ID: 969475149

View in Genome Browser
Species Human (GRCh38)
Location 4:7418118-7418140
Sequence CAGAAAAAAGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4478
Summary {0: 1, 1: 3, 2: 38, 3: 493, 4: 3943}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969475149_969475155 24 Left 969475149 4:7418118-7418140 CCTTCCTCCTTCCCTTTTTTCTG 0: 1
1: 3
2: 38
3: 493
4: 3943
Right 969475155 4:7418165-7418187 TTCAGGTGTACCCTAGACTCCGG 0: 1
1: 0
2: 0
3: 10
4: 90
969475149_969475154 7 Left 969475149 4:7418118-7418140 CCTTCCTCCTTCCCTTTTTTCTG 0: 1
1: 3
2: 38
3: 493
4: 3943
Right 969475154 4:7418148-7418170 CTGAGCGCTCAGCACATTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969475149 Original CRISPR CAGAAAAAAGGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr