ID: 969475179

View in Genome Browser
Species Human (GRCh38)
Location 4:7418298-7418320
Sequence TCCGCAGCACTTCCTCCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969475179_969475190 22 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475190 4:7418343-7418365 TGCAGGCCCAGGGGTCAGGCTGG 0: 1
1: 0
2: 6
3: 69
4: 502
969475179_969475186 11 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475186 4:7418332-7418354 CGGGGCAGCAATGCAGGCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 224
969475179_969475187 12 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475187 4:7418333-7418355 GGGGCAGCAATGCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 27
4: 317
969475179_969475183 -8 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475183 4:7418313-7418335 GCTGCGGAAGTGCACGGGACGGG No data
969475179_969475184 -7 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475184 4:7418314-7418336 CTGCGGAAGTGCACGGGACGGGG 0: 1
1: 0
2: 0
3: 3
4: 75
969475179_969475185 5 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475185 4:7418326-7418348 ACGGGACGGGGCAGCAATGCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
969475179_969475188 13 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475188 4:7418334-7418356 GGGCAGCAATGCAGGCCCAGGGG 0: 1
1: 0
2: 2
3: 30
4: 284
969475179_969475182 -9 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475182 4:7418312-7418334 TGCTGCGGAAGTGCACGGGACGG 0: 1
1: 0
2: 0
3: 8
4: 113
969475179_969475191 26 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475191 4:7418347-7418369 GGCCCAGGGGTCAGGCTGGCTGG 0: 1
1: 0
2: 7
3: 77
4: 689
969475179_969475189 18 Left 969475179 4:7418298-7418320 CCATAGGGAGGAAGTGCTGCGGA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 969475189 4:7418339-7418361 GCAATGCAGGCCCAGGGGTCAGG 0: 1
1: 0
2: 1
3: 20
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969475179 Original CRISPR TCCGCAGCACTTCCTCCCTA TGG (reversed) Intronic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
901803171 1:11721088-11721110 TCTGGAGCACTTCCCCCCCAGGG + Exonic
902710780 1:18238331-18238353 ACAGCAGCTCTTCCTGCCTAAGG - Intronic
903384066 1:22915410-22915432 TAAGCAGCCCTTCCTCCCTCAGG + Intergenic
909353481 1:74680649-74680671 TAGCCAACACTTCCTCCCTAAGG + Intergenic
909960743 1:81838879-81838901 TCTGAAGCACTTCCCTCCTACGG + Intronic
910220846 1:84888495-84888517 TCAGCAGCATTCACTCCCTAAGG - Intronic
915705994 1:157844326-157844348 TCCCCAGCACTTCCTCACTGAGG - Intronic
917651327 1:177080723-177080745 TTCACTACACTTCCTCCCTAGGG - Intronic
918104226 1:181402593-181402615 TCAGCAGCACTTTCTAACTAAGG - Intergenic
920207264 1:204301559-204301581 TCTGTACCACTTACTCCCTAGGG + Intronic
920588284 1:207190379-207190401 TTCCCAGCACTGCCTCCCCAGGG + Intergenic
923052526 1:230398799-230398821 TCCTCAGCACCACCTCCTTAAGG + Intronic
1063963492 10:11326606-11326628 TGAGCATCCCTTCCTCCCTAAGG - Intronic
1064246116 10:13668853-13668875 TCCCCTGCAGTTCCTGCCTACGG + Intronic
1064769010 10:18704306-18704328 TACTCAGAACTCCCTCCCTAGGG - Intergenic
1068511623 10:57973015-57973037 TCAACAGCACTTCCTCCTCAGGG - Intergenic
1069827926 10:71265682-71265704 TGCGCTCCTCTTCCTCCCTAAGG + Intronic
1074149423 10:110744989-110745011 ACTCCAGCACTTCCTCCCTGGGG + Intronic
1074428763 10:113374955-113374977 TCAGCAGCACTTCCTTCCCTTGG - Intergenic
1075437922 10:122459157-122459179 CCCTCATCACCTCCTCCCTAGGG - Intergenic
1075656393 10:124164376-124164398 TCAAAAGCACTTCCTCCTTAGGG + Intergenic
1083596043 11:63918667-63918689 TCCCCAGCACCTCCACCCTTTGG + Intergenic
1087162424 11:94961830-94961852 AACACAGCACTTCCTACCTAAGG + Intergenic
1090856525 11:130613648-130613670 ACCGCAGATTTTCCTCCCTATGG + Intergenic
1092026369 12:5244129-5244151 TCTGCTGAACTTCCTCTCTAAGG + Intergenic
1092257756 12:6936591-6936613 CCCCCACCACCTCCTCCCTATGG + Exonic
1092915539 12:13185994-13186016 TGTGCACCACTTGCTCCCTAAGG - Intergenic
1092997175 12:13961373-13961395 CCAGCAGCATTTCTTCCCTATGG - Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106652767 13:31709519-31709541 ACCACAGCACTTCCTCCGTTTGG - Intergenic
1109959878 13:69616125-69616147 TCAGCACCACTTTCTCCCCAGGG - Intergenic
1115566500 14:34629732-34629754 CCCGCAGCCCTTCCTCCCTAGGG - Intronic
1117252994 14:53953961-53953983 TCCCCGCCACTTCCTCCCCAGGG + Intronic
1120666683 14:87314671-87314693 TCCATAGTACTTCTTCCCTATGG - Intergenic
1121988781 14:98534037-98534059 TCAGCACCACTGCCTCCCTCTGG + Intergenic
1122219666 14:100228986-100229008 TCCGCAGCACTAACTCCTTTTGG + Intergenic
1124648407 15:31456882-31456904 TCCTCTGCTCCTCCTCCCTATGG + Intergenic
1125540565 15:40467502-40467524 TCATCTGCCCTTCCTCCCTAAGG - Exonic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1134148635 16:11788143-11788165 TCAGCAGCACTCCCTCCCAGGGG + Intronic
1135893754 16:26379895-26379917 TCCTCAGCACTTCCATCGTATGG - Intergenic
1141761332 16:86030550-86030572 ACCCCAGCACTTCCTTACTACGG - Intergenic
1142011255 16:87715459-87715481 TCCGCAGCTCATCCTGCCCAGGG + Intronic
1143722686 17:8823679-8823701 TCCAGAGCCCTGCCTCCCTAGGG + Intronic
1144512238 17:15887019-15887041 CCCGCAGCATTTCCTCCCTGAGG - Intergenic
1146288794 17:31593726-31593748 TCCGCAGAACTCCCACCCTCAGG - Intergenic
1147861485 17:43526496-43526518 CCCAAAGCACTTCCTCCCTGTGG + Intronic
1147970446 17:44216776-44216798 TGCTCAACTCTTCCTCCCTAGGG + Intronic
1148826157 17:50395964-50395986 TCAGCAAAACTTTCTCCCTAAGG + Intronic
1151216236 17:72578522-72578544 TCCTCAGCGCTTCCTCCTTGGGG - Intergenic
1151570030 17:74921483-74921505 TCCGGAGCTCTCCCTCCCTTGGG + Intronic
1152342582 17:79733486-79733508 TCTGCACCTCTTCCTCCCTCAGG + Exonic
1152791705 17:82283625-82283647 TCCCTAGCACCTCCTCCCCAGGG + Intergenic
1155439053 18:25842382-25842404 GCTTCAGCACCTCCTCCCTATGG + Intergenic
1161290874 19:3492692-3492714 TCCACATCACCTCCTCCCTGAGG - Intronic
1161686988 19:5707810-5707832 TCTGCAGCACTGACTCCCTGGGG + Exonic
1163804210 19:19386244-19386266 TCCACAGCACTTCCCCCTCAGGG + Intronic
1167347432 19:48955233-48955255 CCCGCACCACTTCCTGCCTCTGG + Intronic
1167738306 19:51310683-51310705 TCCCCAGCCCCTCCTCCCTCAGG - Intergenic
925614130 2:5729291-5729313 TCTTCTGTACTTCCTCCCTATGG + Intergenic
925640882 2:5985147-5985169 ACTGCAGCACTTTCTCCCTCGGG + Intergenic
928727872 2:34195962-34195984 TGCTCAGCACTTTCTCTCTATGG + Intergenic
931951456 2:67367955-67367977 TCAGCAGCATTTTCTGCCTAGGG + Intergenic
934112539 2:88756734-88756756 TCCACAGCACTAGCTCCCTGTGG - Intergenic
935916552 2:107958264-107958286 TCCCCTGCACTTCTACCCTAGGG - Intergenic
936163747 2:110103195-110103217 TCCACAGCACTAGCTCCCCATGG - Intronic
945045119 2:205775039-205775061 CCCGCAGCACTTCCCACCCATGG + Intronic
947785027 2:232809699-232809721 TCCTCACCACTTCATTCCTAGGG + Exonic
948167250 2:235872728-235872750 TTAGTACCACTTCCTCCCTAAGG + Intronic
948860061 2:240748483-240748505 TCCTGAGCACTTCCTCCCACTGG - Intronic
1169309624 20:4524229-4524251 TCCCCATGATTTCCTCCCTATGG - Intergenic
1169867477 20:10217567-10217589 TCCCCAGCCCTCCCTCCCTGCGG + Intergenic
1171438938 20:25146304-25146326 TCCCCAGCAGTTCCTTGCTAAGG - Intergenic
1177249210 21:18570331-18570353 GCAGCAGCAGTTCCTCCCTGCGG - Intergenic
1180002101 21:44999822-44999844 TGCGCAGCACGGACTCCCTAAGG - Intergenic
1181802900 22:25358827-25358849 TCCACTGCACCTCCTCCCTCAGG + Intronic
1182064769 22:27422788-27422810 TCCACACTACTTACTCCCTAAGG - Intergenic
1182087548 22:27571775-27571797 AGCGCAGCCCTTCCTCCCTTGGG + Intergenic
1183189011 22:36309531-36309553 TCCTCACCACTTCCTTCTTAGGG - Intronic
1184312914 22:43659818-43659840 TGCAGAGCACTTCCTCCCTTTGG - Intronic
1184477555 22:44729784-44729806 TCCGCAGCATTTCCGCCCCGTGG + Intronic
1185079317 22:48701056-48701078 CCCGCAGCCCTTCATCCCTAGGG + Intronic
949510384 3:4761806-4761828 TCCTCAGGACTGTCTCCCTATGG - Intronic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
953033186 3:39191065-39191087 GGGGCAGGACTTCCTCCCTATGG + Intronic
962480135 3:135790875-135790897 TCCTGAGCACTTTCCCCCTAAGG - Intergenic
963264591 3:143228220-143228242 TTCCCAGCACTCCCTCCCTGAGG + Intergenic
963264641 3:143228404-143228426 TTCCCAGCACTCCCTCCCTGAGG - Intergenic
968273094 3:197419890-197419912 TCCACTGCACTTCCTCCTTTGGG - Intergenic
968276962 3:197447281-197447303 CCCTCAGCATTTCCTCCCTCTGG + Intergenic
968529852 4:1085912-1085934 TCTGCAGCACTGACTTCCTAAGG + Exonic
969326507 4:6447402-6447424 TCCGGAGCTCTTCCTCCGCAGGG - Intronic
969475179 4:7418298-7418320 TCCGCAGCACTTCCTCCCTATGG - Intronic
969498742 4:7540617-7540639 TGCGCAGTTCTTCCTCCCGAGGG + Intronic
975649377 4:76577307-76577329 TCCCCAGCACCTCGTCCCTTTGG - Intronic
978478425 4:109159520-109159542 TCCCCAGCACTGGCTCCCTCAGG + Intronic
979107018 4:116701782-116701804 TCCACAGAACATCCTCCCTTGGG - Intergenic
980700734 4:136425729-136425751 TCTGAAGCAGTTCTTCCCTAGGG - Intergenic
985621940 5:960393-960415 TCCCCAGCACTTCCTGCCCCTGG + Intergenic
985988058 5:3533832-3533854 TCCCCAGTACTTCCTCCCGCAGG + Intergenic
994909697 5:105886549-105886571 TCCTCAGCACTACCTCCCATAGG - Intergenic
997732361 5:136191053-136191075 TGCCCAGCACTTCCTCCCAAAGG - Intergenic
1002327040 5:178416432-178416454 CCAGCAGCACTGCCTCCCTCGGG - Intronic
1002785901 6:399872-399894 TCAGAAGCACCTCCTCCCAAAGG - Intronic
1003270070 6:4600758-4600780 TCCAGAGCACTTCCTTCTTAGGG - Intergenic
1004104937 6:12658532-12658554 TCCCCAGCCCTTCCTCCCAAAGG - Intergenic
1006321459 6:33321941-33321963 TCCCCACCACTTCCTCCCTCCGG - Exonic
1007187970 6:39988506-39988528 TGTGCAGCACTTTCTGCCTAAGG - Intergenic
1007340143 6:41186123-41186145 TCCTCAGCAATTCATCCCCAGGG - Intergenic
1018359626 6:163054523-163054545 CCCGCAGCAGTTCCTCCTTAGGG - Intronic
1018622415 6:165743162-165743184 TACGAGGGACTTCCTCCCTAAGG - Intronic
1022900922 7:34810002-34810024 TCCTCAGAACCTCCTCCCTATGG + Intronic
1032721362 7:134553063-134553085 TTCCCAGCATTTCCTACCTAGGG + Intronic
1036478438 8:9116391-9116413 TCCACAGGACTCCCTCCCTCTGG - Intronic
1037035573 8:14162727-14162749 TCAGCAGAACTTGCTCCCAAGGG + Intronic
1039495128 8:37974741-37974763 TCCCCAGCACTTGCTTCCCAGGG - Intergenic
1041110285 8:54476948-54476970 TCCACCCCACTTCCTCCCTCAGG + Intergenic
1041639170 8:60178463-60178485 TCTGCAGCTCTTCCTCACGAAGG - Intergenic
1042668701 8:71235634-71235656 TCCACAGCACTAACTCCATAAGG + Intronic
1044112830 8:88297534-88297556 ATGGCAGCACTTCCTCCCAAAGG + Intronic
1049510945 8:143026378-143026400 ACCGCAGCCCCTCCTCCCTCCGG - Intergenic
1050310319 9:4346300-4346322 TCAACAGCACTTTCTCCCTGGGG + Intronic
1053344042 9:37364919-37364941 TGTGCAGCACTGCCTCCCTGTGG + Intergenic
1059104849 9:111502127-111502149 TCAGCAGCACTACCTGCCTGTGG + Intergenic
1186877484 X:13830491-13830513 TCCTCAACACTCCCTCCCTGTGG - Intronic
1187244327 X:17540227-17540249 TCCTCAGCAACTCCTCCCTAGGG - Intronic
1192656534 X:73000265-73000287 TCAACAGCACTTCCTCCCACGGG + Intergenic
1192665586 X:73082736-73082758 TCAACAGCACTTCCTCCCACGGG - Intergenic
1198744548 X:139876391-139876413 TCAGCCGCACTTTCTGCCTAAGG - Intronic