ID: 969478909

View in Genome Browser
Species Human (GRCh38)
Location 4:7436574-7436596
Sequence GCCAAGAAGTCCTTCATTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969478909 Original CRISPR GCCAAGAAGTCCTTCATTAT CGG (reversed) Intronic
908246105 1:62228741-62228763 GTCAAGAACTCCTTCCTTAGTGG + Intergenic
909122171 1:71617170-71617192 GCTAAGAAGCCCTTCCCTATTGG + Intronic
912364455 1:109121740-109121762 GCAAAGAAGACCTCCATTATTGG - Intronic
914956804 1:152170030-152170052 GGCAAGAATTCCTACATTCTGGG - Intergenic
916255158 1:162779771-162779793 GCCAAGATGAACTTCAATATGGG + Intronic
918017106 1:180646275-180646297 GCTAAGAAGCCCTTTACTATTGG - Intronic
918676530 1:187293035-187293057 GCCAATAAGTCTGTCTTTATAGG - Intergenic
918751040 1:188269879-188269901 GCTAAGAAGCCCTTTACTATTGG - Intergenic
919090895 1:192978219-192978241 GCAAAGAAATCCTTTACTATTGG + Intergenic
920924981 1:210332519-210332541 GCTAAGAAGCCCTTTACTATTGG - Intronic
1068038438 10:51790947-51790969 GCTAAGAAGTTTTCCATTATAGG - Intronic
1068163434 10:53298045-53298067 GCTAAGAAGCCCTTTACTATTGG - Intergenic
1069463386 10:68615985-68616007 GCTAAGATGTCCTTATTTATAGG - Intronic
1073152229 10:101319887-101319909 GCCAAGACTTCCTTCCTTCTGGG - Intergenic
1073788812 10:106919094-106919116 GCCAATAATTCCATCACTATGGG - Intronic
1074421842 10:113315977-113315999 GTCAAGGAGACCTGCATTATAGG + Intergenic
1075765054 10:124886709-124886731 GCCAAGAAGTCCGTCTGGATTGG + Intergenic
1079696739 11:23491282-23491304 TCCAAGCTGTCCTTCATTCTTGG + Intergenic
1080761958 11:35259485-35259507 GCCAACAAATCCTTAATGATTGG - Exonic
1080932418 11:36825845-36825867 GACAATAAGTCCTTCATCAAAGG - Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1083237957 11:61364097-61364119 CCCAAGAAGTCATTTATTCTAGG - Intronic
1085074208 11:73575224-73575246 GCCTAGAAGTCCTTTAATTTTGG + Intronic
1085293795 11:75418993-75419015 GCAAAAAAGTCCTTAATTAAAGG - Intronic
1088667653 11:112109604-112109626 GCTAAGAAGCCCTTTACTATTGG - Intronic
1090194973 11:124807225-124807247 GCTAAGAAGCCCTTTAGTATTGG + Intergenic
1091315680 11:134612375-134612397 GCAAAGAAGTCCTTCAGGGTTGG - Intergenic
1091776407 12:3187796-3187818 TCCAAGAAGCCCTTCCTGATGGG + Intronic
1091912755 12:4245089-4245111 TCCGTGAAATCCTTCATTATGGG - Intergenic
1092293044 12:7175823-7175845 ACCAAGATGTCCTTCAGTAGAGG - Intergenic
1094737071 12:33246895-33246917 TCCAAGGTGACCTTCATTATAGG + Intergenic
1101549484 12:105748757-105748779 GCACTGAAATCCTTCATTATGGG + Intergenic
1103001004 12:117385248-117385270 GCAAAGAAATCCTCCATTGTAGG - Intronic
1104458485 12:128934779-128934801 GTCAAGAAGCCCTTCATTCAAGG + Intronic
1105480702 13:20773264-20773286 GACAGGAAGGCCTTCCTTATAGG - Intronic
1105895462 13:24713629-24713651 GCCTAGATGTCTTTTATTATAGG + Intergenic
1106623501 13:31394609-31394631 GCTAAGAAGTCCTTCGCTACTGG - Intergenic
1108932988 13:55853369-55853391 GCCATGCAGTCTTTCATTCTAGG - Intergenic
1110480426 13:75967857-75967879 GCCATGAATTCATTTATTATGGG + Intergenic
1113401323 13:109996382-109996404 GCTAAGAAGCCCTTTACTATTGG + Intergenic
1119030074 14:71185280-71185302 GCCAAGAATTCCTTTCTTAGTGG + Intergenic
1120007390 14:79374842-79374864 CCCAAGAAGTCTTGCATAATTGG - Intronic
1120141124 14:80930839-80930861 GCTAAGAAGTCCTTTACTATTGG + Intronic
1124638456 15:31379997-31380019 GGCCAGAAGTCCTTCTTTAGAGG - Intronic
1126763995 15:51995417-51995439 GACAAGAAGTCCTTCCATAAAGG + Intronic
1128487959 15:68115127-68115149 ACCAAGATGTCCTTCATTAAGGG - Intronic
1131631858 15:94185853-94185875 GCTAAGAAGCCCTTTACTATTGG - Intergenic
1135868944 16:26131088-26131110 GGCCAGAAGTCCTTAATGATGGG - Intronic
1138944628 16:61833823-61833845 GCCAAGAAGTCTTTCCAAATAGG + Intronic
1146704965 17:34994590-34994612 GCTGAGCAGCCCTTCATTATGGG - Intronic
1147391662 17:40112955-40112977 GCCAAGAATGCCCTAATTATGGG - Intergenic
1155252261 18:23963842-23963864 GCCAAGAACTCATTCATGAGGGG + Intergenic
1156079109 18:33313588-33313610 GCCAGGAAGTCCTTTATAACTGG + Intronic
1158641635 18:59208474-59208496 GCCAGAAAGTCCTTGGTTATGGG + Intergenic
1159709824 18:71743342-71743364 GGAAAGAAGTCCTTAATTAATGG + Intronic
1159792436 18:72799097-72799119 GCTAAGAAGCCCTTTATTATTGG + Intronic
926513797 2:13815643-13815665 GCCAAGTAGTTCTTGGTTATGGG + Intergenic
926824607 2:16891588-16891610 GCTAAGAAGCCCTTTACTATTGG + Intergenic
926887851 2:17614130-17614152 ACCAGGAAGTCCTTCAGTGTGGG + Intronic
928040480 2:27871140-27871162 GCTAAGAAGTCCTTTACTGTTGG - Intronic
931413279 2:62055696-62055718 GCTAAGAAGCCCTTTACTATTGG + Intronic
931819062 2:65933434-65933456 ACCAAAAAGTCCTTCCCTATAGG + Intergenic
936689818 2:114873150-114873172 GTAAAGAAGTCCTTTACTATTGG + Intronic
936951764 2:117984699-117984721 GCCAAGAACTTCTTCATTCTGGG + Intronic
937302661 2:120852679-120852701 GCCTAGAATTCCACCATTATAGG + Intronic
937480452 2:122252810-122252832 GCCAAGAACTACTTCAGTTTAGG + Intergenic
939306429 2:140417252-140417274 GCTAAGAAGCCCTTTACTATTGG + Intronic
939579459 2:143930851-143930873 TCCAAGACCTCCTGCATTATGGG + Intergenic
946108575 2:217393739-217393761 GCCAAGAATTCCTTCATCTGGGG + Intronic
947453292 2:230228300-230228322 GCCAAGATGTACTTCATTTTGGG - Intronic
948587685 2:239029466-239029488 GCCAAGACGTCTTTGAATATGGG + Intergenic
1169302245 20:4453431-4453453 GCCAAGAAGTCCTTAATTTAGGG - Intergenic
1170744106 20:19083057-19083079 GCTAAGAAGCCCTTTACTATTGG + Intergenic
1173182959 20:40818393-40818415 GCCAAGAAGTCTTTAATGAAGGG + Intergenic
1175765786 20:61591857-61591879 TCAGAAAAGTCCTTCATTATTGG + Intronic
1178089618 21:29148917-29148939 GACAAGCAGTCCTTCTTAATTGG + Intronic
1179100951 21:38355338-38355360 GCCAAGAAGACCTACATTTCAGG - Intergenic
1180115205 21:45698766-45698788 GCCAAAATCTCCTTGATTATGGG - Intronic
1180644381 22:17326484-17326506 ACCAAGATGTCCTTCAGTAGGGG + Intergenic
1182420575 22:30246679-30246701 GCCGCCAAGACCTTCATTATGGG + Exonic
1182974329 22:34608699-34608721 GCCAAGAAGCCCTTTACTGTTGG + Intergenic
953566072 3:44033082-44033104 GCCAAACAGTACTGCATTATTGG + Intergenic
957902207 3:86509105-86509127 ACCAAGATGTCCTTCAATAGGGG + Intergenic
963356501 3:144214741-144214763 GCTAAGAAGCCCTTTACTATTGG - Intergenic
963537583 3:146547082-146547104 GCTAAGAAGCCCTTTACTATTGG - Intergenic
964666354 3:159178433-159178455 GCCCAGAAGTCATTCCTGATGGG + Intronic
965292532 3:166901763-166901785 GTCAAGTAGTCTTTCATTTTAGG - Intergenic
965909991 3:173762277-173762299 ACAAAAAAGTACTTCATTATTGG - Intronic
966298106 3:178447277-178447299 ACCAAGAAGTCTTTAATTAAAGG - Intronic
967252216 3:187551995-187552017 ACCAAGAATTCCTTCAATAAAGG + Intergenic
967421793 3:189281353-189281375 GGGAAGAAGTCCTACATTGTTGG + Intronic
969478909 4:7436574-7436596 GCCAAGAAGTCCTTCATTATCGG - Intronic
972210650 4:36832483-36832505 GCCAATAAGTAATGCATTATAGG + Intergenic
973329514 4:48897865-48897887 GCAAAAATGTCCTTCAATATTGG + Intronic
975640051 4:76491305-76491327 GCCAAGAAGTCTTTCCAAATTGG - Intronic
976515347 4:85958024-85958046 ACCAATAAGTTTTTCATTATTGG + Intronic
978222317 4:106291697-106291719 GCTAAGAAGCCCTTTACTATCGG + Intronic
978316073 4:107438799-107438821 GCTAAGAAGCCCTTTACTATTGG - Intergenic
979623361 4:122820376-122820398 GCTAAGAAGCCCTTTACTATTGG - Intergenic
979841911 4:125452174-125452196 GTCAAGAAGTCCTTTACTGTTGG - Exonic
980111109 4:128637926-128637948 GCCAAGAAGATTTTCTTTATAGG - Intergenic
980860530 4:138494539-138494561 GCCCACAAGTCATTCATTTTTGG - Intergenic
983074011 4:163303028-163303050 GCAAACACGTCCTTCTTTATGGG + Intergenic
986350292 5:6871700-6871722 GCTAAGAAGCCCTTTACTATTGG - Intergenic
987993283 5:25243239-25243261 GCTAAGAAGCCCTTTACTATTGG - Intergenic
989333612 5:40288695-40288717 ACCAACAAGTCCTTCATTAAGGG + Intergenic
989556052 5:42796272-42796294 GCTAGGAAGCCCTTCATTGTGGG + Intronic
990097018 5:52128766-52128788 ACCAAGATGTCCTTCAGTATGGG + Intergenic
990110560 5:52318095-52318117 GCTAACAAGCCCTTCATAATAGG + Intergenic
992594468 5:78331685-78331707 TACAATAAGTCCTTTATTATGGG - Intergenic
992607618 5:78475250-78475272 GCTAAGAAGTTCTTTATTTTTGG + Intronic
995827176 5:116313730-116313752 GCCAAGAAGCAATCCATTATTGG - Intronic
995861539 5:116646114-116646136 GCTAAGAAGCCCTTTACTATTGG - Intergenic
997248884 5:132373793-132373815 GCCAAGAAGCACTGCATGATGGG - Intronic
998500454 5:142628022-142628044 GCAAAGGAGTCCTCCTTTATGGG + Intronic
1003006123 6:2383236-2383258 GACAAGAAGTTCTTCTTTGTTGG - Intergenic
1004775261 6:18837200-18837222 GCCAAGAAATAATTCATTTTGGG - Intergenic
1008224983 6:48903988-48904010 GCCAAGAATACATTCATTTTGGG - Intergenic
1009523696 6:64716645-64716667 GCCAAGAAGCTCTTCACTATTGG - Intronic
1011385164 6:86788624-86788646 CTGAAGAAGTCCTTCATTCTAGG - Intergenic
1011925462 6:92638787-92638809 GCTGAGAAATCCTTCATTGTTGG - Intergenic
1012333533 6:98024834-98024856 GCCATCAACTGCTTCATTATAGG + Intergenic
1012614438 6:101259332-101259354 GCTGAGAAGCCCTTTATTATTGG + Intergenic
1013036168 6:106385853-106385875 GCCAAGAAGCTCTTTACTATTGG - Intergenic
1013880997 6:114900611-114900633 GCCAAGGAGCCCTTTACTATTGG + Intergenic
1015092252 6:129372543-129372565 ACCAAGATGTCCTTCAGTAGGGG - Intronic
1015429111 6:133109631-133109653 GCATAGAAGTGCCTCATTATCGG + Intergenic
1027894055 7:84017853-84017875 GCCAAGAAATCCTAGATAATAGG - Intronic
1027934707 7:84587982-84588004 ACCAAGAATTCCTTAATAATGGG - Intergenic
1027947276 7:84764600-84764622 ACCAAGATGTCCTTCAATATAGG - Intergenic
1032130160 7:129221390-129221412 GCCAAGAAATTCTTCTTTATTGG + Intergenic
1035485395 7:159219943-159219965 GTCAAGATGTCCTTGTTTATGGG + Intergenic
1037464606 8:19148201-19148223 GGCAAGAAGTCCTTCCTTGATGG - Intergenic
1037715166 8:21391450-21391472 GCTTTGAAGTCCTTCATTTTGGG - Intergenic
1038339659 8:26674697-26674719 GCCAAGATGTTCTTCTTTACGGG + Intergenic
1051863751 9:21655144-21655166 GACAAGAAGTCCTTAATGGTGGG + Intergenic
1053151172 9:35744230-35744252 GCCAAGAGGTCCTTCCTTCTTGG + Intronic
1058155498 9:101510264-101510286 GCTAAGAAGCCCTTTACTATTGG - Intronic
1058229131 9:102404654-102404676 GCTAAGAAGCCCTTTACTATTGG + Intergenic
1060534779 9:124376211-124376233 ACCAAGAAGTCTTTAAATATTGG - Intronic
1061375862 9:130224143-130224165 GCCAAGAAACCCTTCTTTAAAGG + Intronic
1189436945 X:41001445-41001467 GGCAAGAAGTCCTTCACTGAAGG - Intergenic
1190159322 X:48018964-48018986 ACACAGAAGTCCTTCAATATGGG + Intronic
1190175035 X:48141192-48141214 ACACAGAAGTCCTTCAATATGGG + Intergenic
1190310945 X:49116671-49116693 GCCTAGAATTCCTTCCTTCTTGG + Intronic
1198024503 X:132692141-132692163 GCCTAAAATTACTTCATTATTGG - Intronic
1198035477 X:132797409-132797431 GCCAAGAACACCATCACTATTGG + Intronic