAGCCAGGGCCCAGG - Intergenic
996007725 5:118443353-118443375 AAGCCAGGGAGCAAGGGTGAGGG + Intergenic
996579482 5:125015371-125015393 GGGCCATGCAGCCAGCGTCCAGG + Intergenic
997251009 5:132388560-132388582 AGGGCAGGGAGCCAGGCTTCGGG + Intronic
997431533 5:133844337-133844359 AGGCCAGTGAGACAGGGTGAGGG - Intergenic
997465799 5:134087347-134087369 GAGCCAGGAGGCCTGGGTGCTGG + Intergenic
998062677 5:139131655-139131677 GCCCCAGGGAGCCAGGTTGCTGG - Intronic
998401120 5:141849662-141849684 GGCCTAGGGAGCTAGGGCGCGGG + Intergenic
999698701 5:154208334-154208356 CGGCCAGGAAGCCAGCGTGAAGG - Intronic
1000039506 5:157474544-157474566 GAGTCAGGGAGCCAGTCTGCTGG - Exonic
1001328230 5:170744717-170744739 GGGCCAGGGAGCCAAAGCGGCGG + Intergenic
1001536956 5:172504817-172504839 GGACCAGGGCCCCAGGATGCTGG + Intergenic
1001546182 5:172571721-172571743 TGCCCAGGGGGCCAGGGTTCTGG + Intergenic
1001924530 5:175626766-175626788 GGCCCAGGGAGCTGAGGTGCTGG + Intergenic
1002000340 5:176193475-176193497 GGGCCTGGGTGCCAGGGTTTGGG - Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1002079544 5:176729138-176729160 GGGCCAAGGGGCTGGGGTGCGGG - Intergenic
1002129801 5:177073646-177073668 GGTCAAAGGAGCCAGGTTGCTGG + Intronic
1002184323 5:177447134-177447156 GCGCCAGTGAGCGAGGGAGCCGG + Intronic
1002253996 5:177945509-177945531 GGGCCTGGGTGCCAGGGTTTGGG + Intergenic
1002570258 5:180136097-180136119 GGGCCAGGTGGCCAGGCTGTTGG - Intronic
1002594237 5:180311975-180311997 GGACCAGGGAGGCAGGGAGGTGG + Intronic
1002594251 5:180312007-180312029 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1002594268 5:180312047-180312069 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1002594287 5:180312103-180312125 GGACCAGGGAGGCAGGGAGGCGG + Intronic
1002636746 5:180612444-180612466 GGGCCAGGGACCCAGGGCAGGGG + Intronic
1003325380 6:5086330-5086352 GGGCCTCCGAGCCAGGGTCCGGG + Exonic
1003345186 6:5260585-5260607 GGGCCGGGGACCGGGGGTGCGGG - Intronic
1003493213 6:6641834-6641856 GTGCCAGGAAGCCAGGGTGATGG + Intronic
1003717286 6:8661491-8661513 GGGTCAGGGAGCCAGGGGTTTGG + Intergenic
1003966652 6:11258327-11258349 GAGCCAGCCAGCCAGGGTGCTGG - Intronic
1004370861 6:15051094-15051116 TGGGCAGGGATTCAGGGTGCTGG - Intergenic
1004754795 6:18600080-18600102 TGGCCAGTCAGCCAGGGTGGAGG - Intergenic
1004924440 6:20403621-20403643 AGGCCAGGGAGCCGGCGAGCAGG - Intronic
1005856108 6:29864229-29864251 GCGTCAGGGAGACAGGGAGCGGG + Intergenic
1005941452 6:30563265-30563287 GGGCCAGGGAGGCAGTCTGATGG - Exonic
1005968355 6:30742794-30742816 GGGCCCGAGAGCCAGCGGGCGGG - Intergenic
1006030010 6:31171498-31171520 GTGCCAGGCACCCAGGCTGCGGG - Intronic
1006107954 6:31728110-31728132 GGGCCCGGGAGGCCGGGAGCTGG - Intronic
1006402650 6:33826778-33826800 GAGCCAGGCAGCCTGGGTGGAGG - Intergenic
1006423952 6:33952176-33952198 GGGACAGAGAGCCAGGCTGAGGG + Intergenic
1006463859 6:34179304-34179326 GGGCCAAGGCGGCAGGGGGCTGG + Intergenic
1006512237 6:34527767-34527789 GGGCCAGTGAGCCTGGGGGAAGG - Intronic
1006606338 6:35259991-35260013 GGGGCAGGGACCCTGGGTGGGGG - Intronic
1006677853 6:35776916-35776938 GGTGGAGGGAGCGAGGGTGCTGG - Intronic
1006936577 6:37722999-37723021 GGGGCGGAGAGCCAGGGTGAGGG - Intergenic
1007390270 6:41546574-41546596 GGGTCCGGGAGCCCGGGAGCCGG + Exonic
1007406993 6:41640842-41640864 GGGCTAGGGAGCCAGGCTCCCGG - Intronic
1007423999 6:41735283-41735305 GGGCCAGGGAGCCTGGGTCGGGG + Intronic
1007789048 6:44298378-44298400 GGGAGAGGCAGCCAGGGTGGCGG + Intronic
1007832379 6:44648245-44648267 GAGCCTGGGAGCCACGGAGCTGG - Intergenic
1008010800 6:46465719-46465741 GGGCCAGGGGGCCATGGAGGTGG + Intronic
1009530269 6:64803721-64803743 GGGCCAGGGCGGCAGAGGGCTGG + Intronic
1010162256 6:72870210-72870232 GAGCCAAGGAGCCAAGGAGCAGG - Intronic
1011254630 6:85407828-85407850 GGGCTTGAGAACCAGGGTGCTGG - Intergenic
1011258605 6:85449813-85449835 GGACCAGGGAGCCTGGGCGCCGG - Intronic
1011983805 6:93418500-93418522 GGGCCGTGGAGGCAGGGGGCGGG - Intronic
1012043870 6:94243900-94243922 TGTCCAGGTATCCAGGGTGCAGG - Intergenic
1012142022 6:95636448-95636470 GGGCCAGGGAGCCAGTCCTCTGG - Intergenic
1013164576 6:107578230-107578252 GGGGAAGGGAGGGAGGGTGCGGG - Intronic
1014217718 6:118768552-118768574 GGGCCAGGCAGTCAGATTGCTGG - Intergenic
1015078385 6:129192010-129192032 GGGCCAGGGATCTAGGCTGTAGG + Intronic
1015400005 6:132778091-132778113 GGGCGAGGGACACAAGGTGCAGG + Intronic
1016232873 6:141827692-141827714 GTGTCAGGGAGTCAGGGTGTTGG + Intergenic
1017523891 6:155226146-155226168 GGGGCAGGGAGACAGGGTCCAGG - Intronic
1017587894 6:155947153-155947175 GGGCCAAGGTGGCAGGGTGTTGG - Intergenic
1017690316 6:156957463-156957485 GGTCCTGGCAGCCAGGATGCTGG - Intronic
1017822852 6:158061435-158061457 TGGTCAGGGAGCCAGAGTGAAGG - Intronic
1017884416 6:158587223-158587245 GGGCCAGGCTGCCAGGGTACTGG + Intronic
1018419277 6:163628103-163628125 GCTCCATGGAGTCAGGGTGCTGG - Intergenic
1018798914 6:167207695-167207717 GGGCCAGTGAGGAGGGGTGCTGG + Intergenic
1018813812 6:167316543-167316565 GGTCCAGGAAGCGAGGGTGGTGG - Intergenic
1018847788 6:167567210-167567232 GAGCCAGCCAGACAGGGTGCTGG + Intergenic
1018905045 6:168071116-168071138 GTGGCAGTGAGCAAGGGTGCCGG - Intronic
1018940266 6:168304852-168304874 GAGGCAAGGAGCCAGGGTGCCGG + Intronic
1018941411 6:168310676-168310698 GGGCCAGGGCTGCAGAGTGCAGG - Intronic
1019150602 6:170003139-170003161 GGACCAGAGAGACAGGGTGCAGG - Intergenic
1019301650 7:307220-307242 AGGCCAGGCAGGCAGGGTCCCGG - Intergenic
1019346008 7:531208-531230 GGGCCAGGGTGGCAGGGGGTGGG + Intergenic
1019442878 7:1056260-1056282 GGGCCAGGGAGCCTGGACCCAGG + Intronic
1019504540 7:1384202-1384224 GGCGCAGGGAGCCAGGGGTCAGG + Intergenic
1019504569 7:1384277-1384299 GGCGCAGGGAGCCAGGGGTCAGG + Intergenic
1019564254 7:1671717-1671739 GGGGCAGGGACCCAGGGGGCAGG - Intergenic
1019572734 7:1720482-1720504 GAGCCAGGGAACCAGCGTGCAGG + Intronic
1019608579 7:1923448-1923470 GCGCGGGGGTGCCAGGGTGCCGG - Intronic
1020009418 7:4800122-4800144 GGGCCAGGCAGCCAGTATGGGGG + Intronic
1020070479 7:5223809-5223831 TGGCTTGGGTGCCAGGGTGCTGG - Intronic
1020138410 7:5599115-5599137 GGGGCTGGGTCCCAGGGTGCCGG - Intronic
1020140412 7:5608426-5608448 GGGGCAGGGAGCCAGGGCAGAGG + Intergenic
1020649247 7:10855001-10855023 AAGCCAGGGGGCCAGGCTGCCGG + Intergenic
1021097192 7:16547709-16547731 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1022534009 7:31084649-31084671 TGGCCTGGGAGACTGGGTGCAGG + Intronic
1023805350 7:43869258-43869280 GGGCCTGGGGGCCGGGGGGCCGG - Intronic
1023805356 7:43869266-43869288 GGGCCTGGGGGCCTGGGGGCCGG - Intronic
1023833810 7:44056978-44057000 GGCCCAGCCAGCCCGGGTGCTGG - Intronic
1023847329 7:44129776-44129798 GGGCAAGGGGGCCAGAATGCTGG + Intergenic
1023857038 7:44190183-44190205 GGAGCAGGGGGCCAGGGTGCTGG + Intronic
1024230552 7:47360470-47360492 GAGCCAAGGAGCCAGGGCCCCGG - Intronic
1024355407 7:48409488-48409510 GACACAGGGAGCCAGGGTGGAGG - Intronic
1025252132 7:57358707-57358729 GGGCCAGGGTGCCTGGGGGCAGG + Intergenic
1026573089 7:71548948-71548970 GAGCCAGGAAGCCAGGGAGTGGG + Intronic
1026905757 7:74061912-74061934 GGGCCAGAGAGCTGGGGTGGAGG - Intronic
1027251444 7:76401079-76401101 GGACCAGGGAGCCATGGTGTGGG - Intronic
1027417199 7:77985815-77985837 GGGACAGGGAGACAGGGTGCCGG + Intergenic
1028136704 7:87230388-87230410 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1029423767 7:100484467-100484489 GGGCCAGGGAGCCAGAATCGGGG + Intronic
1029424884 7:100489054-100489076 GGGCCGGGGAGCAAGGCGGCCGG - Exonic
1029458948 7:100684618-100684640 TGGACAGGGAGCGAGGGAGCGGG + Intronic
1029708977 7:102289331-102289353 GGGGCAGGGGGCAAGGGTGGAGG + Intronic
1030721878 7:112881188-112881210 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1030925919 7:115454407-115454429 AGGAAAGGGAGCCAGGGAGCTGG + Intergenic
1032079978 7:128853945-128853967 GGTCAAGGGAGCCAGGGTGAGGG - Intronic
1032085217 7:128880189-128880211 GAGCCTGGGAGCCAGAGTCCTGG - Intronic
1032136063 7:129279391-129279413 TGGCCAGGAAGCCGGGGTGGGGG - Intronic
1032334403 7:131011623-131011645 GGGCCTGGGAGGCTGGGTGTTGG - Intergenic
1032591256 7:133194131-133194153 GGGCCAAGGTGGCAGGGAGCTGG + Intergenic
1033476698 7:141699648-141699670 GTGCCAGGGAGCAGGGGTTCAGG + Intronic
1034422043 7:150995573-150995595 GGGAGAGGGAGGAAGGGTGCAGG - Intronic
1034422184 7:150995926-150995948 GGGAGAGGGAGGAAGGGTGCAGG - Intronic
1034422196 7:150995958-150995980 GGGAGAGGGAGGAAGGGTGCAGG - Intronic
1034422334 7:150996321-150996343 GGGGCAGGGAGGAGGGGTGCAGG - Intronic
1034443863 7:151101773-151101795 GGGGCAGGAAGCCAGGGTCTCGG + Intronic
1034501255 7:151452309-151452331 GGCCCTGGGAGACAGGGAGCGGG + Intergenic
1034513334 7:151553697-151553719 GAGCTAGGGGGCCTGGGTGCAGG + Intergenic
1034534047 7:151715845-151715867 GGGGCAAGGAGCCTTGGTGCGGG + Intronic
1034815910 7:154171696-154171718 GGGCCACGTGGACAGGGTGCTGG + Intronic
1034897285 7:154885792-154885814 GGGCCACGCAGGCAGGGGGCGGG - Intronic
1034901766 7:154912123-154912145 GGGCCAGAGAGACAGGCTTCAGG + Intergenic
1035224061 7:157424063-157424085 GGGCGAGGGCGCCAAGGGGCTGG + Intergenic
1035224787 7:157427092-157427114 GGGCCCGGGAACGAGGGTGGCGG - Intergenic
1035375607 7:158404909-158404931 GGAGCTGGGAGCCAGGGAGCTGG - Intronic
1035424715 7:158762019-158762041 GAGCCTGGGAGCAAGGGTGGGGG - Intronic
1035578497 8:724877-724899 GGGCCAGGCGGCGTGGGTGCAGG - Intronic
1035720292 8:1786176-1786198 TGTCCTGGGAGCCAGGCTGCTGG - Exonic
1035744383 8:1951061-1951083 GGGCCGGGGAGGCCGGGTTCAGG + Intronic
1035891470 8:3348451-3348473 CAGCCAGTGAGCCATGGTGCTGG - Intronic
1036127780 8:6079142-6079164 GAGCCAGGGATGCAGGGGGCGGG + Intergenic
1036417516 8:8564317-8564339 GGGCCACGGAGCCAGGGAGGAGG + Intergenic
1036663820 8:10726121-10726143 GGGCCAGGGAGCCCAGGGGGTGG + Exonic
1037142964 8:15540175-15540197 TGGCGAGGGAGCCAGGCTTCGGG - Intronic
1037888019 8:22605115-22605137 GGGCCCGGGAGCGTGGGAGCAGG + Intronic
1037920353 8:22801430-22801452 GGGCCTGGCAGCCAGGAAGCAGG - Intronic
1038421662 8:27437693-27437715 GAGCCAGGGGACCAGGGTGCTGG - Intronic
1038439110 8:27559315-27559337 CTGCCAGCGAGTCAGGGTGCCGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039458864 8:37726996-37727018 GTGCCAGGGAACGAGGGGGCGGG + Intergenic
1039823307 8:41152879-41152901 GGTCCAGGGAGCCAGGCTAGGGG + Intergenic
1041380299 8:57247915-57247937 ATGCCAGGCTGCCAGGGTGCAGG - Intergenic
1045438660 8:102188852-102188874 GGGCTAGAGAGGCAGGGGGCAGG + Intergenic
1045510011 8:102806697-102806719 GAGCGAGGGAGGAAGGGTGCGGG + Intergenic
1046867256 8:119164720-119164742 GGGTCAGGGAGGCAGTCTGCCGG + Intergenic
1046990651 8:120449126-120449148 GGGAGAGGCAGCCAGGGTGGAGG + Intronic
1047433642 8:124816129-124816151 TGGCCACAGAGCCAGGGAGCTGG + Intergenic
1047489950 8:125366132-125366154 GGGTCAGGGAGAGAGAGTGCTGG - Intronic
1047787326 8:128166566-128166588 GGGCCTGGGAGCAATGCTGCTGG + Intergenic
1048327728 8:133451981-133452003 GGATCAGGGAGCCAGCGTGGTGG + Intergenic
1048421765 8:134284328-134284350 GGGCCAAGGTGGCAGGGTGCTGG + Intergenic
1048836218 8:138521275-138521297 GGGGCAGGCATCTAGGGTGCAGG - Intergenic
1048901023 8:139037942-139037964 GGGCTAGGGAGCCAGACCGCAGG + Intergenic
1048993240 8:139773630-139773652 ATGCCTGGGAGCCAGGGTGGGGG - Intronic
1049140427 8:140949608-140949630 GGGCCAGGGCGGCAGGGGGCTGG - Intronic
1049204842 8:141358896-141358918 GGGCAGGGGGGCCAGGGTGGGGG + Intronic
1049246823 8:141567331-141567353 TGGCCAGGGGGCCAGAGTGCAGG + Intergenic
1049292654 8:141812823-141812845 GGGTCAGGGAGTGAGGGTGCAGG - Intergenic
1049292736 8:141813052-141813074 GGGTCAGGGAGTGAGGGTGCTGG - Intergenic
1049292924 8:141813576-141813598 GGGTCAGGGTGTGAGGGTGCTGG - Intergenic
1049428165 8:142546665-142546687 GGGCCAGGAGGTCAGGGAGCTGG - Intergenic
1049480042 8:142818282-142818304 GGCCCAGGGAGCCGCGGAGCCGG + Intergenic
1049550003 8:143252792-143252814 GGGTGAGGGAGCGAGGGGGCGGG + Intronic
1049624686 8:143614737-143614759 GGGCCGGGGAGCCGGTGGGCAGG - Intronic
1049746905 8:144266798-144266820 GGGGCGGGGGGCCAGGGGGCCGG + Exonic
1049820016 8:144627834-144627856 GGGCAAGGGGTCCAGGGTGCAGG - Intergenic
1049826563 8:144672539-144672561 GCTCCTGGCAGCCAGGGTGCTGG - Intergenic
1049944300 9:579625-579647 GGTCCAGTGAGCCATGGTGGGGG + Intronic
1050483925 9:6114436-6114458 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1050537692 9:6645115-6645137 CGGCCCGGGACCCAGGGTGCGGG + Intronic
1052978700 9:34431147-34431169 TGGCCAGGCAGCTAGGCTGCTGG - Intronic
1053054731 9:34987865-34987887 GGGGCAGGAAGGCAGGGTGAGGG - Intergenic
1053093710 9:35305465-35305487 GAGCTAGCTAGCCAGGGTGCTGG + Intronic
1056168007 9:83957020-83957042 AGGCCAAGGAGCCCGGATGCGGG - Intergenic
1056687422 9:88778111-88778133 GGGTCAGGGGCCCAGGCTGCAGG + Intergenic
1056804622 9:89718896-89718918 GAGCCAGGAAGCCAGTGGGCAGG - Intergenic
1057260599 9:93580948-93580970 GGGGCAGGGAGCCAGTGAGGAGG + Intronic
1057272156 9:93657453-93657475 GTGCCAGGGAGGCAGGGATCAGG + Intronic
1057576639 9:96247523-96247545 GGGCCAGGGGGCCAGGGCAGTGG + Intronic
1057716795 9:97501970-97501992 GGGCTAGGGAGCCCGGGTCTCGG + Intronic
1057814577 9:98285172-98285194 GGGTCAAGGAGCCAGGCTGAGGG - Intergenic
1058510692 9:105713493-105713515 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1059381960 9:113933858-113933880 GGGCAAGGGTGACAGGGTGGTGG + Intronic
1059415445 9:114159469-114159491 GGGCCAGGAAGAGAGGGGGCTGG + Intronic
1060447050 9:123699520-123699542 GGCACAGGGAGCCAGGGTGAGGG - Intronic
1060515557 9:124263623-124263645 GGGCCACGGACCAAGGGTCCCGG - Intronic
1060719775 9:125969149-125969171 GGGCCAGAGAGCCTGTGTGATGG - Intergenic
1060726687 9:126010875-126010897 TGGCCAGAGAGTCAGGGGGCAGG - Intergenic
1060820385 9:126658374-126658396 GGGCCCGGCAGCCAGGGGGAGGG - Intronic
1061046099 9:128165980-128166002 GGCCCAGAGAGGCTGGGTGCTGG + Intergenic
1061220115 9:129245573-129245595 AGTTCAGGGAGCCGGGGTGCGGG - Intergenic
1061283226 9:129609226-129609248 GGGCTAAGGAGCCAGCTTGCAGG + Intronic
1061375731 9:130223187-130223209 GGACCAGGGAGGCAAGGTGTCGG + Intronic
1061537931 9:131260977-131260999 GGGCCAGCGCGCCCGGCTGCGGG - Exonic
1061544859 9:131298768-131298790 TGGCCAGGGAACCAGAGTGCTGG - Intronic
1061626531 9:131843867-131843889 GGGCGGGGGGGCCAGGGAGCAGG - Intergenic
1061801901 9:133117364-133117386 GGGGCAGGGAGCCTGGGCTCTGG - Intronic
1061886523 9:133593758-133593780 GGCCCAGGGAGACAGGCTGTCGG + Intergenic
1061921271 9:133783782-133783804 GGGGCAGGGAGGCAGGCTGGTGG - Intronic
1061934081 9:133847597-133847619 GAGTCAGGGGGCCAGGGTTCCGG - Intronic
1062003007 9:134226210-134226232 GGGGCTGGGAGGCAGGGGGCTGG + Intergenic
1062008078 9:134251548-134251570 GGGGCCGGGAGCCAGGGGCCGGG - Intergenic
1062165451 9:135105259-135105281 CAGCCCGGGAGCCAGGTTGCCGG + Intronic
1062379840 9:136281851-136281873 AGGCCTGGGAGCCAGGAGGCAGG + Intronic
1062427392 9:136512306-136512328 GGGCCAGGCAGCCGGGCTGGAGG - Intronic
1062471943 9:136709989-136710011 GGGCCAGGGGGAGTGGGTGCAGG - Intergenic
1062502432 9:136857268-136857290 GGGCATGGGAGCCAGGCTGGTGG - Exonic
1062533111 9:137010408-137010430 GGGCCAGAGGGGCAGGGTGGGGG - Intronic
1062599765 9:137314590-137314612 GGGACAGGGGGCAAGGGGGCAGG - Intronic
1062656391 9:137606158-137606180 TGCGCCGGGAGCCAGGGTGCGGG - Intronic
1203747181 Un_GL000218v1:46206-46228 GCTTCAGGGACCCAGGGTGCTGG + Intergenic
1203562925 Un_KI270744v1:73274-73296 GCTTCAGGGACCCAGGGTGCTGG - Intergenic
1186578361 X:10790438-10790460 GAGCCAAGCAGCAAGGGTGCTGG - Intronic
1187871301 X:23767130-23767152 GGGCCAGGGTGGCAGGGGGCTGG + Intergenic
1189216315 X:39327788-39327810 GGGCCAGAGGGGCAGGGAGCTGG - Intergenic
1189316602 X:40061349-40061371 GGGCTTTGGAGCCAGGCTGCTGG + Intronic
1189853583 X:45200772-45200794 GGGCCAGCCAGCCAGGGCGGAGG + Exonic
1190055721 X:47180060-47180082 GGGCCGGGCAGCCAGGGTCCCGG + Intronic
1190137093 X:47807277-47807299 GGGCCGGGGACCCAGTGAGCTGG + Intergenic
1190303269 X:49068326-49068348 GAGCCTTGAAGCCAGGGTGCCGG + Intronic
1192169698 X:68846670-68846692 GGCCCAGGCAGCCTGGGTGGGGG - Intergenic
1192186800 X:68952448-68952470 GGGACTGGGAGCCGGGGAGCAGG - Intergenic
1192223835 X:69215303-69215325 GGGACAGGGAGCAAGGGTCAGGG - Intergenic
1194268725 X:91783336-91783358 AGGCCAAGGAGCCAGGGGGAAGG - Intronic
1194774403 X:97944658-97944680 GGGGCAGGGGGCAAGGTTGCTGG - Intergenic
1195379251 X:104255317-104255339 GGGCGAGGGGGCGAGGGGGCGGG + Intergenic
1196736707 X:118986830-118986852 GGGGGAGGGAGCCAGCTTGCAGG - Intronic
1196819626 X:119692702-119692724 AGGCCAGGGTGCCAGGGACCCGG + Intronic
1198099875 X:133414629-133414651 GAGCCAGGCAGCCCGGGCGCAGG - Intronic
1199248329 X:145631831-145631853 TGGCCAGGGAGCAAGGCTGCTGG + Intergenic
1199665644 X:150094513-150094535 AGGCCCGGGAGCCAGGTGGCAGG + Intergenic
1200047345 X:153409922-153409944 GGGCCATGGAGGCAGGGGGCGGG - Intergenic
1200060691 X:153482476-153482498 GGGGCAGGGACCGAGGGGGCAGG + Intronic
1200102260 X:153694034-153694056 GGGACAGGGAGCCAGGAGGGGGG + Intronic
1200115026 X:153766155-153766177 GGGCAAGGCAGCGGGGGTGCTGG - Exonic
1200247581 X:154534301-154534323 GGGCCGGGGGACCAGGGTGGGGG - Intronic
1200272975 X:154704246-154704268 GGGAAAGGTAGCCAGGGTGGGGG + Intronic
1200585927 Y:5004252-5004274 AGGCCAAGGAGCCAGGGGGAAGG - Intronic
1201160502 Y:11161201-11161223 GCTTCAGGGACCCAGGGTGCTGG + Intergenic
1201285695 Y:12376857-12376879 GAGCCTGGGAGACAGGTTGCGGG - Intergenic