ID: 969482981

View in Genome Browser
Species Human (GRCh38)
Location 4:7456740-7456762
Sequence GGACAAGCAGCAGGCACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 273}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969482981_969482996 2 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG 0: 1
1: 0
2: 17
3: 198
4: 2573
969482981_969482987 -5 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482987 4:7456758-7456780 TGTCCCCCTGTGGCAGGGGTAGG 0: 1
1: 0
2: 2
3: 31
4: 312
969482981_969482986 -9 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482986 4:7456754-7456776 TGCTTGTCCCCCTGTGGCAGGGG 0: 1
1: 0
2: 2
3: 29
4: 1079
969482981_969482991 -2 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482991 4:7456761-7456783 CCCCCTGTGGCAGGGGTAGGGGG 0: 1
1: 0
2: 5
3: 28
4: 411
969482981_969482989 -3 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482989 4:7456760-7456782 TCCCCCTGTGGCAGGGGTAGGGG 0: 1
1: 0
2: 4
3: 34
4: 329
969482981_969482985 -10 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482985 4:7456753-7456775 CTGCTTGTCCCCCTGTGGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 221
969482981_969482999 29 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482981_969482997 5 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482997 4:7456768-7456790 TGGCAGGGGTAGGGGGGTGGAGG 0: 1
1: 3
2: 61
3: 353
4: 2497
969482981_969482988 -4 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482988 4:7456759-7456781 GTCCCCCTGTGGCAGGGGTAGGG 0: 1
1: 0
2: 1
3: 25
4: 227
969482981_969482998 6 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482998 4:7456769-7456791 GGCAGGGGTAGGGGGGTGGAGGG 0: 1
1: 1
2: 23
3: 245
4: 2440
969482981_969482993 -1 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482993 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 1
3: 54
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969482981 Original CRISPR GGACAAGCAGCAGGCACCCA AGG (reversed) Intronic
900392745 1:2440858-2440880 GGCCAAGCACCAGGGACCCAGGG - Intronic
900557628 1:3288251-3288273 GGACAAGCAGCTGAGACCTAGGG + Intronic
900605269 1:3521061-3521083 GGACAAGGAACATGCCCCCACGG - Intronic
900628597 1:3621732-3621754 GGAAAAGCCGTAGGCACTCAGGG + Intergenic
902219202 1:14954099-14954121 GGCCATGCAGCAGGTCCCCAGGG - Intronic
902633093 1:17717558-17717580 GGAGGAGCAGGAGGCAGCCATGG - Intergenic
903336881 1:22630529-22630551 GAACAGGCAGAAGGCACCAATGG + Intergenic
903463205 1:23533700-23533722 GGGGAAGCAGCAGGGCCCCAGGG + Intergenic
903946473 1:26967036-26967058 AGGCAAGCAGCAGATACCCAGGG - Intergenic
904280754 1:29416713-29416735 GGACAGGCGGAAGGCATCCATGG + Intergenic
904357998 1:29953922-29953944 GGAGTACCAGCAGACACCCAAGG - Intergenic
904882319 1:33710271-33710293 GGACAGGCAGCAAGCAATCAAGG - Intronic
905516092 1:38563199-38563221 GGACAAGGAGCAGCCAAGCAGGG - Intergenic
906463827 1:46058450-46058472 GGAAAAGCCGCAGACACTCAAGG + Intronic
906772318 1:48496005-48496027 GGACAAGCAGGACCCACTCATGG + Intergenic
907347615 1:53795914-53795936 AGAAAGGTAGCAGGCACCCAGGG - Intronic
909586253 1:77291950-77291972 TGACAAGAAGCAGTCAGCCATGG + Intronic
909599704 1:77448628-77448650 GGACAAGCACTTGGAACCCATGG + Intronic
913209112 1:116569123-116569145 GTACAGGCAGCAGTGACCCAAGG + Intronic
914299488 1:146366321-146366343 TGGCAAGCAGCAGGAACCCCAGG + Intergenic
914428058 1:147596866-147596888 GTACAAGCAGCAGGAGCCCATGG + Intronic
914637150 1:149562236-149562258 TGACAAGCAGCGGGAACCCCAGG - Intergenic
919978936 1:202630466-202630488 GGAAGAGCAGCAGGGAGCCAAGG + Intronic
920533711 1:206723608-206723630 AGGAAAGCAGCCGGCACCCAGGG - Intronic
922622577 1:227001333-227001355 GGACAAGCAGCTGGTAACCAGGG + Intronic
922709089 1:227813728-227813750 GGAAAAGCTGCAGTCACTCAAGG - Intergenic
1062861629 10:814994-815016 GCACAAGAAGCCGGCACCGAGGG + Exonic
1063384396 10:5606984-5607006 AGAAAGGCAGCAGGCAACCAGGG + Intergenic
1064007099 10:11707567-11707589 GGAAGAGCTGCAGGAACCCAGGG - Intergenic
1064143255 10:12807642-12807664 GGACAAGGAGCAGGTAGCCGGGG - Intronic
1066425293 10:35302659-35302681 AAACAACTAGCAGGCACCCAAGG + Intronic
1067523276 10:47023532-47023554 GAGCAGGCAGGAGGCACCCAGGG + Intergenic
1068829203 10:61473505-61473527 GGACAAGCAAAAGGAACCCAGGG - Intergenic
1068980334 10:63056157-63056179 GGACCTGCAGCAGCCTCCCAGGG + Intergenic
1069691301 10:70354725-70354747 GGGGAAGCAGGAGGAACCCAGGG - Intronic
1069903871 10:71720905-71720927 GGGCAGGCAGTAGGCATCCAGGG + Intronic
1070595413 10:77829460-77829482 GGACAAGAAGCAGGCCATCAAGG - Exonic
1070703328 10:78619016-78619038 GGACAAGCAGGAGACATCCAGGG + Intergenic
1070806986 10:79276482-79276504 GGCCAAGCAGGAGGCAGCCAGGG - Intronic
1073192832 10:101663991-101664013 GGAGAACCAGCAGGCTCCAAAGG - Intronic
1073465902 10:103694321-103694343 GAAGAGGCAGCAGGCTCCCAGGG + Intronic
1073818281 10:107231771-107231793 GGACAATCGGCAGTCACACAGGG + Intergenic
1075281613 10:121143724-121143746 GGAAAAGCTGCAGACACTCAAGG - Intergenic
1075603899 10:123790618-123790640 GGACAGGCTGCAGCCAACCAGGG + Intronic
1076735189 10:132455836-132455858 AGACTAGCAGCTGGCTCCCAAGG - Intergenic
1077065827 11:640584-640606 GGCTCAGCAGCAGGCACGCAGGG - Exonic
1077418223 11:2435929-2435951 GAACAGGCAGCAGGTAGCCATGG + Intergenic
1081154990 11:39679653-39679675 TGACAAACAGCAGGCACTCAAGG - Intergenic
1083083771 11:60121358-60121380 AGGTAAGCAGCAGGCAACCAGGG + Intergenic
1083224807 11:61278154-61278176 AGACAGCCAGCAGGCACACAGGG - Intronic
1083476978 11:62921263-62921285 GGAGACGCCGCAGGCCCCCAGGG - Exonic
1083491041 11:63015395-63015417 GGACACGTAGCAGGGACCAAGGG + Intronic
1084204814 11:67585151-67585173 GGACCAGCAGGAGGCAGCCCTGG + Exonic
1084208901 11:67611862-67611884 GGGCAATTAGCAGGCACCCACGG - Intronic
1084276381 11:68053198-68053220 GGTCAAGCAGCTGGCTCCCCTGG + Exonic
1084470312 11:69355618-69355640 GAACAAGCTGCAGGCTACCAGGG - Intronic
1087148002 11:94831206-94831228 GCACGAGCAGCAGGCAGCTAGGG - Intronic
1087704935 11:101479373-101479395 GGACATGTAGCAGGAACACAGGG - Intronic
1088416218 11:109591905-109591927 GGACAAGGAAGAGGCACCCCAGG + Intergenic
1088972660 11:114787338-114787360 GGAACTGCACCAGGCACCCACGG - Intergenic
1089049755 11:115536033-115536055 GGACAAGAAGCAAGCAGCCAGGG - Intergenic
1089331518 11:117692190-117692212 GGCCAAGCAGCAGGGAGGCAAGG - Intronic
1090991335 11:131819655-131819677 GGACAAGCTGCAGGCTTTCATGG - Intronic
1091679281 12:2515081-2515103 GGACAAGAAACAGACCCCCAGGG - Intronic
1095764703 12:45881708-45881730 GGGCAAGGAGCAGGCAGCCTTGG - Intronic
1096231079 12:49897305-49897327 AGACACCCAGAAGGCACCCAGGG + Intronic
1104956018 12:132466187-132466209 GGACGGGCAGCAGAGACCCAGGG - Intergenic
1105438251 13:20395400-20395422 GGACACGCAGCATGCACACATGG - Intergenic
1108979457 13:56492172-56492194 GGAAAAGCTGCAGGCACTTAAGG - Intergenic
1111222343 13:85220876-85220898 GGAAAAGCCACAGGCACTCATGG + Intergenic
1113608854 13:111629157-111629179 GGACAAACAGCTGGCAGTCAAGG + Intronic
1113628788 13:111865999-111866021 GGACAACCAGCCGGCACACCGGG - Intergenic
1113647026 13:112005333-112005355 GGGCTGGCAGCAGGCACCCAAGG + Intergenic
1113970678 13:114185957-114185979 GGACAGGCAGCTGGAACCCCAGG - Intergenic
1114672251 14:24417480-24417502 GGCCTAGCAGCAGAAACCCACGG - Exonic
1119019051 14:71090859-71090881 AGACTAGGGGCAGGCACCCAAGG - Intronic
1119265584 14:73261790-73261812 GGGCTCGCAGGAGGCACCCATGG + Intronic
1121016289 14:90551318-90551340 GGACAAGCAGAAAGCAGCTAGGG - Intronic
1121416585 14:93783481-93783503 GGACAAGCTCCAGACACCCGAGG - Intronic
1121636105 14:95454926-95454948 GGCCAAGCAGCAGAGGCCCACGG - Intronic
1121666381 14:95675582-95675604 GGAAAAGCTCCAGGCACACAAGG + Intergenic
1122920543 14:104878172-104878194 GGGCAAGCAGCAGGTACCCGTGG - Intronic
1124494533 15:30178354-30178376 GGAAAAGCAGCAGGGAGCCAAGG + Intergenic
1124749037 15:32360291-32360313 GGAAAAGCAGCAGGGAGCCAAGG - Intergenic
1125994565 15:44145723-44145745 TGATAAGCAGCAGGAACACATGG + Intronic
1126781468 15:52142761-52142783 GGAAAAGCAGAAGGGACCCTTGG - Intronic
1127361565 15:58248836-58248858 GGCCAGGCACCAGGCAACCAGGG - Intronic
1127937306 15:63654281-63654303 GGAGAGGCAGCAGGCTGCCAGGG + Exonic
1128705700 15:69836286-69836308 GGACAAGCAGCAGGGAGCACGGG - Intergenic
1128760710 15:70214436-70214458 GGACAGCCAGTAGGGACCCAGGG + Intergenic
1129263906 15:74383776-74383798 GGAGTCACAGCAGGCACCCAGGG + Intergenic
1131442707 15:92470995-92471017 AGACAAGGAGCAGGCTCCCCAGG - Intergenic
1132394651 15:101463914-101463936 GGAGAACCAGAAGGCCCCCATGG + Intronic
1132573420 16:653900-653922 GGACACAGAGCAGGGACCCAGGG - Intronic
1132598897 16:765250-765272 GGACCAGCAGGAGGCAGCCAGGG + Exonic
1133430962 16:5736433-5736455 GGACAAGCAGCAGCCCCATATGG - Intergenic
1134336859 16:13308359-13308381 GGACAAGAGACTGGCACCCATGG + Intergenic
1136023169 16:27452956-27452978 GCAGATGCAGCAGGCACCCACGG - Intergenic
1137750815 16:50859887-50859909 GGACAAGCAGCAGAGACCTTTGG - Intergenic
1139491097 16:67286444-67286466 GGACAAGCAGCAAGCACTGGGGG + Exonic
1139737382 16:69003090-69003112 GGACAAGCAGCTGACACCTCTGG + Intronic
1139779680 16:69340106-69340128 GGGCAGGCAGCATGGACCCAGGG + Intronic
1139922794 16:70470443-70470465 AGACAACCAGCAGGCACCGGAGG - Intronic
1140031899 16:71345617-71345639 AGGCAAGCAGCTGGCACCCAGGG + Intergenic
1141131998 16:81443816-81443838 TCACAAGCAGCCGGCACCTAAGG - Intergenic
1141983135 16:87562177-87562199 GGACAAGCAGTTGGCTCCCCTGG - Intergenic
1142242175 16:88952569-88952591 GGGCGAGCAGCAGGCACCCCAGG - Intronic
1142524885 17:533182-533204 GGACAAACAACAGTCACCAAAGG - Intronic
1142840178 17:2622627-2622649 GGAAAAGCTGCAGACACTCAAGG - Intronic
1144702462 17:17348353-17348375 AGACAAGGGGAAGGCACCCATGG + Intergenic
1147335810 17:39726503-39726525 GGAGAGGCAGCAAGCACACAGGG + Intronic
1150717107 17:67581441-67581463 AGACAAGCAGCAGGTCCCCTGGG - Intronic
1151055224 17:71022973-71022995 TGATAAGAAGCAGGCAGCCAAGG - Intergenic
1151214974 17:72571197-72571219 AGACAAGTGGCAGGCACCGATGG + Intergenic
1151268232 17:72973076-72973098 GGACAAGCAGAAGGCAGCTTGGG - Intronic
1151532455 17:74715431-74715453 TGACATGCAGCAGGGACCAAAGG - Intronic
1151783666 17:76264978-76265000 GGCCAATCAGCAGGCACTCCGGG + Intergenic
1151955697 17:77379164-77379186 GGGCAAGCAGCACGCAGCCTTGG - Intronic
1152577608 17:81149679-81149701 GCACAGGCTCCAGGCACCCAGGG - Intronic
1152797583 17:82315700-82315722 AGACAAACAGCAGGGACCGAGGG + Intronic
1152907757 17:82978203-82978225 GGAGAAGCAGAAGGGACCCCAGG - Intronic
1155027698 18:21957453-21957475 AGACATGCGGCATGCACCCATGG - Intergenic
1156377116 18:36524648-36524670 GGACCAGCAGGATGCACACATGG - Intronic
1158939742 18:62396332-62396354 GGACAATGAGCAGGCATCCATGG + Intergenic
1161027492 19:2043244-2043266 GGCCGGGCAGCAGGTACCCAGGG - Intronic
1161231848 19:3178550-3178572 GGACAGGAAGAAGGCAGCCAGGG + Intronic
1161447425 19:4326531-4326553 GGACAAGCAGTAGCCCCACAGGG - Intronic
1161574727 19:5049088-5049110 GACCTAGCAGCAGGCACCCCCGG - Intronic
1161704719 19:5814266-5814288 GGGCAAGAGGAAGGCACCCATGG + Intergenic
1162028857 19:7908931-7908953 GGGCAGGCAGCAGGCACCCTGGG - Intronic
1162389465 19:10380554-10380576 GGACAAGCAGTAGCTACCCGCGG - Exonic
1163322914 19:16585164-16585186 GCAGAAACAGCAGGCACCCCTGG + Intronic
1163603816 19:18263677-18263699 AGGCCAGCAGCAGGCATCCAGGG - Intronic
1164638905 19:29811317-29811339 GGAATAGCAGCCGGCCCCCAGGG + Intergenic
1165004229 19:32791362-32791384 GGAGGAGCAGCAGGCCACCAGGG + Intronic
1166081775 19:40448126-40448148 GGACACACAGTAGGCACCCTGGG - Intronic
1166268942 19:41701735-41701757 GGACAGGCATCAGGGACTCAAGG - Intronic
1166417513 19:42606972-42606994 GGACAGGCATCAGGAACCCCAGG + Intronic
1166567515 19:43774244-43774266 GGCCGAGCAGCAGGCGGCCAGGG + Exonic
927495738 2:23550355-23550377 GGACAAGCAGGAGGCCCCCCAGG + Intronic
927865475 2:26584874-26584896 GAACTAGCAGCCGGCACACACGG - Intronic
928380250 2:30811477-30811499 GGACAACCAGCAGACACTCTCGG - Intronic
930479378 2:51927096-51927118 GGAGAAGCTGTAGGCAGCCAAGG - Intergenic
934751934 2:96799328-96799350 GGGCAGGCAGCAGGCTCCCCAGG - Intronic
934762522 2:96864445-96864467 GGGCAAGCAGCAGGAAGGCAGGG + Intronic
937545967 2:123021313-123021335 GAACATGCAGCAGGGAACCAAGG + Intergenic
938010988 2:127828782-127828804 GGAAAAGCTGCAGACACTCAAGG + Intergenic
939985633 2:148827176-148827198 GGCCAGGCTGCATGCACCCAGGG + Intergenic
943759912 2:191596717-191596739 GGTGAAGCAGCAGGCTCCTAGGG + Intergenic
944017121 2:195054645-195054667 GGACATGTAGCAGGGACCTAAGG - Intergenic
944551057 2:200845088-200845110 GGCCAGCCAGCAGGCAGCCAAGG + Intergenic
945058953 2:205891852-205891874 GGAAGAACAGCACGCACCCAGGG + Intergenic
945270145 2:207930170-207930192 GGGAAAGCAGCCTGCACCCACGG + Intronic
946034104 2:216728213-216728235 GAACAAGAAGCATGCAGCCATGG - Intergenic
946165960 2:217863973-217863995 GGACAAGCTTCAGGCACCCCTGG + Intronic
947670513 2:231932791-231932813 GGTCAAGCAGTGGGCACCGAGGG - Intergenic
948454902 2:238100422-238100444 GGAGAAGCAGCGGGCACTCGTGG + Exonic
949026838 2:241770328-241770350 GGGCCAGCAGCAGCCACCCAGGG - Intergenic
1169257620 20:4111019-4111041 TGACAAGCAGCTGGCACCTGGGG - Intergenic
1170572181 20:17638636-17638658 TGACAAGCAGAAGGAACCCTGGG - Intronic
1171485274 20:25481437-25481459 GGACAAGCTCCAAGGACCCAGGG - Intronic
1172484270 20:35288856-35288878 GGGCAAGGAGCAGGTACACAGGG + Exonic
1173182029 20:40813058-40813080 GGAAGAGCACCAGGCACCCGAGG + Intergenic
1173927637 20:46792565-46792587 GGACGAGAAGCAGGTAGCCATGG - Intergenic
1173981928 20:47231139-47231161 GTCCCTGCAGCAGGCACCCAGGG + Intronic
1174063934 20:47851502-47851524 GGACAAGCCCCAGCCTCCCAAGG + Intergenic
1174066244 20:47867876-47867898 GGATAAGGAGCAGGTGCCCACGG + Intergenic
1175375214 20:58519435-58519457 GGACTAGTGGGAGGCACCCAGGG - Intergenic
1176050896 20:63119297-63119319 GGGCATGGAGCAGGGACCCACGG + Intergenic
1178695293 21:34787617-34787639 GGAAAAGGCGCAGGCTCCCAGGG - Intergenic
1180021212 21:45128754-45128776 GAACAAGCAGGAGGGACTCATGG - Intronic
1180927541 22:19566683-19566705 GGGCACGCAGTAGCCACCCACGG + Intergenic
1181286086 22:21753603-21753625 CCACAAGCAGCAGGCACACGTGG - Intergenic
1182548141 22:31087269-31087291 GTAGAAGCAGCTGTCACCCAGGG + Intronic
1184275157 22:43405727-43405749 GGGCCAGCAGCAGGAACCCTGGG - Intergenic
1184322859 22:43756421-43756443 GGACAAGCAGATGGAACCCAGGG - Intronic
1184391581 22:44206375-44206397 GCACACGCAGAAGGCACACAGGG + Exonic
1184453268 22:44595250-44595272 GGAAAAGCAGCATGCAGCGAGGG + Intergenic
1185366547 22:50439493-50439515 TGACAAGCTGCCGACACCCATGG - Intronic
950149474 3:10675603-10675625 GGACAAGTCACAGGCACCCTGGG - Intronic
950181296 3:10915295-10915317 GGGGAAGCAGAAGGGACCCATGG - Intronic
950890329 3:16398852-16398874 GGAGAAGCAGAAGGTAACCAAGG - Intronic
951836505 3:26989052-26989074 GGGAAAGCAGCAGGCACTGAAGG + Intergenic
952188571 3:30997631-30997653 GCAAAAGCAGCAGGGAGCCATGG - Intergenic
954420724 3:50417723-50417745 GGACAAGCAGCAGGGGGGCAAGG - Intronic
954690156 3:52391445-52391467 GTACAAGCAGCAGGGAAACACGG + Exonic
956427912 3:69155660-69155682 GGACCAGCTGCAAGCACCCCCGG - Intergenic
958911082 3:99995433-99995455 GGAAAAGCAGCAGATACTCAAGG - Intronic
960988229 3:123294280-123294302 AGACAAGCAGGAGCCACCAATGG + Intronic
961012848 3:123447913-123447935 CGCCAGGCAGCAGGCGCCCAGGG + Exonic
961065930 3:123877488-123877510 GGATAATCAGCAGGCCCACAGGG + Intronic
961452050 3:127006645-127006667 CCAGAAGCAGCAGGTACCCAGGG - Intronic
961488154 3:127232010-127232032 GGAGAAGCTGCAGGCATCCCAGG - Intergenic
963140425 3:141942145-141942167 GGACAATCAGAAGGCACAGAAGG - Intergenic
963388867 3:144632212-144632234 GGAAAAGCTGCAGACACTCAAGG + Intergenic
964607500 3:158572910-158572932 TGGAAAGCAGCAGGCACCCCGGG - Intronic
967997074 3:195174738-195174760 GGACGAGGAGGAGGCAGCCAAGG - Intronic
968584553 4:1410115-1410137 GGAAAGGCAGCAGGGTCCCAGGG + Intergenic
969269597 4:6090247-6090269 GGACAAGCTGCAGACATGCAGGG + Intronic
969390081 4:6886161-6886183 GCAGCAGCAGCAGGCACACAGGG - Intergenic
969482981 4:7456740-7456762 GGACAAGCAGCAGGCACCCAAGG - Intronic
969660085 4:8522301-8522323 GGAGAAGCAGCAGATACTCATGG - Intergenic
969699649 4:8761192-8761214 GGAGCAGCAGCAGGGACTCAGGG - Intergenic
977612450 4:99050233-99050255 GGACTAGCAGCAGGCAGTCCAGG + Intronic
982104638 4:152000741-152000763 GGCCAAGGAGCAGTCAACCATGG - Intergenic
982116119 4:152099740-152099762 GGGCCAGCAGGAGTCACCCAAGG + Intergenic
985538385 5:476760-476782 GGGCACGCAGGAGGCAGCCAGGG - Intronic
985560072 5:580873-580895 GCACAAGCAGCCGGAACTCAGGG + Intergenic
985643999 5:1076590-1076612 GGACAAGCAGTAGACAGGCATGG - Intronic
985722246 5:1495633-1495655 TGACACGCAGCAGACAGCCACGG + Intronic
985850318 5:2383797-2383819 GGTCCTGCAGTAGGCACCCAGGG + Intergenic
985876871 5:2606658-2606680 GGAGGAGCACCTGGCACCCAAGG - Intergenic
989812848 5:45697553-45697575 GGAGAAGGGGCAGGCACTCAAGG + Intergenic
990328266 5:54699256-54699278 GGAATACCAGGAGGCACCCAGGG + Intergenic
990389762 5:55307332-55307354 GGACAAGCAGCAAGGTCTCAGGG + Intronic
992155983 5:73955633-73955655 GGAAAAGCAGCAGGCAGACCAGG + Intergenic
992451376 5:76879313-76879335 GGACCAGAAGCAGGCAAGCAAGG - Intronic
993799926 5:92319893-92319915 GGAAAAGCTGCAAGCACTCAAGG + Intergenic
999368253 5:151036941-151036963 GGACCATCAGCAGGAACCCCTGG + Intronic
1000472354 5:161660933-161660955 TCACAGGCAGCCGGCACCCATGG + Intronic
1001712494 5:173789832-173789854 GGACAAGTGGGAGGGACCCAAGG + Intergenic
1002059856 5:176619947-176619969 GGACTAGCAGGAGGCGCCCGAGG + Intergenic
1002397768 5:178971408-178971430 GGCCGAGCACCAGGCACCTAGGG - Intergenic
1002581707 5:180212742-180212764 GGACAGGCAGCAGGCCCACGAGG + Intergenic
1004075687 6:12342220-12342242 GGAGAAGGAGGTGGCACCCAGGG - Intergenic
1005282260 6:24286752-24286774 GGCCAAGAAGAAGGCAGCCAGGG - Intronic
1006039228 6:31239972-31239994 TGACAAGCACCTGGCACCCTTGG - Intergenic
1006581625 6:35080867-35080889 GGAGAAGCAGCAGGGAGCGAAGG - Intronic
1006947245 6:37792943-37792965 GGACAAGAAGCAGAGAGCCAGGG - Intergenic
1007686242 6:43668899-43668921 GGACAAGAAGCACAGACCCAGGG - Intronic
1017185470 6:151596412-151596434 GGAGGAGAAGCAGGCACGCACGG + Exonic
1018919564 6:168161717-168161739 GGGAAAGCAGCGGGCACCAAAGG - Intergenic
1019542066 7:1555990-1556012 GGAGATGGAACAGGCACCCAGGG - Intronic
1019897205 7:3991722-3991744 GAACAGGCAGGAGGCAACCATGG - Intronic
1021624099 7:22575843-22575865 GGAAAAGCAGCAGGCATTCAAGG - Intronic
1021782691 7:24121215-24121237 GGACAGGCAGCAGGCAGCTCTGG - Intergenic
1023662272 7:42481998-42482020 GGCCAAGCAGAAGGAACACAGGG - Intergenic
1024317612 7:48035809-48035831 GGATAAGCAACAGGTAACCAAGG - Intronic
1024792305 7:52980380-52980402 GGTCAAGCAGCAAGCAGACAGGG - Intergenic
1024965310 7:55018883-55018905 GAACCAGCAGCGGGGACCCAAGG - Intergenic
1025115481 7:56254617-56254639 GGACAAGCTGGAGGCATGCAGGG - Intergenic
1026199869 7:68205487-68205509 GGACAAGCTGGAGGCATGCAGGG - Intergenic
1029432236 7:100539011-100539033 GGACAAGGAGAGGGCACGCACGG + Intergenic
1030052649 7:105552513-105552535 GGACAACAAGCAGGCCCACAAGG - Intronic
1030270246 7:107661912-107661934 GGAGAAGCAGCTGGCGCCCAGGG - Intronic
1032366815 7:131307455-131307477 GGAAAAGCTGCAGGAACTCAAGG + Intronic
1032425424 7:131818827-131818849 GGACAAGTCGCAGGGACCTAAGG + Intergenic
1034086780 7:148329120-148329142 GGACACCCAGCAGGCTCCCCAGG + Intronic
1034174755 7:149091284-149091306 GGACAAGCATGGGGCCCCCACGG - Intergenic
1034475283 7:151277934-151277956 AGGCAGGCAGCAGGGACCCATGG + Intergenic
1035381402 7:158443648-158443670 GGACAAGCAGCTCGCACGCTTGG - Intronic
1035725855 8:1824353-1824375 GGACTGGCAGCAGGGACCCCTGG + Intronic
1036501387 8:9317760-9317782 GGATAAGAAGCAGTTACCCAGGG - Intergenic
1037287932 8:17320846-17320868 GCCCAAACAGCAGGCGCCCAGGG - Intronic
1040286212 8:46101715-46101737 GGGAAAGCCGCAGGCACTCAGGG - Intergenic
1040286290 8:46102133-46102155 GGGCAAGCAGCAGGGACTCAGGG - Intergenic
1040293117 8:46135610-46135632 GGACAAGCCGCAGAGACTCAGGG - Intergenic
1040301729 8:46191532-46191554 GGACAGGTAGCAGGAACTCATGG + Intergenic
1040303367 8:46199627-46199649 GGGCAAGCCGCAGGGACTCAGGG + Intergenic
1040308492 8:46224444-46224466 GGAGAAGCAGCAAGAACCCAGGG + Intergenic
1040308951 8:46226765-46226787 GGAAAAGCAGCAAGAACGCAGGG + Intergenic
1040309394 8:46228937-46228959 GGACAAGCAGCGAGCCCACAAGG + Intergenic
1040312692 8:46244892-46244914 GGACAGGCCGCAGGGACTCAGGG + Intergenic
1040314112 8:46251909-46251931 GGACATGCCGCAGGGACACATGG + Intergenic
1040317753 8:46273922-46273944 GGACAAGCTGCAGGGACTCAGGG + Intergenic
1040336159 8:46417064-46417086 GGGCAAGCGGCAGGGACTCAGGG + Intergenic
1040341762 8:46444639-46444661 GGACAAGTGGCAGGGACTCAGGG - Intergenic
1040385574 8:46912913-46912935 GGACGAGGAGCAGGCACACTGGG - Intergenic
1041179076 8:55229172-55229194 AGGCAGGCAGCAGGCAGCCATGG + Intronic
1041381537 8:57258553-57258575 TCACAAGCAGCAGGAACCCGAGG + Intergenic
1041694458 8:60720979-60721001 GGAAAAGCAGCAGCCGCCAACGG - Intronic
1042346452 8:67732863-67732885 GGACAAGCAGCAGGGTGACATGG - Intronic
1042873740 8:73421416-73421438 GGACAATAACCAGGCACCCCCGG - Exonic
1044762844 8:95539988-95540010 GGAAAAGCAGAAGGAATCCAAGG - Intergenic
1044769521 8:95616271-95616293 GGAAAAAAAGCAGGTACCCAAGG - Intergenic
1044997062 8:97847353-97847375 TGACAAGCAGCAGCTACTCAAGG - Intronic
1047769476 8:128019128-128019150 GGACCAGCTGAAGGCAGCCACGG + Intergenic
1049012630 8:139897545-139897567 GGAAAAGCAGCAGGCATTTATGG - Intronic
1049346846 8:142143781-142143803 TGTCACGCAGCAGGCAGCCAGGG + Intergenic
1049566733 8:143344232-143344254 GGAAGGGCAGCAGACACCCACGG + Intronic
1049800377 8:144514856-144514878 GGACAAGCAGCAGTTGCCCTTGG + Intronic
1050099183 9:2100079-2100101 GGAAAAGCTGCAGGGATCCAGGG + Intronic
1053598163 9:39584858-39584880 GGACCAGCACCAGGTACCCCAGG - Intergenic
1053856190 9:42341866-42341888 GGACCAGCACCAGGTACCCCAGG - Intergenic
1056864172 9:90214660-90214682 GATCACGCAGCGGGCACCCACGG - Intergenic
1057111802 9:92479128-92479150 GGAGAAGGAGAAGGCACACAGGG + Intronic
1057676558 9:97140574-97140596 GGAAAAGCTACAGGCACTCAAGG + Intergenic
1058538488 9:105988450-105988472 GGAGAAGCTGCTGGAACCCAGGG + Intergenic
1058770176 9:108223410-108223432 GGAGAAGCTGCAGGCTACCAAGG + Intergenic
1060053424 9:120392932-120392954 GGACGAGCAGCAGGGACCGGCGG - Intronic
1060485715 9:124045286-124045308 GGGCACGCAGCAGGCATTCATGG + Intergenic
1060901188 9:127259591-127259613 GGCCAAGCAGCAGGCTTCCCAGG - Intronic
1061690024 9:132319882-132319904 GGACAGGGAGCAGGCAGGCAAGG - Intronic
1062205040 9:135331587-135331609 GGAAATGCAGAGGGCACCCAGGG + Intergenic
1062572071 9:137190370-137190392 GGGCAAGCAGCAGGCTGGCACGG - Exonic
1062632199 9:137468208-137468230 GACCAGGCAGCCGGCACCCAGGG + Intronic
1187400401 X:18954461-18954483 GGACAAGCATCTGTTACCCAGGG - Intronic
1189364861 X:40380579-40380601 GGACAGGCAGCAGGAGCCCCTGG + Intergenic
1190190998 X:48277400-48277422 GGACAAGGAGCAGGGTCTCAGGG - Intronic
1191184348 X:57592968-57592990 GGTCCAGCCGCAGCCACCCAGGG - Exonic
1191213046 X:57909491-57909513 GGTCCAGCCGCAGCCACCCAGGG + Exonic
1195877523 X:109557712-109557734 GGACAGGCAACAGAAACCCACGG - Intergenic
1198429317 X:136549591-136549613 GGTCAGGGAGCAGGAACCCAAGG - Intronic