ID: 969482773

View in Genome Browser
Species Human (GRCh38)
Location 4:7455521-7455543
Sequence GGCGCATGACACTAACACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969482773_969482785 24 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482785 4:7455568-7455590 GGGTCAGGAGCTGTGTGTTGGGG 0: 20
1: 29
2: 9
3: 38
4: 332
969482773_969482780 3 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482780 4:7455547-7455569 TTAGGGTCAGGCACTGTGTTGGG 0: 2
1: 23
2: 28
3: 113
4: 623
969482773_969482779 2 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482779 4:7455546-7455568 GTTAGGGTCAGGCACTGTGTTGG 0: 2
1: 23
2: 17
3: 52
4: 205
969482773_969482783 22 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482783 4:7455566-7455588 TGGGGTCAGGAGCTGTGTGTTGG 0: 21
1: 29
2: 4
3: 90
4: 462
969482773_969482784 23 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482784 4:7455567-7455589 GGGGTCAGGAGCTGTGTGTTGGG 0: 22
1: 30
2: 6
3: 42
4: 353
969482773_969482777 -9 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482777 4:7455535-7455557 TCATGCGCCACGTTAGGGTCAGG 0: 3
1: 1
2: 0
3: 3
4: 24
969482773_969482786 29 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482786 4:7455573-7455595 AGGAGCTGTGTGTTGGGGTCAGG 0: 23
1: 23
2: 7
3: 47
4: 429
969482773_969482782 9 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482782 4:7455553-7455575 TCAGGCACTGTGTTGGGGTCAGG 0: 19
1: 15
2: 41
3: 121
4: 691
969482773_969482781 4 Left 969482773 4:7455521-7455543 CCTCCGTGTTAGTGTCATGCGCC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 969482781 4:7455548-7455570 TAGGGTCAGGCACTGTGTTGGGG 0: 2
1: 22
2: 16
3: 50
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969482773 Original CRISPR GGCGCATGACACTAACACGG AGG (reversed) Intronic
906756350 1:48319973-48319995 GGGGCATGACACTAAGGCAGGGG - Intronic
913514589 1:119593135-119593157 GGCAGATGACACTAAAATGGTGG + Intergenic
919044100 1:192429721-192429743 GGCACATCTCACTTACACGGTGG - Intergenic
922490031 1:226008768-226008790 GTCACATTACACTAACAAGGAGG - Intergenic
1067791784 10:49293730-49293752 GTGCCATGTCACTAACACGGTGG - Intergenic
1074761184 10:116668693-116668715 GGCTCATGAACCTAACACAGGGG - Intronic
1086184613 11:83998761-83998783 GGGGCAGGACTCTAAAACGGTGG - Intronic
1093205373 12:16242414-16242436 GGCGCTTGACACTAATCCTGAGG + Intronic
1119631598 14:76236918-76236940 GGTGCATTACACCAACAGGGAGG + Intronic
1120000190 14:79294130-79294152 GGAGCATGACACTAAAAGGAAGG + Intronic
1124179232 15:27457096-27457118 GCAGCTTGACACCAACACGGTGG + Intronic
1128078979 15:64845017-64845039 GGCACAGGACTCTGACACGGTGG + Intronic
1134917205 16:18083024-18083046 GGAGAAAAACACTAACACGGAGG - Intergenic
932578110 2:72973767-72973789 AGGGCATGTCACTAACACAGAGG - Intronic
947099661 2:226606362-226606384 GCCGCATGACACTACAACGGTGG + Intergenic
1182619108 22:31608738-31608760 GAAGCAGGACGCTAACACGGTGG - Intronic
949930965 3:9078114-9078136 TGAGCATGACACTAACAGGTAGG + Intronic
950464222 3:13143754-13143776 TGAGCATGACACTCACACTGAGG + Intergenic
962380786 3:134896929-134896951 GGAGCATGACACTCACCAGGAGG - Intronic
969453687 4:7288974-7288996 GCAGCATGACACAAACACTGTGG - Intronic
969482773 4:7455521-7455543 GGCGCATGACACTAACACGGAGG - Intronic
984226140 4:177037071-177037093 CGCGCATGAAACTGACACTGGGG + Intergenic
1001130305 5:169058212-169058234 GCCGCATGGCATTAACACAGTGG - Intronic
1057758402 9:97854295-97854317 GGCGCTTGACCCCAACGCGGAGG + Exonic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1188963226 X:36518740-36518762 GTCTAATGACACTAACACAGAGG - Intergenic