ID: 969476518

View in Genome Browser
Species Human (GRCh38)
Location 4:7425303-7425325
Sequence CTGTCTCCACAGCCGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969476509_969476518 26 Left 969476509 4:7425254-7425276 CCAGAGACCCCAGGACTGGCCTG 0: 1
1: 0
2: 9
3: 66
4: 529
Right 969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG No data
969476515_969476518 7 Left 969476515 4:7425273-7425295 CCTGTGTGGCCTTTGGCAAGCAC 0: 1
1: 0
2: 4
3: 30
4: 263
Right 969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG No data
969476512_969476518 18 Left 969476512 4:7425262-7425284 CCCAGGACTGGCCTGTGTGGCCT 0: 1
1: 1
2: 0
3: 29
4: 276
Right 969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG No data
969476511_969476518 19 Left 969476511 4:7425261-7425283 CCCCAGGACTGGCCTGTGTGGCC 0: 1
1: 0
2: 3
3: 31
4: 351
Right 969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG No data
969476513_969476518 17 Left 969476513 4:7425263-7425285 CCAGGACTGGCCTGTGTGGCCTT 0: 1
1: 1
2: 2
3: 43
4: 294
Right 969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG No data
969476516_969476518 -2 Left 969476516 4:7425282-7425304 CCTTTGGCAAGCACCTGCTCTCT 0: 1
1: 1
2: 1
3: 26
4: 275
Right 969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969476518 Original CRISPR CTGTCTCCACAGCCGCAGCC TGG Intronic
No off target data available for this crispr