ID: 969472228

View in Genome Browser
Species Human (GRCh38)
Location 4:7395738-7395760
Sequence TCCTGGGCCCCCAAGCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969472228 Original CRISPR TCCTGGGCCCCCAAGCATCT TGG Intronic
900032223 1:380370-380392 TCCTGGGCCCCCTCGGTTCTTGG - Intergenic
900052775 1:608556-608578 TCCTGGGCCCCCTCGGTTCTTGG - Intergenic
900232648 1:1568806-1568828 TCCTGGCCTCCCAAGTAGCTGGG - Intronic
900376756 1:2358328-2358350 CGCTCGGCCCCCAAGCCTCTGGG - Intronic
900850108 1:5136094-5136116 CCCTGGGACTCCAAGCTTCTAGG - Intergenic
901403731 1:9032157-9032179 TCCTGGGTCCCCAAGAGTGTGGG + Intergenic
902421066 1:16280658-16280680 TCCTCAGCCCCCAAGAAGCTGGG - Intronic
903038084 1:20507839-20507861 TCATGGGCTCCCCAGCACCTGGG + Intronic
903378383 1:22880501-22880523 TCCTGGGACCACAAAAATCTCGG + Intronic
903463009 1:23532050-23532072 TGCTGTGCCCCCAGGCAGCTTGG - Intergenic
903629846 1:24759836-24759858 GCCTCAGCCCCCAAGCAACTGGG - Intronic
904173096 1:28605739-28605761 TCCTGGCCTCCCAAGTAGCTGGG + Intronic
904365791 1:30010293-30010315 TCCTGGGCCCCCAAGAGTGCAGG + Intergenic
904460942 1:30679512-30679534 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
904648797 1:31988490-31988512 ACCTCGGCCCCCAAGTAGCTGGG - Intergenic
904743142 1:32694111-32694133 GCCTTAGCCCCCAAGCAGCTGGG - Intronic
905886954 1:41496666-41496688 TCCTGGCCGCCCAAGCCCCTGGG + Intergenic
906097587 1:43234736-43234758 TACTGGGCCCCCAGACACCTGGG - Intronic
906167697 1:43699345-43699367 TCTTGGGCCCCCAAACCACTGGG + Intronic
906815760 1:48876581-48876603 CCATGGGCCCCACAGCATCTAGG + Intronic
907029474 1:51156611-51156633 GCCTCAGCCCCCAAGTATCTGGG - Intergenic
907482445 1:54754523-54754545 TCCAGGGCCCCCAAGCTACAGGG + Intergenic
907946075 1:59137859-59137881 TCCTGGGCCCACATCCCTCTAGG + Intergenic
911617283 1:100028440-100028462 GCCTCGGCCCCCAAGCAGCTGGG + Intergenic
915492622 1:156259642-156259664 GCCTCGGCCCCCAAGTAGCTGGG + Intronic
915601812 1:156927344-156927366 TCCTTGTCCCCCTACCATCTCGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917239949 1:172937599-172937621 GCCTCAGCCCCCAAGTATCTGGG + Intergenic
918243550 1:182640487-182640509 TCCTGGGTCCTCAAGCATCAGGG - Intergenic
919632805 1:199975393-199975415 GCCTCAGCCCCCAAGCAGCTGGG - Intergenic
920293223 1:204938834-204938856 TCCCGGGCCCTCAATCTTCTAGG - Intronic
921011400 1:211145500-211145522 TCCTGGCCTCCCAAGTAGCTGGG + Intergenic
921057369 1:211553445-211553467 GCCTGGGACCCCAAGTAACTGGG - Intergenic
923464407 1:234235393-234235415 TCCTGGACCACCTAGCATCTAGG + Intronic
1063707973 10:8449360-8449382 TCTTGGCCTCCCAAGCAGCTGGG - Intergenic
1065708812 10:28495590-28495612 TCCTGGGCACACCAGCAGCTAGG + Intergenic
1065976811 10:30849010-30849032 TCCTAGGCCCCCAAGCATCTGGG + Exonic
1066231491 10:33439184-33439206 TCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1068749643 10:60577287-60577309 TCCTGGGGCCCTAAACTTCTAGG + Intronic
1069012069 10:63385551-63385573 CCATGGCCTCCCAAGCATCTGGG + Intronic
1069214718 10:65804744-65804766 GCCTCGGCCCCCAAGTAGCTGGG - Intergenic
1069628598 10:69883249-69883271 TGCTGGGCCAGCCAGCATCTTGG - Intronic
1069917657 10:71797326-71797348 TCCTGGCCCCCAGAGCAACTGGG - Intronic
1071736823 10:88310099-88310121 TCCTCAGCCCCCAAGTAGCTGGG - Intronic
1071819524 10:89265238-89265260 TCCTGGGCCCCCAAACTGCAGGG + Intronic
1073670303 10:105580085-105580107 TCCTTGGCCCCCAAGAATGCAGG + Intergenic
1074537652 10:114340226-114340248 TCCTGGGCTCCCAAGTAGCTGGG - Intronic
1074991637 10:118713308-118713330 TCCTGGGCCCCCAAGAATGCAGG + Intronic
1075071968 10:119325667-119325689 CCCTGAGCCCACCAGCATCTGGG - Intronic
1076209449 10:128628758-128628780 TCATGGGCCCAGAGGCATCTGGG - Intergenic
1076245587 10:128945190-128945212 CCCTGGGATCCCCAGCATCTGGG + Intergenic
1076567346 10:131407714-131407736 TCCTGGGCCCCAGAGTAGCTGGG - Intergenic
1076655251 10:132019529-132019551 TCCTGGGCCCCCAAGAGTGCAGG + Intergenic
1077554121 11:3217853-3217875 TCCTGGTCCTGAAAGCATCTGGG + Intergenic
1077938760 11:6817979-6818001 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
1078201032 11:9183526-9183548 TCCTGGGCTGCCAAGTAGCTTGG + Intronic
1078583876 11:12563084-12563106 CCTTGGCCCCCCAAGTATCTAGG + Intergenic
1078626637 11:12964160-12964182 TCTTGGGCGCCCAAGCTCCTTGG + Intergenic
1079659486 11:23020939-23020961 TCTTGGGCCACCAAGAAACTAGG - Intergenic
1082641726 11:55669292-55669314 TCCTCAGCCCCTATGCATCTAGG + Intergenic
1083327279 11:61879246-61879268 ACGTGGGCCCCCATGCATCTGGG - Intronic
1083782364 11:64925045-64925067 TCCTGGCCCCCCAAACCTCATGG - Intronic
1084162262 11:67356305-67356327 TCCTGGACCCCCAGGACTCTGGG - Intronic
1085257157 11:75181650-75181672 TGCTGGGCCCCCAGGGATCCAGG - Intronic
1088298762 11:108331514-108331536 TCCTAGGCCTCCCATCATCTTGG - Exonic
1088583811 11:111341008-111341030 TCCTCAGCCCCCAAGAAGCTGGG - Intergenic
1088914412 11:114216546-114216568 CTCTGGGCCCCAAAGCAGCTGGG - Intronic
1089314500 11:117582381-117582403 TACTGGGTCTCCAAGGATCTTGG + Intronic
1089759902 11:120715674-120715696 TCCTGTGGCCCCAAACCTCTGGG + Intronic
1089867690 11:121646251-121646273 ACCTCGGCCCCCAAGTAGCTGGG - Intergenic
1090813930 11:130273773-130273795 TGCCTGGCCCCCAAGCATTTTGG - Intronic
1091317499 11:134624785-134624807 TCCTGGCTTCCCAAGCCTCTTGG + Intergenic
1091344217 11:134842158-134842180 TCCTTGGCTCCCAAGCCACTGGG + Intergenic
1092058787 12:5530746-5530768 TCCTGGGACCAAAAGCATTTTGG + Intergenic
1092219674 12:6704275-6704297 ACCTCAGCCCCCAAGTATCTGGG + Intergenic
1093392169 12:18636345-18636367 GCCTCAGCCCCCAAGCAGCTGGG + Intronic
1095145382 12:38720966-38720988 TCCTGGGCCCCCAAGGGTACAGG - Intronic
1095738867 12:45586253-45586275 TGCCCGGCCCCCAACCATCTGGG - Intergenic
1095738897 12:45586372-45586394 TGCCCGGCCCCCAACCATCTGGG - Intergenic
1096843050 12:54390800-54390822 TCCTGGGCCCAGAAGGATGTCGG + Intronic
1097130978 12:56810515-56810537 TCCTGGGCCCCCAAGAGTGCAGG + Intergenic
1097171820 12:57119077-57119099 CCCTGTGCAGCCAAGCATCTTGG + Intronic
1097735281 12:63175586-63175608 TTCTGAGCCTCCAAGCCTCTAGG - Intergenic
1097756141 12:63408606-63408628 TCCTGGGCCCCCAGTCATCCAGG + Intergenic
1100672897 12:96835642-96835664 TCCCGGGCCCCCAAGAATGTAGG + Intronic
1101064395 12:101004347-101004369 TGCTGGGCCCTCAAGGATATGGG + Intronic
1101178299 12:102180625-102180647 TCCTGGGCTCCCAAGTAGCTGGG - Intronic
1101771723 12:107758363-107758385 ACCTCAGCCCCCAAGCAGCTGGG + Intronic
1103679614 12:122682885-122682907 TCCTGGGCTCCCAAAGTTCTGGG - Intergenic
1104535250 12:129612398-129612420 TCTTGGTCCCCCAAGCGTCCAGG - Intronic
1104966561 12:132511112-132511134 TCCAGGGCCCCCAAGCTACAGGG + Intronic
1106415290 13:29541165-29541187 ACCTGGGCCTCCTAACATCTGGG - Intronic
1110209755 13:72957690-72957712 TCCTGGCCTCCCAAGTAGCTGGG - Intronic
1110325416 13:74208722-74208744 TCTTAGCCTCCCAAGCATCTGGG - Intergenic
1112495299 13:99899245-99899267 TCCAGGGCCCCCCACCATTTTGG + Intergenic
1113950768 13:114069852-114069874 TCCTGGCCCCCCAAGTCTCCCGG - Intronic
1117233045 14:53741907-53741929 ACATGGACCCCCAAGGATCTGGG + Intergenic
1119226189 14:72946277-72946299 CCCCGAGCCCCCAAGCAGCTGGG - Intronic
1119768338 14:77204960-77204982 TCCTGTGCCTCTGAGCATCTTGG - Intronic
1121714939 14:96067120-96067142 TTCTGGGCACCCCAGCACCTGGG - Intronic
1121762101 14:96454597-96454619 GCCTGGGCCACCAAGTAGCTGGG + Intronic
1122237485 14:100340137-100340159 TCCTGGGACACCAGGCTTCTGGG + Intronic
1122381926 14:101313871-101313893 TCCTGTGCCCCCAACAAACTGGG - Intergenic
1123027670 14:105435398-105435420 GCCTTAGCCCCCAAGCAGCTGGG + Intronic
1123122184 14:105921807-105921829 TCCAGAGCCCCCAAGCATCACGG - Intronic
1123404848 15:20013372-20013394 TCCAGAGCCACCAAGCATCACGG - Intergenic
1123514179 15:21020020-21020042 TCCAGAGCCACCAAGCATCACGG - Intergenic
1124195611 15:27624127-27624149 TCATGGGCCCCACAGCAGCTGGG - Intergenic
1124570171 15:30855812-30855834 TCCTGGGAACCCAAACATCCTGG - Intergenic
1125021133 15:34988098-34988120 TCTTGGGTCCCCAGGCACCTTGG + Exonic
1125925281 15:43558170-43558192 TCCTAGCCTCCCAAGCAGCTGGG + Intronic
1126695891 15:51325101-51325123 TTCTGGCCTCCCAAGCAGCTGGG - Intronic
1126852530 15:52805870-52805892 TCCTGGGTCCCCACGCGTCGGGG - Intergenic
1128480775 15:68036225-68036247 TTCTGGGCCCTCAAGGCTCTGGG - Intergenic
1128790766 15:70432001-70432023 TCCTGGGTCCCCAAGGGTGTAGG + Intergenic
1129616002 15:77099055-77099077 TCCAAGGCCCCCATGCTTCTGGG + Intergenic
1129771449 15:78205893-78205915 CCCAGGGCTCCCAAGCTTCTAGG + Intronic
1130562911 15:84972617-84972639 TCCTAGGCCCCCTTGCATCAGGG + Intergenic
1132347539 15:101117450-101117472 TCCTGGTGCCCCAGGCACCTGGG + Intergenic
1132640594 16:976530-976552 CCCTGGGGCCCCAAGCAGCCAGG - Intronic
1132888038 16:2191026-2191048 TCCTGGGGCCCCCCGCATCCTGG + Intronic
1133771968 16:8871911-8871933 TCTTGGGCTCCCAAGTAGCTGGG - Intergenic
1134506532 16:14812245-14812267 TCCTGGCCTCCCAAGTAGCTGGG + Intronic
1134515090 16:14880505-14880527 TCCTGGCCTCCCAAGTAGCTGGG + Intronic
1134574023 16:15316576-15316598 TCCTGGCCTCCCAAGTAGCTGGG - Intergenic
1134702766 16:16279152-16279174 TCCTGGCCTCCCAAGTAGCTGGG + Intronic
1134728395 16:16439741-16439763 TCCTGGCCTCCCAAGTAGCTGGG + Intergenic
1134939046 16:18272177-18272199 TCCTGGCCTCCCAAGTAGCTGGG - Intergenic
1134964777 16:18432963-18432985 TCCTGGCCTCCCAAGTAGCTGGG - Intronic
1134969064 16:18515498-18515520 TCCTGGCCTCCCAAGTAGCTGGG - Intronic
1138878251 16:60979260-60979282 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
1139849360 16:69941281-69941303 GCCTGGGCCCCCAGGATTCTAGG + Exonic
1141429673 16:83965195-83965217 TCCTGGGCCCCACAGCTGCTGGG - Exonic
1141444666 16:84050169-84050191 CCCAAGGCCCCCCAGCATCTGGG + Intergenic
1141465885 16:84205586-84205608 TCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1141578577 16:84981756-84981778 TACATGGCCCCCGAGCATCTGGG - Intronic
1141804984 16:86336446-86336468 GCCTGGGCCCCCAAGCCACAGGG + Intergenic
1142193460 16:88728482-88728504 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193494 16:88728652-88728674 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193578 16:88729077-88729099 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193597 16:88729162-88729184 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193616 16:88729247-88729269 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193635 16:88729332-88729354 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193669 16:88729502-88729524 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193688 16:88729587-88729609 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193708 16:88729673-88729695 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193725 16:88729758-88729780 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142193744 16:88729843-88729865 TCCTGGGTTCCCCAGCATCGAGG - Intronic
1142548720 17:724170-724192 TCCTGGGCTCCTAAGTAGCTGGG + Intergenic
1142751661 17:1992246-1992268 TCCTGCCCCCCCAAGTAGCTGGG - Intronic
1143395280 17:6589664-6589686 TCCAGGGCCCAAAAGCATATGGG + Intronic
1143770977 17:9168705-9168727 TCCTGGGCCCCCACCCTTCTTGG + Intronic
1144183660 17:12775578-12775600 TTCTGGGAACCCAAGCATCTTGG + Intergenic
1148084849 17:44987883-44987905 TCCTCTGCCCCCCAGCATCCAGG - Intergenic
1148346893 17:46909141-46909163 TCCCGGGCTCCCAAGTAACTGGG + Intergenic
1148865325 17:50625334-50625356 GCCTGCTCCCCCAAGCATGTGGG - Intronic
1149085397 17:52710066-52710088 TCCTGGGCCCCCAAGGGTGCAGG - Intergenic
1149523770 17:57338563-57338585 TTCAGGGTCCCCAAGCAACTGGG - Intronic
1150054826 17:62005008-62005030 TCCTTAGCCTCCAAGTATCTGGG + Intronic
1150689981 17:67356893-67356915 ACCTCAGCCCCCAAGCAGCTGGG - Intronic
1151193663 17:72416527-72416549 TCCTGGGCTCCCAGGCATGCTGG + Intergenic
1151625945 17:75275854-75275876 GCCTTGGCCTCCAAGCAGCTGGG - Intronic
1151742090 17:75990159-75990181 TCTTGGCCTCCCAAGTATCTGGG + Intronic
1151780863 17:76244335-76244357 TGCAGGGCCCCAAAGCATTTAGG - Intergenic
1152686606 17:81696769-81696791 TCCTCAGCCCACAAGCCTCTGGG - Intronic
1153791854 18:8586304-8586326 TCCTGGGCCCCCTACCACATGGG - Intergenic
1156027767 18:32675245-32675267 TCCTAGCCTCCCAAGCAGCTGGG - Intronic
1157131360 18:45010228-45010250 TCCTGGACCCAAAAGCATGTTGG + Intronic
1157170414 18:45399550-45399572 TCCTTGGCCCACAAGAACCTGGG + Intronic
1158735708 18:60076016-60076038 TCTTGGGCCTCCAGGCAACTTGG - Intergenic
1161809823 19:6465256-6465278 CCCTGGGCCCTTAAGGATCTGGG - Intronic
1162673897 19:12283895-12283917 TCCTGGGCTCCCAAGTAGCTGGG - Intronic
1162719647 19:12654787-12654809 TCCTCAGCCCCCAAGTAGCTGGG + Intronic
1162742012 19:12778769-12778791 TCCTGGCTCCCCGAACATCTGGG - Intronic
1163099144 19:15083055-15083077 CCTTGGCCCCCCAAGCAGCTGGG + Intergenic
1163369801 19:16895840-16895862 TGCTGGTCCCCCCAGCATTTCGG + Intronic
1163445187 19:17341725-17341747 TCCTGGGTCTCCACGCAGCTTGG - Exonic
1165245941 19:34498372-34498394 TTCCGGGCCCCCCAGCAGCTTGG + Intronic
1166196392 19:41208534-41208556 GCCTCGGCCTCCAAGCAGCTGGG + Intergenic
1166569624 19:43785239-43785261 TGCTGGGCCCCGAGGCACCTGGG - Intergenic
1167113316 19:47474493-47474515 CCCTGGGCCCCCAACCCCCTAGG + Intergenic
1168657723 19:58143112-58143134 TCCTGGGCTACCAAGTAGCTGGG - Exonic
925684136 2:6453638-6453660 GCCTGAGCCTCCAAGTATCTGGG - Intergenic
926125189 2:10267632-10267654 TCCTGGGCCCCCCAGCTCCCAGG - Intergenic
927174648 2:20397062-20397084 TTCTGTGACCCCAAGGATCTGGG + Intergenic
928596255 2:32861917-32861939 TCCTGGACCCCCAAGCAAAGGGG - Intergenic
929492359 2:42407907-42407929 TTCTGGGCCCCCAAGAGTGTAGG - Intronic
930967567 2:57349587-57349609 TCTTGGGACCCCAGACATCTTGG - Intergenic
931455303 2:62405370-62405392 TTTTGGTCCCCCAAGAATCTAGG + Intergenic
937388180 2:121456400-121456422 TCCTGGGCTTCCAAGTAGCTGGG - Intronic
937917196 2:127105199-127105221 TCCTGGCTCCCCAAGGCTCTTGG - Intronic
937989861 2:127656317-127656339 TCCTGGTCCCCCCAGCCTCCTGG + Intronic
938068354 2:128293655-128293677 CCGTGGGCCCCAAAGAATCTGGG - Intronic
941440483 2:165529043-165529065 TCCTGGGCCCCCAAGAATGCAGG - Intronic
941931531 2:170945419-170945441 TCCTGGCCTCCCAAGCAGCTGGG - Intronic
943666974 2:190619260-190619282 GCCTCAGCCCCCAAGCAGCTGGG - Intergenic
943669147 2:190642181-190642203 TCCTGGGAACCTAACCATCTCGG + Intergenic
944151454 2:196562926-196562948 ACCTTGGCCTCCAAGCAGCTGGG - Intronic
947408517 2:229808080-229808102 TCTTGGCCTCCCAAGCAGCTGGG + Intronic
948364260 2:237444504-237444526 TCCTGCGCCCCTCACCATCTGGG + Intergenic
949049882 2:241891866-241891888 CCCTGGAGCCCCAAGCAGCTCGG + Intergenic
1171493263 20:25537196-25537218 ACCTCAGCCCCCAAGCAGCTGGG + Intronic
1175094030 20:56527708-56527730 CCCTGAGGCCCCAGGCATCTGGG - Intergenic
1175797472 20:61780995-61781017 TCCGGGGCAGCCAAGGATCTGGG - Intronic
1175851870 20:62098037-62098059 CCCTGGGCTCCCACGGATCTGGG - Intergenic
1177396154 21:20538357-20538379 TCCTGGGCCCCCAAGAGTACAGG + Intergenic
1178488690 21:33034286-33034308 TCCTTGGACCGCAAGCATCCTGG + Intergenic
1178760809 21:35401005-35401027 TCCTGGTCCACCAAACACCTCGG - Intronic
1180954420 22:19735292-19735314 CCCTGGGTCCCCAGGCCTCTGGG + Intergenic
1181356821 22:22302272-22302294 TCCTGGGCCCCCAAAGTGCTGGG + Intergenic
1183681977 22:39336844-39336866 GCCTCGGCTCCCAAGTATCTGGG - Intergenic
1184152306 22:42646243-42646265 TCCTGGGCCCCCAGGTGGCTGGG - Intronic
949312437 3:2714850-2714872 TCCTTGGCCCCCAAAGCTCTGGG + Intronic
950023893 3:9807930-9807952 TCCTGGACCTCCAAGCCTCAAGG - Intronic
950648754 3:14394000-14394022 TGCTGGGCCTCCAAGCATTCCGG - Intergenic
952269453 3:31817406-31817428 TCCTGGGCCCCCAAGGATGCAGG + Intronic
955116603 3:56011389-56011411 ACCTGGGCCACCTTGCATCTCGG - Intronic
955303721 3:57809226-57809248 TCCTGGGCCCCCAAGAGTGCAGG - Intronic
958762886 3:98329294-98329316 TCCTGGCGCCCCAAGGATGTGGG + Intergenic
959389823 3:105759758-105759780 TCCTGGGCCCCCAAGAGTATAGG + Intronic
960054865 3:113269963-113269985 TCCTGGACACCCCAGCAACTCGG - Intronic
961017530 3:123479375-123479397 TCCTGGGCCCCTGAGCGCCTGGG + Intergenic
961306337 3:125960781-125960803 TCCAGGGCCCCCAAGCTACAGGG + Intergenic
961398574 3:126616594-126616616 TGCTGGGCCCCAGAGCAGCTGGG + Intronic
961661800 3:128473003-128473025 TCCTGGGCCTCCCAGCCTCCAGG - Intergenic
962105333 3:132383339-132383361 TCCTGGGCCCCCAGGAATTCAGG + Intergenic
964473671 3:157079579-157079601 TCCTGGGCTCCTGAGCAACTGGG - Intergenic
965005580 3:163018909-163018931 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
965261266 3:166489281-166489303 TCCTGGGCCCCCCAGAATGCAGG - Intergenic
968084967 3:195870125-195870147 TCCCGGCCCCCCCAGCATCTAGG - Exonic
968652063 4:1764041-1764063 TCCTCTGCCCCCAACCATCCTGG - Intergenic
968928970 4:3566020-3566042 TCCTGGCAACCCAAGCTTCTGGG - Intergenic
968959428 4:3735407-3735429 TCCTGGGCCACCCAGCCCCTGGG - Intergenic
968984523 4:3867871-3867893 TCCAGGGGCCCCCAGCATCATGG + Intergenic
969251074 4:5969272-5969294 GCCTGGGCCTCCAAGGATCCAGG - Intronic
969432135 4:7161536-7161558 TCCTGGGCTCCCAAACTGCTGGG + Intergenic
969472228 4:7395738-7395760 TCCTGGGCCCCCAAGCATCTTGG + Intronic
971036087 4:22694201-22694223 TCATGGACCCCCAAGTCTCTAGG - Intergenic
971257621 4:25029509-25029531 GACTGGGCACCCAGGCATCTTGG + Intronic
971296022 4:25392787-25392809 TCCAGGTCACCCAAACATCTTGG - Intronic
972358360 4:38303599-38303621 TCCTGGGCCCCCAAGAGTACAGG + Intergenic
972519794 4:39843033-39843055 TCCTGAGCTCCCAAGTAGCTGGG + Intronic
975387326 4:73772832-73772854 TCCTGGGCCCCCAAACATACAGG + Intergenic
975640983 4:76500182-76500204 TCCTGGGTCCCCGAGCAGCAGGG - Intronic
977471794 4:97452193-97452215 TCCTGGGCCCCCAGGTGTGTAGG - Intronic
977791729 4:101112893-101112915 TCCTGGGCACACAAGTGTCTAGG - Intronic
980775167 4:137427791-137427813 CCCTGGGCTCCCAAACTTCTGGG - Intergenic
984418288 4:179487924-179487946 TCCTGGCCTCCCAAGTCTCTGGG + Intergenic
984629493 4:182045930-182045952 TCCTGGCCTCCCAAGCAGCTGGG - Intergenic
986561536 5:9065248-9065270 TGCTGGGCCTCCAGGCATCCAGG + Intronic
990585778 5:57209414-57209436 TCCCAGGCTCCCAAGTATCTGGG + Intronic
990601784 5:57366545-57366567 TCCTGGGCCCCCAGGCATGATGG + Intergenic
993862708 5:93155802-93155824 TCCTGGCCTTCCAAGCATCTAGG - Intergenic
997960348 5:138316173-138316195 TCCTGGGCCCCCAAGGGTGCAGG - Intronic
998872930 5:146570572-146570594 CCATGGGTCCCCAAGCCTCTGGG - Intergenic
999404698 5:151296611-151296633 ACCTTGGCCCTCAATCATCTTGG - Intronic
1001492949 5:172168538-172168560 TCCTGAGCCCGCAAGGACCTGGG - Intronic
1001581191 5:172799667-172799689 TCCTGGGACCCCCAACATTTAGG - Intergenic
1002335927 5:178478267-178478289 TCCTGACCCTCCAGGCATCTTGG - Intronic
1002741597 5:181438498-181438520 TCCTGGGCCCCCTCGGTTCTTGG + Intergenic
1004720940 6:18266629-18266651 TCCTGGGCCCCCAAGAGTGCAGG + Intergenic
1006397474 6:33796637-33796659 CCCTGAGCCCCCAAGCGTCTAGG - Intronic
1006866750 6:37214816-37214838 TCCTGGGCCCTCCAGGTTCTAGG - Intronic
1008953373 6:57186017-57186039 ACCAGGGACCCCAAGCAGCTTGG - Exonic
1013173360 6:107657346-107657368 CCCTGGGACCCCAAGGCTCTTGG + Intronic
1014227247 6:118862182-118862204 TCCTGGGCCCCCAAGAGTGCAGG + Intronic
1015543664 6:134341105-134341127 TCCTGGACCCCCACGTAGCTGGG + Intergenic
1016163408 6:140908631-140908653 TCCTGGGCCCCCAAGAGTGTGGG + Intergenic
1017609347 6:156168040-156168062 GCCTAGGCCCCCAAGCACCCAGG + Intergenic
1017771517 6:157648556-157648578 TGCTGGGCTCCCAAGTTTCTAGG - Intronic
1018503136 6:164434095-164434117 TACTGGGCCCCCAATTAACTTGG + Intergenic
1018805269 6:167254468-167254490 GGCTGGGCCCCCAAGTCTCTGGG + Intergenic
1019246735 6:170714263-170714285 TCCTGGGCCCCCTCGGTTCTTGG + Intergenic
1019353941 7:569429-569451 TCCCCGGCCCCCAAGCTGCTGGG + Intronic
1019710461 7:2516042-2516064 CCATGGGCCCCCTGGCATCTGGG + Intronic
1020560670 7:9726704-9726726 TCCTGGACCCCCGAGGCTCTCGG + Intergenic
1022085860 7:27066876-27066898 ACCTGGACCCCCAAATATCTAGG - Intergenic
1023630840 7:42162832-42162854 TCCTTGGCTCCCAAGTAGCTCGG + Intronic
1024051409 7:45626018-45626040 TCCAGAGCCACCAAGCCTCTAGG - Intronic
1024853885 7:53754412-53754434 ATCTGGGCCACCCAGCATCTTGG + Intergenic
1024857124 7:53794913-53794935 TCCTGGGCTCCCAAGAATGCAGG + Intergenic
1025886967 7:65604834-65604856 TCCTGGCCTCCCAAGTAGCTAGG - Intergenic
1025968039 7:66293273-66293295 TCCTGGGCTCACTCGCATCTCGG - Intronic
1026163171 7:67888516-67888538 TGCCGGGCCGCCAACCATCTGGG + Intergenic
1027164801 7:75826766-75826788 GCCTCGGCCCCCAAGTAGCTGGG - Intergenic
1028378984 7:90176901-90176923 TCCTGGGCCCCCAAGAACACAGG + Intronic
1029327556 7:99823154-99823176 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
1031142262 7:117956367-117956389 TCCTGGGCCCCTAGAAATCTGGG - Intergenic
1031265209 7:119572509-119572531 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
1031855448 7:126917089-126917111 TCCTGGCCTCCCAAGTAGCTAGG + Intronic
1033033333 7:137847179-137847201 TCCTGGTCCCCCCAGCCTCACGG - Intergenic
1033288723 7:140063177-140063199 TCCTGGTCCCTCAAACATCCAGG - Exonic
1034174087 7:149086956-149086978 TCTTGGCCTCCCAAGCAGCTGGG + Intronic
1034176140 7:149101313-149101335 ACCTCAGCCCCCAAGCAGCTGGG + Intergenic
1035501407 8:93698-93720 TCCTGGGCCCCCTCGGTTCTTGG - Intergenic
1035556743 8:572771-572793 TCCCAGGGCCCCCAGCATCTGGG - Intergenic
1037514571 8:19617992-19618014 ACCTCAGCCCCCAAGCAGCTAGG + Intronic
1038661354 8:29499748-29499770 TCTTAGCCTCCCAAGCATCTGGG - Intergenic
1039210226 8:35204953-35204975 TCCTAGGCCCCCAAGAATACAGG + Intergenic
1040402954 8:47071169-47071191 GCCTTGGCCCCCAAGTAGCTGGG + Intergenic
1041043777 8:53872484-53872506 TCATGGAATCCCAAGCATCTAGG + Intronic
1041332105 8:56738128-56738150 TCATGAGCTTCCAAGCATCTTGG + Intergenic
1041571665 8:59344155-59344177 TCCTGGGCCACATTGCATCTGGG - Intergenic
1042407912 8:68426401-68426423 CCTTGGGCCCCCGAGCATTTGGG - Intronic
1042928095 8:73987445-73987467 TCCTGAGCCTCCAAGTAGCTGGG - Intergenic
1043157922 8:76808853-76808875 TCCTGGACCTCTAACCATCTAGG - Intronic
1043552094 8:81386258-81386280 TCTTGGGCCCCTGAGCAACTGGG + Intergenic
1048029186 8:130614950-130614972 CCCTAGGCTCCCAAGCACCTAGG - Intergenic
1049252793 8:141598117-141598139 TCCTGGGCTCCCGAGTAGCTGGG + Intergenic
1049687638 8:143945277-143945299 TCCTGGGGTCCCAGGGATCTGGG + Intronic
1049823940 8:144654966-144654988 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
1051761978 9:20477611-20477633 TCCTGGGCCCCAGAGCATATAGG - Intronic
1052754832 9:32530003-32530025 GCCTCGGCCCCCAAGTAGCTGGG + Intergenic
1053101550 9:35375863-35375885 GCCTTGGCCCCCAAGTAGCTGGG - Intronic
1053803677 9:41779604-41779626 TCCTGGCAACCCAAGCTTCTGGG - Intergenic
1054141592 9:61535519-61535541 TCCTGGCAACCCAAGCTTCTGGG + Intergenic
1054191976 9:61990996-61991018 TCCTGGCAACCCAAGCTTCTGGG - Intergenic
1054461290 9:65466242-65466264 TCCTGGCAACCCAAGCTTCTGGG + Intergenic
1054646403 9:67596794-67596816 TCCTGGCAACCCAAGCTTCTGGG + Intergenic
1056029293 9:82535148-82535170 TCCCAGACCTCCAAGCATCTTGG + Intergenic
1056986048 9:91364400-91364422 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
1057551506 9:96054046-96054068 TCCTGGGCCCTCTGGCTTCTGGG - Intergenic
1058545896 9:106059941-106059963 TCCCAGGCCCCCAAGAATGTAGG + Intergenic
1058694050 9:107544301-107544323 TCCTGGGCCAGCAAGCATTCTGG - Intergenic
1059886038 9:118745621-118745643 TCCCAGGCCCCCTTGCATCTGGG - Intergenic
1060777776 9:126389061-126389083 CCCTGGGCCCCACAGCAGCTGGG - Intronic
1061881169 9:133569825-133569847 GCCTGGGCCCCCAAGTCCCTGGG + Intronic
1061888979 9:133607794-133607816 TCCTGGGCCCCCGAGCCTTAGGG + Intergenic
1062100452 9:134725234-134725256 TCCAGGGTCCCCCAGCAGCTGGG - Intronic
1062184657 9:135211523-135211545 TCCTGGGCCCCCAAGAGTGCAGG - Intergenic
1062375606 9:136260529-136260551 TGCTGGGCCCCCGAGAATCACGG + Intergenic
1203607508 Un_KI270748v1:69714-69736 TCCTGGGCCCCCTCGGTTCTTGG + Intergenic
1189463703 X:41262427-41262449 TCTTGGCCTCCCAAGTATCTAGG + Intergenic
1191000203 X:55651891-55651913 TCCTTGGCCTCCAAACATCCTGG - Intergenic
1193047328 X:77067007-77067029 CCCTGAGCCCCCACACATCTTGG + Intergenic
1196826898 X:119748178-119748200 CCCCAGGCCCCCAAGTATCTGGG - Intergenic
1200118945 X:153781438-153781460 CCCTGGGCCCCCGAACACCTCGG - Intronic
1200246800 X:154530841-154530863 TCCTGGGGAACCAGGCATCTTGG - Intergenic
1201276638 Y:12304673-12304695 GCCTGGGCTCCCAAGTAGCTGGG - Intergenic
1202187798 Y:22206306-22206328 GCCTCAGCCCCCAAGGATCTGGG - Intergenic
1202203562 Y:22380090-22380112 GCCTCAGCCCCCAAGGATCTGGG + Intronic
1202240367 Y:22760833-22760855 GCCTCAGCCCCCAAGGATCTGGG + Intergenic
1202393353 Y:24394587-24394609 GCCTCAGCCCCCAAGGATCTGGG + Intergenic
1202477432 Y:25275513-25275535 GCCTCAGCCCCCAAGGATCTGGG - Intergenic