ID: 969475356

View in Genome Browser
Species Human (GRCh38)
Location 4:7419424-7419446
Sequence CTCAGGTTACAGAGAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969475348_969475356 22 Left 969475348 4:7419379-7419401 CCAGGAAAGGCTGTGTGAGCCTT 0: 1
1: 0
2: 3
3: 25
4: 309
Right 969475356 4:7419424-7419446 CTCAGGTTACAGAGAAAGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 279
969475351_969475356 3 Left 969475351 4:7419398-7419420 CCTTGGTGAGAGACACATGGCCA 0: 1
1: 0
2: 3
3: 13
4: 167
Right 969475356 4:7419424-7419446 CTCAGGTTACAGAGAAAGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969475356 Original CRISPR CTCAGGTTACAGAGAAAGGG TGG Intronic
901712902 1:11129720-11129742 CTCAGGTATCAGAGAAGGGAAGG - Exonic
901727870 1:11256603-11256625 CCCAGGTTACAGAGTTAGGTAGG + Intronic
902161936 1:14537555-14537577 CTCAGGCTACTGAGAATGAGTGG - Intergenic
902373102 1:16017512-16017534 CTGTGGTTACAGAGCATGGGTGG + Intronic
902561202 1:17278686-17278708 CTGGGGTCACTGAGAAAGGGAGG - Intronic
903377115 1:22873759-22873781 CTCAGGTTGCAGTGGAAGGAGGG + Intronic
903974683 1:27141745-27141767 CTCAGGTTACAGCAAGATGGGGG - Intronic
904270212 1:29344889-29344911 CTCAGGTCACACAGGAAGGTAGG - Intergenic
904272610 1:29360280-29360302 TTCATGTTACAGTGAAGGGGTGG - Intergenic
905912954 1:41666291-41666313 CTCAGGCTGGAGAGAAAGGATGG - Intronic
906333906 1:44911643-44911665 CTCTGGTTACAACTAAAGGGTGG - Intronic
907840034 1:58148141-58148163 GTCAGGCTACAGAGAAAGCTTGG - Intronic
907999113 1:59663189-59663211 CTCATTTTACAGACAAGGGGAGG + Intronic
911581906 1:99643989-99644011 GGCAGGTGAAAGAGAAAGGGAGG + Intergenic
912300481 1:108510837-108510859 CCCATCTTACAGACAAAGGGTGG - Intergenic
916644532 1:166770039-166770061 CTTAGGTTACAGAAAAAGTGTGG - Intergenic
918170056 1:181987899-181987921 CTCAGTTTAAAGGGAAAGAGAGG + Intergenic
918240373 1:182615329-182615351 CTCAGGCTGCGGAGAAAGGGCGG + Intergenic
918288303 1:183080510-183080532 CTTAGCTTCCAGAGAAAGGGAGG - Intronic
918866610 1:189908071-189908093 TTCTGGTTACAGAGTCAGGGTGG + Intergenic
920456390 1:206104865-206104887 CTCAGTTTAGAAAAAAAGGGCGG + Intergenic
922616540 1:226964427-226964449 CTCAGGGTACAGGGAAATGGAGG - Intronic
923897233 1:238285047-238285069 CTCAGCTTACAGAGAATGGGAGG - Intergenic
923981348 1:239327471-239327493 CTGAAGCTACAGAGAAAAGGAGG + Intergenic
1063169135 10:3490675-3490697 CTCATGTACCAGGGAAAGGGTGG - Intergenic
1063445157 10:6108857-6108879 CTCAGGTGACAGAGCCAGGCAGG - Intronic
1063507054 10:6609137-6609159 CTGAGGTAGCAGAGAAAGGAGGG + Intergenic
1064251272 10:13708167-13708189 CTCAGTGGCCAGAGAAAGGGGGG - Intronic
1065128670 10:22598704-22598726 ATCAGATAACAGAGTAAGGGAGG - Intronic
1065313558 10:24439880-24439902 ATCAGGTTACATGGAAAAGGGGG - Intronic
1068648938 10:59500102-59500124 CCCAGGTTAGAGAGCAGGGGAGG + Intergenic
1069832316 10:71288904-71288926 CATAGGTGACAGGGAAAGGGTGG - Intronic
1072454662 10:95565186-95565208 CCCAGGTTTAAGAGAAACGGTGG - Intergenic
1073593038 10:104774385-104774407 CACAGGTTGCAGAGAAAGAAGGG - Intronic
1075417050 10:122271884-122271906 CTTCAGTTACAGAGAGAGGGAGG - Intronic
1075470871 10:122688045-122688067 CTCAGGTTTCAGAGGGAGGTTGG + Intergenic
1077934394 11:6768441-6768463 CCCAGGACACACAGAAAGGGAGG + Exonic
1078368340 11:10724772-10724794 CTCAAGAAACAGAGAAAAGGAGG + Intergenic
1078557194 11:12338841-12338863 GTCAGGTTACCCACAAAGGGAGG - Intronic
1078560576 11:12367697-12367719 GTCAGGTTACCCACAAAGGGAGG + Intergenic
1078959822 11:16252326-16252348 CTCAGATTCCAGAGAAAGACAGG + Intronic
1079125603 11:17716677-17716699 CTGAGGCTACAGAGGAAGTGAGG + Intergenic
1080795108 11:35556412-35556434 CTCAGTTTGAAGGGAAAGGGAGG - Intergenic
1080842066 11:35993310-35993332 CTCAGGGCACAGAGAAGGGCTGG + Intronic
1081455812 11:43221523-43221545 ATCAGGGTGCAGAGAAAGGCTGG + Intergenic
1081508594 11:43744366-43744388 AGCAGGTTACATAGAAATGGTGG + Intronic
1081874336 11:46398341-46398363 CTCTCTTTGCAGAGAAAGGGTGG - Intronic
1083368528 11:62158552-62158574 GTCAGGTTACCCACAAAGGGAGG + Intergenic
1084386173 11:68843909-68843931 CTGAGGTTCCAGGGAAAGGAGGG - Intronic
1084607948 11:70183497-70183519 GTGAGGTCACAGAGAATGGGGGG + Intronic
1085038851 11:73315325-73315347 CTAAGGTCACACAGCAAGGGCGG + Intronic
1085772054 11:79334448-79334470 CTCAGGGAATAGAGAAATGGTGG - Intronic
1086960982 11:92979988-92980010 CACGGGGTACAGAAAAAGGGAGG - Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087791520 11:102411070-102411092 CTCAGGTTTGAGCAAAAGGGGGG - Intronic
1088924474 11:114286381-114286403 CTCAGGTTACAGAACACAGGGGG - Intronic
1090298210 11:125609258-125609280 CTCAGGTTTGAAAGAAAGGAAGG + Intronic
1091187146 11:133657078-133657100 CTCACGTGGCAGAGAGAGGGAGG - Intergenic
1091661262 12:2385524-2385546 CTAAGGCTACAGAGGGAGGGAGG - Intronic
1093585229 12:20827961-20827983 CTCAAGGTACAGAGAGAGAGTGG + Intronic
1094270377 12:28608100-28608122 CTCAGGTTACTGACAAAATGTGG - Intergenic
1094284017 12:28772316-28772338 TTCAGGTCACACAGAAATGGTGG + Intergenic
1096117855 12:49066106-49066128 TTCAGGTTAGAGACAAAGAGAGG + Intronic
1096235888 12:49926069-49926091 CTCATTCTACAGAGAAACGGAGG + Intergenic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1097092743 12:56520227-56520249 CTCAGGGGACACAGGAAGGGTGG - Intergenic
1097860226 12:64511573-64511595 AGCAGGTTACACAGAAAAGGAGG - Intergenic
1099344170 12:81477269-81477291 CTCAGGATTGAGAGAAAAGGAGG + Intronic
1100959878 12:99950748-99950770 CTCAGATTAGAGAAAAAGGATGG - Intronic
1101080827 12:101182377-101182399 CTTAGGTAACAGAAAAAGTGTGG + Intronic
1101529941 12:105564528-105564550 CTCAGGTCACTGAGAAAATGGGG + Intergenic
1102019287 12:109670508-109670530 CCCAGGCTGCAGAGAAAGAGAGG - Intergenic
1102405302 12:112668364-112668386 CTCAGTTTACAGAGAAAAATTGG - Intronic
1104716342 12:131018810-131018832 CTGAGCGTACTGAGAAAGGGTGG - Intronic
1106305086 13:28502450-28502472 CTGAGGCTACAGAGAAAAGGCGG + Intergenic
1106759576 13:32855427-32855449 CCCAGATGACAGAGCAAGGGGGG - Intergenic
1107422829 13:40265034-40265056 CTGAGGTGAGGGAGAAAGGGAGG - Intergenic
1109673408 13:65639524-65639546 CTAAGGTTAAAGAAAAATGGAGG - Intergenic
1109781249 13:67113024-67113046 CTAAAGTTACAGGGAAAAGGAGG - Intronic
1110667699 13:78137421-78137443 CACAGCTTTCAGAGAAAGGAGGG + Intergenic
1110837985 13:80106828-80106850 ATCAGGGCAGAGAGAAAGGGAGG - Intergenic
1111710759 13:91810637-91810659 CTCAGGATAATGAAAAAGGGAGG + Intronic
1112282500 13:98075222-98075244 CTACAGTTACAGAGAAGGGGTGG + Intergenic
1112398627 13:99056699-99056721 AACACGTTACAGGGAAAGGGAGG - Intronic
1113730109 13:112635522-112635544 CACAGGTGTCAGAGGAAGGGAGG + Intergenic
1114193618 14:20458990-20459012 CTCATCCTACAGAGAAAGGAAGG + Intronic
1114215812 14:20656932-20656954 CTCAGGGAAGAGAGATAGGGAGG + Intergenic
1114413689 14:22524534-22524556 CTGAGGTGACAGAGAAGGCGAGG - Intergenic
1114458244 14:22871337-22871359 TTCAGTTTGCAGAGAAGGGGCGG + Intergenic
1114856813 14:26457029-26457051 TTCAGGTAAAACAGAAAGGGAGG + Intronic
1117294083 14:54362982-54363004 GTGAGGTTACAGAGATATGGAGG + Intergenic
1118307723 14:64669315-64669337 TTGAGGTTACAGAAAAAGAGAGG - Intergenic
1119662110 14:76459541-76459563 CTGAGGCTGCAGAGAGAGGGTGG + Intronic
1120142591 14:80945184-80945206 CTGAGGATACAGAGAAAAGATGG - Intronic
1122621546 14:103060349-103060371 CTCAGGAGAGAGAGAAAGCGAGG - Intergenic
1125260532 15:37819443-37819465 CTAAAGATAGAGAGAAAGGGAGG + Intergenic
1125796629 15:42408575-42408597 GCCAGGATACAGAGAAGGGGAGG + Intronic
1127610775 15:60634316-60634338 CTCAGGTCACTGAGAGAGGCTGG - Intronic
1128252673 15:66173956-66173978 CTCAGGCTATAGAGGAAGGCAGG - Intronic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1130000614 15:80043428-80043450 CTCAGGGTACAGAGTTGGGGAGG + Intergenic
1130753778 15:86741296-86741318 ATCAGGTTACAGAAAATGAGGGG + Intronic
1132563576 16:610207-610229 CTCAGGGGACAGAGGCAGGGAGG - Intronic
1134095115 16:11413961-11413983 CTCAGGCTCCAGAGAAAGGCAGG - Intronic
1134316891 16:13127109-13127131 CTGAGGGAACAGAGAGAGGGAGG + Intronic
1135580604 16:23622895-23622917 CACAGGTTTCAGAGAAAGTTGGG - Intronic
1137570144 16:49560011-49560033 CTCAGGCTACTGTGACAGGGTGG - Intronic
1138159048 16:54736192-54736214 CTAAGGTTCCAGAGAATGGCTGG + Intergenic
1140753955 16:78050685-78050707 CACAGGGGACAGGGAAAGGGAGG - Intronic
1140869879 16:79096520-79096542 CGAAGGTAACAGAGAAAGGATGG - Intronic
1141665668 16:85463959-85463981 CTCCAGTGACAGAGAATGGGCGG + Intergenic
1143623542 17:8095104-8095126 CTCAGGTGGCAGAGGAAGGAAGG + Intergenic
1147147029 17:38491338-38491360 CTCAGGTGCCAGAGTGAGGGAGG + Intronic
1148556695 17:48582850-48582872 CTCGGGTTCCAGAGAGAGTGTGG + Intronic
1148856240 17:50580630-50580652 CTCAGGCTCCTGAGGAAGGGCGG + Intronic
1149441120 17:56674780-56674802 CTCAGGTGACAAAGAAAAAGTGG + Intergenic
1151439568 17:74119443-74119465 CTCAGGTCACAGAGAGAGGGTGG - Intergenic
1151555030 17:74842530-74842552 CACAGGCTACAGAGACAGTGGGG - Exonic
1152909415 17:82990876-82990898 ATCAGGGTTCAGAGAAAAGGTGG + Intronic
1153629670 18:7057419-7057441 CACTGGTTAAAGTGAAAGGGTGG - Intronic
1155288157 18:24313096-24313118 CTTGGGTGACAGAGCAAGGGAGG + Intronic
1157719545 18:49913485-49913507 CTGAGGACACAGAGAAAGTGGGG - Intronic
1157731280 18:50006593-50006615 CTCAGGTGTCACAGAAGGGGGGG - Intronic
1158513880 18:58115022-58115044 GTCAGCTTACACAGAAAAGGGGG - Intronic
1160398355 18:78588729-78588751 CTCATATTAAAGAGAAATGGTGG - Intergenic
1160773277 19:843406-843428 CCCAGGCTGCAGGGAAAGGGGGG - Intronic
1160777414 19:862447-862469 GGCAGGTGGCAGAGAAAGGGTGG + Intronic
1160839503 19:1139495-1139517 CTCACGTGACAGAAAAGGGGCGG + Intronic
1162838728 19:13340114-13340136 CTCAGATGACAGGGACAGGGTGG + Intronic
1166378721 19:42343639-42343661 CTGGGGTGACAGGGAAAGGGTGG + Intronic
1167029075 19:46945084-46945106 CTCCGGTTACATGGAAAGGCTGG + Intronic
1167613045 19:50516600-50516622 CCCAGGTTTCAGAGAGAGCGTGG + Intergenic
1168293554 19:55368653-55368675 CTCAGGTGGCAGAGTGAGGGAGG - Intronic
925311176 2:2883173-2883195 CTCAGTCTATAGAGAAAGTGTGG - Intergenic
925351800 2:3206251-3206273 ACCAGGGGACAGAGAAAGGGTGG + Intronic
925416792 2:3675970-3675992 CTCAGGTGACAGAGAAGAGAGGG + Intronic
927600902 2:24439901-24439923 CTTAGGTGACACAGAAAGGCTGG - Intergenic
928168994 2:28991459-28991481 CCAAGGTGACAGAGAAAGGAAGG - Intronic
929826007 2:45310242-45310264 CTCAGGATACTGAGAGAGGATGG - Intergenic
930017874 2:46983359-46983381 CTTTGGTTTCAGAGAAACGGTGG + Intronic
930387908 2:50720844-50720866 CTCAGGTTTCAGTGATGGGGTGG - Intronic
934072576 2:88398164-88398186 TTCAGGGGACAGAGAAATGGAGG - Intergenic
934909144 2:98234697-98234719 CTCAGCTTGCAGTGAAAGGAAGG + Exonic
936236718 2:110748418-110748440 CTCAGGAGATAGAAAAAGGGAGG - Intronic
936852878 2:116922439-116922461 CCCATATTACACAGAAAGGGAGG + Intergenic
938580907 2:132645786-132645808 CTCCGGTTACACAGACATGGGGG + Exonic
940198671 2:151125787-151125809 GTGAGGTTGCAGAGAAAAGGGGG + Intergenic
941156469 2:161984680-161984702 CTCATGTTCCATAAAAAGGGGGG - Exonic
944496653 2:200313967-200313989 CTAAGGTTTGAGAGGAAGGGAGG - Intronic
944651194 2:201831917-201831939 CTCAGTTTACAGAGAAAACCAGG - Intronic
945005097 2:205396765-205396787 CTAAGGTAACAGATAATGGGAGG + Intronic
946673267 2:222129111-222129133 CTCAGGTGTCAGAGCCAGGGAGG - Intergenic
947004585 2:225496230-225496252 CTGAGGTTACAGAGGGAGTGAGG + Intronic
947976871 2:234374272-234374294 TTCAGGTTACAGAGGAGGGGCGG + Intergenic
948505514 2:238424904-238424926 CTCAGGGTCCTGAGAAATGGGGG + Intergenic
1168972935 20:1943264-1943286 CTCAGGCTAATGAGAAAGAGAGG - Intergenic
1169540225 20:6591806-6591828 CCCAGGTTCCAGAGAAAGATGGG + Intergenic
1169748183 20:8964221-8964243 CTCTGGCTACAGAGGAGGGGAGG - Intronic
1170529296 20:17274253-17274275 CTCTGGCTATTGAGAAAGGGTGG + Intronic
1170893268 20:20393547-20393569 ATCTGGTCACAGTGAAAGGGAGG + Intronic
1171400873 20:24872458-24872480 CTCATGTTAGAAGGAAAGGGAGG + Intergenic
1172174761 20:32965642-32965664 CTCATTTTGCAGAGAAAGAGAGG + Intergenic
1175701199 20:61138422-61138444 CTGAAGTTAGAGAGAGAGGGTGG - Intergenic
1176006408 20:62866014-62866036 CTCATTTTAAAGAGAAAGGATGG + Intergenic
1176071530 20:63229226-63229248 CTGAGGTTTCAGGGAAGGGGTGG - Intergenic
1176698778 21:10017045-10017067 ATCAGGAAACAGAGAGAGGGAGG + Intergenic
1178726508 21:35057179-35057201 ATAAGGTTGCAGAGAAAGTGGGG - Intronic
1179988393 21:44933165-44933187 CTCAGGCTGCAGGGATAGGGAGG + Intronic
1183478043 22:38046699-38046721 CTCAGGGGACAGAGAGTGGGAGG - Intergenic
1184236024 22:43183471-43183493 CTCACATTACACAGAAAGAGAGG + Intronic
949578043 3:5358086-5358108 GTCAGCATACAGAGAAAAGGAGG - Intergenic
950505298 3:13390910-13390932 CTCAGGGCACAGGGAAAGTGTGG - Intronic
953881747 3:46694473-46694495 CTCAGGTTCCAGTGAGGGGGAGG + Intergenic
956353186 3:68361355-68361377 GTAGGGTTACAGAAAAAGGGAGG + Intronic
956763559 3:72464702-72464724 CTCAGGATACAGAGACAGTGAGG + Intergenic
957939977 3:86991459-86991481 GCCAGGTGACAGAGACAGGGTGG - Intergenic
959430590 3:106250799-106250821 TTCAGCTTACAGACAAATGGTGG - Intergenic
961416158 3:126758839-126758861 CGCAGGGTAGACAGAAAGGGTGG - Intronic
961479575 3:127171303-127171325 CTCAGGGACCTGAGAAAGGGAGG + Intergenic
961812210 3:129528427-129528449 CTCAGGATCCAGGAAAAGGGAGG - Intergenic
962066713 3:131989135-131989157 CTCAGGTGCCACACAAAGGGTGG + Intronic
963368272 3:144366386-144366408 CTTAAGTTAAAGACAAAGGGTGG + Intergenic
964050387 3:152385320-152385342 CACAGGGTATAGAGAAAGGAAGG + Intronic
966303338 3:178502890-178502912 CTCAGGTGACAGAGATAGCTTGG - Intronic
968419775 4:474035-474057 CGCAGGTTACAGAGCGATGGAGG + Intronic
969201142 4:5607155-5607177 CTAAGCTGAGAGAGAAAGGGAGG + Intronic
969307763 4:6335564-6335586 CTGAGGGTTCAGAGACAGGGAGG + Intronic
969475356 4:7419424-7419446 CTCAGGTTACAGAGAAAGGGTGG + Intronic
970023964 4:11601240-11601262 CTCAGGGTGCAGTGAAAGGGAGG + Intergenic
970884676 4:20974378-20974400 TTCAGATTAGAAAGAAAGGGTGG + Intronic
972657656 4:41080439-41080461 CTCAGTTTTCAGAGACAGTGGGG - Intronic
975558386 4:75686895-75686917 CTCAGTTTACAGAGAAAAGTAGG - Intronic
976804823 4:89035169-89035191 CACTGGGTACAGAAAAAGGGAGG + Intronic
976891520 4:90053611-90053633 TTCAGGTTTCAGACAAAGGACGG + Intergenic
977401302 4:96535674-96535696 TCCAGGTTACAGAGCATGGGTGG - Intergenic
977569272 4:98612780-98612802 CTGAGGGGACAGAGTAAGGGAGG - Intronic
977675878 4:99746197-99746219 CCCAGGATACAGAAAAAGAGGGG + Intergenic
978824020 4:112999480-112999502 CTCACCTGACAGAGAAAGGGAGG + Intronic
979268118 4:118726984-118727006 TTCAAGTGTCAGAGAAAGGGTGG + Intronic
980108717 4:128613886-128613908 CTCAGACAACAGAGAAAGGACGG + Intergenic
980371246 4:131876390-131876412 ATCAGGAAACAGAGAGAGGGAGG + Intergenic
980885886 4:138761811-138761833 CTCATCTTACAGAAAAAAGGAGG + Intergenic
980977872 4:139628445-139628467 CTAAGGTTAGAAAGAAAAGGAGG + Intergenic
981225537 4:142289852-142289874 GTGAGATTTCAGAGAAAGGGAGG - Intronic
981751008 4:148092290-148092312 AGCAGGTTAAAGAGAAAGTGGGG - Intronic
982594634 4:157363774-157363796 CTCGAGTTACAGACAAAGCGTGG + Exonic
983696514 4:170539186-170539208 CTCAGTTTACAGACATTGGGAGG + Intergenic
984631877 4:182069818-182069840 CTAAGGCTACAGATGAAGGGAGG + Intergenic
984781401 4:183529477-183529499 CAAAGGTTAAAGAGAATGGGAGG - Intergenic
986431509 5:7685416-7685438 TTGAGGTGGCAGAGAAAGGGTGG + Intronic
987815741 5:22899620-22899642 CTCAGATGAGAGAGAAAAGGAGG + Intergenic
990010866 5:50995672-50995694 CTCAGGATACAAAGAAAAAGTGG - Intergenic
990469757 5:56104486-56104508 CTCAGTTTTCAGGGACAGGGTGG + Intronic
990873500 5:60459484-60459506 CCCAAGATACAGAGAAAGGAGGG + Intronic
993291820 5:86081996-86082018 TTCAGGTTACCCATAAAGGGAGG - Intergenic
995911106 5:117187894-117187916 CTTAGGTCCCAGAGAAAAGGAGG + Intergenic
996108270 5:119533182-119533204 CTCTGCTTTCAGAGAATGGGAGG + Intronic
996833806 5:127768994-127769016 CTCATGCTACAGAGAAAGGAGGG - Intergenic
997944240 5:138184962-138184984 CTCAGGTGACAGAGCAAGAGGGG - Intronic
998456882 5:142280520-142280542 GCCAGGGTACTGAGAAAGGGAGG + Intergenic
998620841 5:143792687-143792709 CTGAGGTTCCAAAGAAAAGGGGG - Intergenic
1000297053 5:159921212-159921234 CTGAGGCCACAGGGAAAGGGTGG - Intronic
1001125650 5:169016941-169016963 CCCAGGTCACAGAGCAAGAGTGG + Intronic
1001170639 5:169416078-169416100 CTAAGGTTACAGAGAACCTGGGG + Intergenic
1001236943 5:170038118-170038140 CCAAGGTTACAGAAAAAGTGAGG - Intronic
1001946259 5:175780770-175780792 CTCAGAACACAGAGAAAGGATGG - Intergenic
1003384629 6:5655756-5655778 CTCAGGTTCCAGAGAATTGGAGG + Intronic
1004002755 6:11610511-11610533 CTTTGATCACAGAGAAAGGGAGG - Intergenic
1004240430 6:13916388-13916410 CTGAGGCAACAGAGGAAGGGAGG - Intergenic
1005208347 6:23431147-23431169 CTCAGGTTACCCACAAAGGCAGG - Intergenic
1005569580 6:27131981-27132003 ATCAGGATGCAGAGGAAGGGCGG + Intronic
1006174133 6:32111682-32111704 CTGAGGTTACAGAGAACAGCCGG - Intronic
1006912414 6:37571971-37571993 CTCAGCTGCCAGAGGAAGGGTGG + Intergenic
1008080815 6:47192872-47192894 CTCAGGTTCCAGACAAAAGGTGG - Intergenic
1010341071 6:74753507-74753529 ATGAGGTTACAGAGAGATGGGGG - Intergenic
1010924628 6:81729309-81729331 CTCAGATTAAAAAAAAAGGGTGG - Intronic
1010953706 6:82067184-82067206 CTCACATGACAGAGAAAGGGAGG - Intergenic
1013531047 6:111019137-111019159 CAGAGGTTACAGAGAGTGGGCGG + Intronic
1013805523 6:113992121-113992143 GTCAGTTTGCAGAGAAAGGGGGG + Intronic
1014281909 6:119450849-119450871 CTCAGGTTGTTGAGAATGGGAGG - Intergenic
1016539331 6:145145855-145145877 ATCAGGGTACAGAGAAACTGTGG + Intergenic
1018616823 6:165694577-165694599 CTCAGGTAGCAGAGAGATGGGGG - Intronic
1018797223 6:167196010-167196032 CTCAGACCTCAGAGAAAGGGCGG - Intronic
1018819074 6:167358754-167358776 CTCAGATCTCAGAGAAAGGGTGG + Intronic
1019598514 7:1869530-1869552 CTGAGGTTGGAGAGAAGGGGAGG - Intronic
1020002610 7:4764392-4764414 GTGAGGTTTCAGAGAAACGGGGG + Exonic
1021669847 7:23024253-23024275 CTCAGGTACCAGAGCAAGTGAGG - Intergenic
1022338644 7:29447487-29447509 CACAGATGAGAGAGAAAGGGAGG + Intronic
1022736475 7:33080960-33080982 CTGAGGTTACAGAAAAATGAGGG - Intergenic
1023051559 7:36257207-36257229 ATCAGGTTACCCACAAAGGGAGG - Intronic
1024275391 7:47673072-47673094 ATCAGGTAACTGAGAAAGGCAGG + Intergenic
1026434505 7:70383815-70383837 CCCACTTTGCAGAGAAAGGGAGG - Intronic
1030199588 7:106889121-106889143 CTCTGCTTACAGAGTAAGTGGGG + Intronic
1031922172 7:127610140-127610162 CTCAGGATGTGGAGAAAGGGAGG - Intergenic
1033468642 7:141622644-141622666 CACAGGGAACAGAGAAAGGTAGG - Intronic
1034674783 7:152884574-152884596 CTCCGGTTACAGAGACAGAGGGG - Intergenic
1040279908 8:46034888-46034910 CTCAGGTTTCAGAGTAACAGTGG + Intergenic
1042445975 8:68885332-68885354 ATCAGTTTTCAGAGAAAGGAAGG - Intergenic
1042834074 8:73062036-73062058 CTTAGTTTACAAAGAAAGGCTGG - Intergenic
1043116511 8:76260880-76260902 GTGAGGATACAGAGAAAAGGGGG + Intergenic
1046438467 8:114227205-114227227 CTCAGGAGGCAGAGAAAGAGAGG - Intergenic
1048162658 8:132035239-132035261 TTCAGTTTACAGAGAAACTGAGG - Intronic
1048365213 8:133732578-133732600 CCCAGGTCACAGAGGAAGAGGGG + Intergenic
1050170900 9:2815362-2815384 CTTGGGTTACAGAGAAAATGGGG + Intronic
1050320871 9:4450603-4450625 GTCAGGTTACCCACAAAGGGAGG + Intergenic
1050709287 9:8441724-8441746 ATCAGGTTAGAGAGAAGGGGAGG - Intronic
1050811155 9:9749388-9749410 CTCAGGAGACAGACAAATGGAGG - Intronic
1051736173 9:20201272-20201294 CACTGAATACAGAGAAAGGGAGG + Intergenic
1052599324 9:30604288-30604310 CACAGGTAACAGAGAACTGGAGG + Intergenic
1052860624 9:33435788-33435810 TTCAGGCTCCTGAGAAAGGGAGG - Intergenic
1053635879 9:40003253-40003275 ATCAGGAAACAGAGAGAGGGAGG + Intergenic
1053770105 9:41461384-41461406 ATCAGGAAACAGAGAGAGGGAGG - Intergenic
1054316757 9:63600356-63600378 ATCAGGAAACAGAGAGAGGGAGG + Intergenic
1054548777 9:66372875-66372897 ATCAGGAAACAGAGAGAGGGAGG - Intergenic
1056174815 9:84023885-84023907 GGCAGGGTAAAGAGAAAGGGAGG - Intergenic
1056252358 9:84762804-84762826 CTGAAGTGACAGAGAAAGTGTGG - Intronic
1056615866 9:88164917-88164939 CACACGTTATTGAGAAAGGGAGG - Intergenic
1059554050 9:115260763-115260785 CTCATGTAAGAGAGAAAGGGAGG + Intronic
1060152144 9:121295628-121295650 CCAAGGTTACAGAGGAAAGGAGG + Intronic
1060344456 9:122804088-122804110 CTCTGGGGACAGAGAAAGGATGG - Intronic
1061266954 9:129511683-129511705 CTCAGCTTCCAGGGAAGGGGAGG + Intergenic
1185525733 X:777364-777386 TTTTGGTTTCAGAGAAAGGGAGG + Intergenic
1186039697 X:5462372-5462394 CTGAGGTTACAGAAAGAGTGGGG + Intergenic
1186102914 X:6175835-6175857 CTGAGGTTACAGAAAGAGTGGGG - Intronic
1186295081 X:8140652-8140674 CTGAGGTTACAGAAAGAGTGGGG + Intergenic
1186584673 X:10859908-10859930 CTCAGGTGGCAGAGAGTGGGGGG + Intergenic
1187466868 X:19535277-19535299 CTCAGGTCCAAGAGAATGGGAGG - Exonic
1187998183 X:24951806-24951828 CTCAGTTTCCAGAGAAAGATTGG - Intronic
1189744004 X:44151117-44151139 CACAGGTTTCAGAGAAAGTATGG + Intronic
1190843459 X:54168442-54168464 CTCAGGTTGAAGAGAAAGTTAGG - Intronic
1190976202 X:55403951-55403973 CACAGGTTACACAGCAATGGAGG - Intergenic
1191161544 X:57335152-57335174 CTCAGATTACAGTGAAGGGATGG + Intronic
1193535221 X:82707015-82707037 GTCCGCTGACAGAGAAAGGGAGG - Intergenic
1197600479 X:128521059-128521081 CTCAGAATAGAGAGAGAGGGAGG + Intergenic
1197861416 X:130974891-130974913 CTCAGGCTATAGAGAAAAGCAGG - Intergenic
1199682032 X:150231788-150231810 CTCTGGGTACACAGACAGGGAGG + Intergenic
1199903727 X:152203877-152203899 GTTAGGTTACATGGAAAGGGGGG - Intronic
1199950196 X:152700426-152700448 CTCAGGTCACAGAGTAGAGGGGG + Intronic
1199959480 X:152768035-152768057 CTCAGGTCACAGAGTAGAGGGGG - Intronic
1200457317 Y:3408932-3408954 CTTGGGTTACACAGAAAGGAAGG - Intergenic
1200868144 Y:8067518-8067540 CTGAGGTTACAGGCATAGGGTGG + Intergenic
1201405241 Y:13643211-13643233 CTAAGGTGACACAGAAAGGAGGG + Intergenic
1202034579 Y:20619224-20619246 GTCAGGTTACCCACAAAGGGAGG - Intergenic