ID: 969482983

View in Genome Browser
Species Human (GRCh38)
Location 4:7456749-7456771
Sequence GCCACAGGGGGACAAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 246}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969482983_969483002 28 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969483002 4:7456800-7456822 CGACGATCAGTGTGGAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 74
969482983_969483000 23 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969483000 4:7456795-7456817 TCTCTCGACGATCAGTGTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 35
969482983_969482993 -10 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969482993 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 1
3: 54
4: 459
969482983_969482998 -3 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969482998 4:7456769-7456791 GGCAGGGGTAGGGGGGTGGAGGG 0: 1
1: 1
2: 23
3: 245
4: 2440
969482983_969482996 -7 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG 0: 1
1: 0
2: 17
3: 198
4: 2573
969482983_969483001 24 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969483001 4:7456796-7456818 CTCTCGACGATCAGTGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 30
969482983_969482997 -4 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969482997 4:7456768-7456790 TGGCAGGGGTAGGGGGGTGGAGG 0: 1
1: 3
2: 61
3: 353
4: 2497
969482983_969482999 20 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969482983 Original CRISPR GCCACAGGGGGACAAGCAGC AGG (reversed) Intronic
900296896 1:1956405-1956427 GCCTCAGGGGCAGCAGCAGCAGG - Intronic
900635661 1:3663853-3663875 GCCTCAGGGTGACAGGGAGCAGG + Intronic
901104854 1:6747202-6747224 GCCACAGCAGGAGATGCAGCGGG + Intergenic
901124377 1:6918786-6918808 GCCACAGGGTGACAGGCTGGGGG - Intronic
901338923 1:8477323-8477345 GCCACAGGGAGAAAAGCTCCTGG + Intronic
903870932 1:26434302-26434324 ACCACAGGCTGTCAAGCAGCAGG + Intronic
903938766 1:26914282-26914304 GCCCCAGGTGCACAATCAGCAGG + Intronic
904702879 1:32368563-32368585 GCCACAGTGTGAAAAGCAGGAGG + Intronic
905254163 1:36669389-36669411 GCCCCAGGAGGACAAGAACCTGG - Intergenic
905455230 1:38083923-38083945 GCCACAGGGAGATCAGTAGCTGG + Intergenic
905654049 1:39674692-39674714 GCCACAGAGAGAGAAGCAGAAGG + Intergenic
905864541 1:41369590-41369612 GAGACAGGGGGACAGGCAGGAGG - Intronic
910325196 1:85998837-85998859 CCCACAGGGTGACAAGAAGAGGG - Intronic
913196936 1:116465037-116465059 CCCACAGGGGAAAGAGCAGCAGG - Intergenic
915070383 1:153261281-153261303 GCCACCGGAGGAGAAGCAGCCGG - Exonic
915070414 1:153261371-153261393 GCCGCCGGAGGAGAAGCAGCCGG - Exonic
915246316 1:154558517-154558539 GCCGCAGGGGCAGCAGCAGCCGG - Exonic
916438680 1:164800401-164800423 GACACAGAGGGACAAGGAGGTGG + Intronic
917269467 1:173257636-173257658 GCCAAAGGGAGACATGCAGAGGG + Intergenic
918248484 1:182681191-182681213 GCCAAAGGTGGAGAAGCAGAGGG + Intronic
919801934 1:201359449-201359471 GCCACAGGGAGAGAAGCACGAGG + Intronic
921890614 1:220350080-220350102 GCCACAGGCTGTCAAGCAGGAGG + Intergenic
922842094 1:228650842-228650864 TCCACAAGGGGACATTCAGCTGG - Intergenic
923666380 1:236002106-236002128 GGCACAGTGGGAGAAGCGGCTGG + Intronic
1063355586 10:5395531-5395553 GCTCCAGGAGGACTAGCAGCAGG - Intronic
1064011202 10:11737874-11737896 GCCACAGCTGCCCAAGCAGCGGG - Intergenic
1067440987 10:46309148-46309170 GCAGCAGTGGCACAAGCAGCAGG - Exonic
1072676387 10:97469396-97469418 GCCACAGAAGGACAAGAAGTGGG + Intronic
1076500199 10:130930766-130930788 GCCACAGGAGGAGGAGGAGCAGG - Intergenic
1076525378 10:131109363-131109385 TCCACAGGGGGACAGACAACAGG - Intronic
1076598602 10:131642153-131642175 CCTACAGGGGGAGAAGCAGCAGG - Intergenic
1076801679 10:132833895-132833917 GCCTCAGGGGAAGGAGCAGCAGG + Intronic
1076868219 10:133179807-133179829 GCCACAGGGCGACGGGGAGCCGG - Intronic
1076885583 10:133261027-133261049 GCTACTGGAGGACAAGGAGCAGG - Intergenic
1077182731 11:1223856-1223878 GCCACCGGGAGACACCCAGCCGG + Intronic
1079106961 11:17577971-17577993 GCCCCAGAGGGACCAGGAGCAGG - Intronic
1083363038 11:62124410-62124432 GGCACAAGGTGCCAAGCAGCCGG - Intronic
1084557133 11:69881890-69881912 CCCACTGGGGGACTGGCAGCGGG + Intergenic
1084601307 11:70147421-70147443 GCCACAGGGGGCCCAGCAGGAGG - Intronic
1084712848 11:70854771-70854793 ACCACAGGGGGCAAAGCTGCTGG + Intronic
1085690188 11:78658186-78658208 GACAGAGGGGGAGAAGCAGCAGG - Exonic
1086527514 11:87745428-87745450 GCCATAGAGGTAAAAGCAGCTGG + Intergenic
1086866394 11:91985074-91985096 GCTCCAGGGTGACTAGCAGCAGG - Intergenic
1088425533 11:109697219-109697241 GCCACTGGGGGACTTGCAGGTGG + Intergenic
1089845369 11:121454071-121454093 GGGACAGGGGGACAAGGATCTGG - Intronic
1091698349 12:2643086-2643108 GCCCCAAGGGGACTGGCAGCCGG - Intronic
1092537866 12:9404307-9404329 GCCACGGGGGGAAGAGCGGCAGG - Intergenic
1095294841 12:40516112-40516134 GCCTCAGGAGGCCAAGCAACTGG + Intronic
1095965580 12:47864893-47864915 GCCTCAGTGGGACCAGCAGCTGG - Intronic
1097288896 12:57897586-57897608 GCAGGAGGGGGACAGGCAGCTGG + Intergenic
1098188855 12:67926577-67926599 GCCACAGTGGAAGAAGAAGCAGG - Intergenic
1098245178 12:68509698-68509720 GCCACAGGGGTGAAAGGAGCAGG + Intergenic
1101199197 12:102416989-102417011 GACACAGGGGGAGAAGAAGGAGG + Intronic
1101883617 12:108642514-108642536 GCCACAGGGGAACTTTCAGCCGG + Intergenic
1102252142 12:111394675-111394697 GGCACAGGTGGACAAGCTCCAGG + Intergenic
1102765968 12:115433265-115433287 GACACAGGGGGAGAAGAAGGGGG + Intergenic
1102942058 12:116951881-116951903 GCCTCAGGGAGACAGGCACCAGG - Intronic
1103360602 12:120351290-120351312 GCCACATGGGGAGAAACAGAAGG - Intronic
1103886538 12:124206662-124206684 GACACAGTGGGACAAGGACCAGG - Intronic
1104776885 12:131394838-131394860 GCCAGAGGAGGCCAAGCAGGAGG - Intergenic
1104831879 12:131758011-131758033 GCCACAGAGGGGCAGGCAGGAGG + Intronic
1105356947 13:19667324-19667346 CCCACAGTGGGACATACAGCTGG + Intronic
1105948903 13:25212281-25212303 GCCACAGGGAGACAAGCAATGGG + Intergenic
1108053345 13:46465376-46465398 GCCACGGGGGGAAAAGGGGCTGG - Intergenic
1108053779 13:46467212-46467234 GCCACGGGGGGAAAAGGGGCTGG - Intergenic
1113874964 13:113588445-113588467 GGCACAGGGAGACAAGCGGGTGG + Intronic
1115514103 14:34168070-34168092 GCCAAAGGAGGACGAGGAGCAGG - Intronic
1117043038 14:51785360-51785382 GCCAGAGGGGGACAAGGATAGGG - Intergenic
1121437616 14:93929397-93929419 GGGACAGCGGGACAAGCTGCTGG - Exonic
1122141871 14:99667559-99667581 ATCACAGGGGGCCAAGCAGAGGG + Intronic
1122301190 14:100732051-100732073 GGCACAGGGGGCCGAGGAGCAGG - Exonic
1122984473 14:105205851-105205873 GCCACACAGGGAGCAGCAGCTGG + Intergenic
1124237723 15:28004265-28004287 GCCACAGGGCGCCTAGCAGGGGG - Intronic
1124570988 15:30863649-30863671 GCCACACGGGGGCAAGGAGGAGG + Intergenic
1125470051 15:39993630-39993652 GCCACAGTGTGGCAAGCAACAGG + Intronic
1125514650 15:40311247-40311269 GCCACAGAGGGACACACAGCTGG - Intergenic
1127772964 15:62245202-62245224 GCCACAGGTGGAAAAGCAGAAGG + Intergenic
1127797869 15:62454031-62454053 GCCACAGGGGCCCTTGCAGCAGG - Intronic
1127844301 15:62856409-62856431 TCCACAGAGGGAGAAGAAGCTGG + Intergenic
1128082375 15:64864311-64864333 GGCACAGGCTGCCAAGCAGCTGG + Intronic
1129161178 15:73748803-73748825 GACACAGGGTGACAGGCAGAGGG - Intronic
1129195136 15:73959937-73959959 GGCACAGGGGCACTACCAGCTGG - Intergenic
1129263608 15:74382470-74382492 GCCCCACGGGGCCAATCAGCTGG + Intergenic
1131093702 15:89642457-89642479 CTCCCAGGGGGACAAACAGCTGG - Intronic
1131145598 15:90009589-90009611 GACACAGAGGAACAAGCAGTGGG - Intronic
1131784833 15:95901148-95901170 GCCACAGGAGCACAAGTTGCAGG - Intergenic
1132647993 16:1007872-1007894 GCCACAGGGGTTCAGACAGCAGG - Intergenic
1132845644 16:1999708-1999730 GCCCCTGGGGGACAGGTAGCGGG + Exonic
1133297856 16:4763910-4763932 GCCACAGGAAGAAAGGCAGCTGG + Intronic
1134217064 16:12324379-12324401 TCCACAGGGCGAGAATCAGCTGG - Intronic
1134307883 16:13049715-13049737 GCCCAAGGAGGAGAAGCAGCAGG - Intronic
1135470444 16:22724641-22724663 ACTACAGGGGGAAAAGCAGAAGG - Intergenic
1135700979 16:24632232-24632254 ACCACAGGGGGATGATCAGCAGG - Intergenic
1136031725 16:27507955-27507977 CCCACATGGGGACAGTCAGCTGG - Intronic
1138349871 16:56340745-56340767 GACACAGCGGGACAAGCAAAGGG - Intronic
1139595485 16:67955312-67955334 GCCCCAGGGTGACAAGCACAGGG + Intronic
1139656186 16:68388427-68388449 GCCACAGGCTCACAAGCATCTGG + Intronic
1140344214 16:74196416-74196438 GCCTCAGGCTGCCAAGCAGCTGG + Intergenic
1141153252 16:81579257-81579279 GCCCCAGGAGGACCAGCTGCTGG - Intronic
1142189549 16:88711615-88711637 GCCCTAGAGGGAGAAGCAGCAGG - Exonic
1142761396 17:2043959-2043981 GCCCCAAGGGGAAAACCAGCTGG - Intergenic
1144809289 17:17988481-17988503 GGCACAAGGAGACAAGAAGCCGG + Intronic
1145913032 17:28553316-28553338 GGCACAGGAGGACAAACACCAGG + Intronic
1146538080 17:33670524-33670546 GGAACAGGGGAACTAGCAGCAGG + Intronic
1146683726 17:34826547-34826569 GCCCCCGGGGCACAAGGAGCTGG - Intergenic
1147166537 17:38596408-38596430 CAGACAGGGGGACAAACAGCAGG + Intronic
1147508703 17:41046926-41046948 GCCGCAGGGGGGCCGGCAGCAGG + Exonic
1147510543 17:41065504-41065526 GCCGCAGGGGGGCCGGCAGCAGG + Exonic
1147608775 17:41789130-41789152 GTGACAGGGTGACAAGCAGGTGG - Intergenic
1147970917 17:44218900-44218922 CGCACAGGCGGGCAAGCAGCCGG + Intronic
1147988452 17:44319603-44319625 GCCCCAGAGGGACAGGCACCAGG + Intronic
1148890088 17:50800954-50800976 GCCACAGGCTGACAGGCAGCTGG + Intergenic
1149660719 17:58332744-58332766 GCCACGGGGGGAAGGGCAGCTGG - Intergenic
1150302204 17:64055988-64056010 CCCACAGGGAAACAAGCAGCTGG + Intronic
1150986892 17:70208340-70208362 GCCACAGGGGGAAAATGTGCTGG - Intergenic
1151657725 17:75503470-75503492 GCCACAGTACCACAAGCAGCTGG - Exonic
1151806652 17:76409917-76409939 GCCACATGGGGGCCAGCAGAGGG + Intronic
1152227120 17:79097635-79097657 GCCCCACGGGGCCAAGTAGCTGG + Intronic
1156826090 18:41431654-41431676 ACCACAGGAGGGCAAGAAGCAGG + Intergenic
1157779729 18:50427702-50427724 GCCACAGGGAGCTAAGCACCAGG - Intergenic
1160230378 18:77044222-77044244 TCCACAGGGGGACATGGAGTAGG - Intronic
1161428222 19:4216224-4216246 GCCACAGGGGGACAGGAGGTGGG - Intronic
1161800513 19:6414897-6414919 GGCACACAGGAACAAGCAGCCGG + Intronic
1161937769 19:7382689-7382711 GCCACAGGGAGACAGGTTGCAGG + Intronic
1162937832 19:13990351-13990373 GCTGCAGGGGGTCCAGCAGCTGG + Intronic
1163353130 19:16792170-16792192 GCCACAGAGGGACTAGGAGTTGG + Intronic
1165423625 19:35733838-35733860 GCCACTGGGACTCAAGCAGCAGG - Exonic
1166300318 19:41909007-41909029 GGCACAGTGGGAGAAGCTGCAGG - Intronic
1167286710 19:48602435-48602457 CCTACAGAGGGACAAGGAGCTGG + Intronic
1167693330 19:51000551-51000573 GGCACAGGAGGACAAGGTGCTGG - Exonic
925330494 2:3054758-3054780 GCCAGAGGCGGAGGAGCAGCAGG + Intergenic
926127167 2:10278721-10278743 GCCACAGAAGCCCAAGCAGCGGG - Intergenic
926597282 2:14805104-14805126 GCCACAGGATCAGAAGCAGCTGG + Intergenic
928218529 2:29382903-29382925 GCCACAGGGGCAAAAGAAGCTGG + Intronic
933737260 2:85505081-85505103 GCCAAAGAGGTCCAAGCAGCAGG + Intergenic
933895747 2:86808449-86808471 GCAGCAGGGGCACTAGCAGCAGG + Intergenic
935150100 2:100426487-100426509 GCCAGACAGGGCCAAGCAGCAGG + Intergenic
937338730 2:121077487-121077509 GCGGCAGGGGCAGAAGCAGCTGG - Intergenic
939798587 2:146679013-146679035 GCCGAAAGGGGAGAAGCAGCTGG - Intergenic
946070307 2:217029298-217029320 GCCTAAAGTGGACAAGCAGCTGG + Intergenic
947390504 2:229634830-229634852 GCCAGAAGGGGACAAGTGGCCGG - Intronic
947807735 2:232980261-232980283 GACACAAGGGGACAAGGAGGTGG + Intronic
948897839 2:240935435-240935457 GGCACAGGCGGAGCAGCAGCTGG + Intronic
948982096 2:241499580-241499602 GCCACAGGGGCACTGCCAGCAGG + Intronic
1169425628 20:5495141-5495163 GCTACAGGAGGAGGAGCAGCAGG + Intergenic
1169746781 20:8951313-8951335 GCCACACCAGGAGAAGCAGCCGG + Intronic
1172692900 20:36802897-36802919 GCTGCAGGGTGAGAAGCAGCAGG - Exonic
1172738573 20:37147780-37147802 GCCTCAGGGTGATATGCAGCAGG + Exonic
1173165364 20:40683669-40683691 GCTACAGGCGGAGACGCAGCCGG + Intergenic
1173869335 20:46331780-46331802 GCCACAGGGGAGCCAGCAGAAGG - Intergenic
1174062815 20:47844502-47844524 GCTACAGGGAGACATTCAGCAGG - Intergenic
1174072904 20:47911168-47911190 GCTACAGGGAGACATTCAGCAGG + Intergenic
1174151170 20:48487498-48487520 GCTACAGGGAGACATTCAGCAGG - Intergenic
1174573803 20:51523348-51523370 GCCACAGGGGGGTACCCAGCCGG + Exonic
1174910228 20:54600209-54600231 GACACAGGTGGAGATGCAGCGGG + Intronic
1175255873 20:57646868-57646890 GCCAGGGGTGGACAGGCAGCTGG + Intergenic
1175825524 20:61934538-61934560 GCCTCAGGAGGAGAATCAGCGGG + Intronic
1175945376 20:62556070-62556092 GCCACAGGGAGGGAAGTAGCCGG + Intronic
1175966042 20:62660755-62660777 GCCTGAGGGGGAGAAGCCGCTGG - Intronic
1176018240 20:62949171-62949193 GCCACATAGGGAGGAGCAGCAGG - Intergenic
1176120814 20:63453748-63453770 GCCACAGGGGGAGAAGGGGAAGG + Intronic
1176135877 20:63521785-63521807 GCCACAGGCGGTCATGCTGCTGG - Exonic
1176222069 20:63974482-63974504 GCCACAGGGGGACTGGGAGAGGG + Exonic
1176222627 20:63977267-63977289 GCCAGAGGGCGGCCAGCAGCAGG - Exonic
1178356492 21:31913779-31913801 GCTACTGGGGGAGAAGCAGGAGG + Intronic
1179528773 21:42003342-42003364 GCTACAGGAGAACAAGAAGCAGG - Intronic
1179795753 21:43782200-43782222 ACAAAAGGGGGACAAGGAGCAGG - Intergenic
1179979632 21:44889284-44889306 GCCACAGGGTGAGGGGCAGCCGG + Exonic
1180922890 22:19530995-19531017 GCCACGTGGGGATCAGCAGCAGG + Intergenic
1183094271 22:35542740-35542762 GTCACACGGGCACAGGCAGCAGG - Intronic
1183522369 22:38303006-38303028 CCCACTGGGGGTCAAGCAGAGGG + Exonic
1183784681 22:40022573-40022595 CCCACCCAGGGACAAGCAGCTGG - Intronic
1184021799 22:41826204-41826226 GACACAGTGGGGCCAGCAGCAGG - Exonic
1184130959 22:42516104-42516126 GCCACAGGTGGACAGGAGGCGGG + Exonic
1184417682 22:44361734-44361756 CCCACAGAGGGACAATCAGGTGG + Intergenic
1184437897 22:44490650-44490672 GCCACGTGGGGACAGGCAGGAGG + Intergenic
1184666569 22:45992435-45992457 GCCCCAGGGAGACAGGCAGCGGG + Intergenic
1184693520 22:46127978-46128000 GCCTGACGGGGACAGGCAGCTGG - Intergenic
1185002779 22:48256400-48256422 CCCACAGGGGGACAAGGAATTGG + Intergenic
949220452 3:1627092-1627114 AACACAGGGGGAAAAGCAGAAGG + Intergenic
949547238 3:5082628-5082650 GCCCCAGGAGGAGCAGCAGCAGG - Intergenic
949883198 3:8677062-8677084 GCCACAGGGGGAAGAGGGGCTGG - Intronic
952307047 3:32155678-32155700 GACACCTGGGGACATGCAGCGGG - Intronic
952774614 3:37032789-37032811 GCCACTGGAAGACAACCAGCAGG + Intronic
953250921 3:41245192-41245214 GCCACATGGGCACACACAGCTGG + Intronic
954111524 3:48436212-48436234 GCCACAGAGAGAAAAGCAGAGGG + Intronic
954690153 3:52391436-52391458 ACCACAGACGTACAAGCAGCAGG + Exonic
960992303 3:123319854-123319876 ACCACAGGGGCACCAGCAGAGGG + Intronic
968577794 4:1376055-1376077 GCCACAGGAGGCCCAGAAGCTGG + Exonic
968633304 4:1664004-1664026 GACACTCCGGGACAAGCAGCTGG + Intronic
969482983 4:7456749-7456771 GCCACAGGGGGACAAGCAGCAGG - Intronic
969567770 4:7989884-7989906 CCCACAGGGAGAGAAGCAGCAGG + Intronic
973114762 4:46441780-46441802 ACTACAGGGGGAAAAGGAGCTGG - Intronic
975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG + Intergenic
975893177 4:79053540-79053562 GCCTCAGAGAGACAAGCAGATGG - Intergenic
981172782 4:141644181-141644203 GAGATAAGGGGACAAGCAGCAGG - Intronic
981695965 4:147559061-147559083 GCCTCAGGGGAACAGGCATCAGG + Intergenic
983826480 4:172268463-172268485 GCCACAGGTGGACCAGTAGTTGG + Intronic
985126695 4:186701697-186701719 GTCACAGGAGGACGTGCAGCAGG + Intronic
986653567 5:9988851-9988873 CCCACATGGGAACAAGTAGCAGG + Intergenic
995667883 5:114565250-114565272 GCCAAAGGGGGACATGCATCAGG - Intergenic
996331940 5:122339498-122339520 GCCAAAGGGGGAGAGGCAGTTGG + Intronic
999195321 5:149777832-149777854 GCTACATGGATACAAGCAGCCGG - Intronic
999195341 5:149777969-149777991 GCTACATGGATACAAGCAGCCGG - Intronic
1000272352 5:159698019-159698041 GACAAATGGGGCCAAGCAGCTGG - Intergenic
1000514064 5:162218695-162218717 GCCACAGCTGGAGAAGCAGTGGG - Intergenic
1001279067 5:170372968-170372990 GCAACTGGGGGAGATGCAGCTGG + Intronic
1001431012 5:171662317-171662339 TCCACAGGGCTCCAAGCAGCAGG + Intergenic
1002792017 6:443922-443944 GCCACGGAGGGACAGCCAGCAGG - Intergenic
1003098510 6:3159673-3159695 TCCACTGGGGGCCCAGCAGCAGG - Intergenic
1004418356 6:15445746-15445768 GCCACAGGGTGACTGTCAGCCGG + Intronic
1005307831 6:24530802-24530824 GCTACAGGTAGAAAAGCAGCAGG - Intronic
1006391759 6:33762853-33762875 GCCAGAGAGGGACAAGCAGATGG - Intergenic
1007397707 6:41587008-41587030 GGCACTGGGGAACAAGCAGCTGG + Exonic
1007721677 6:43888887-43888909 GAGACGTGGGGACAAGCAGCAGG - Intergenic
1009849669 6:69180003-69180025 GCCACTGGGGGACCTGCAGGTGG - Intronic
1012524656 6:100162893-100162915 GCCACTGGTGGAAAAGCTGCAGG + Intergenic
1018690503 6:166340479-166340501 GCCAGAGGGGCTCTAGCAGCGGG - Intronic
1019341943 7:512549-512571 GCCACTGGGGAACAGGCACCTGG + Intronic
1019610600 7:1934906-1934928 ACAACAGGGGGACAAACAGACGG + Intronic
1019614133 7:1951244-1951266 GCCTCAGGGGCTCAGGCAGCAGG + Intronic
1019655975 7:2196017-2196039 GCCACATGGTGCCATGCAGCTGG - Intronic
1019735533 7:2648222-2648244 GCCACAGGGGCACAGGCCACAGG - Intronic
1019905280 7:4057560-4057582 GCTGCAGGGGGCCAAGCAGGTGG - Intronic
1021806467 7:24361826-24361848 CCCACAGAGGGAAAAGGAGCAGG - Intergenic
1022469533 7:30673826-30673848 GTCAGAGGGGAACAGGCAGCTGG + Intronic
1023150417 7:37196537-37196559 GCCACAGTGAGACAAGCATTTGG + Intronic
1024082281 7:45865348-45865370 GCCACAGCTGGAGAACCAGCAGG - Intergenic
1024561740 7:50650356-50650378 GAGACAGGGAGTCAAGCAGCTGG + Intronic
1024622548 7:51174744-51174766 GGCAAAGGGGGACAAGGAGTGGG - Intronic
1028527466 7:91801570-91801592 TCCAGAGGGGGTGAAGCAGCAGG + Intronic
1032120268 7:129150241-129150263 GCCACAGTGGGGCCACCAGCAGG - Intronic
1032334538 7:131012794-131012816 GACACTGGGGGCCAACCAGCAGG + Intergenic
1033267338 7:139897535-139897557 CCCACATGTGGACAAGCAGCAGG + Intronic
1033350455 7:140558013-140558035 GGCACAGGAGGAGAAGGAGCAGG - Intronic
1034374071 7:150627970-150627992 GGCACAGGGGGAGGAGCAGGAGG - Exonic
1035628185 8:1089363-1089385 GCCTCAGGGGGACAAACGGCTGG - Intergenic
1040537500 8:48322819-48322841 GCCACAGGGAGACAGACACCAGG - Intergenic
1048261101 8:132945735-132945757 GCCAGAGGGGGAGAAGGAGATGG + Intronic
1048672298 8:136736739-136736761 GCCACACGTGGGGAAGCAGCAGG + Intergenic
1049099245 8:140567517-140567539 CACACAAGGGGACAAGCAGGTGG + Intronic
1049777931 8:144415025-144415047 GGCACAGGGGAGCCAGCAGCCGG - Exonic
1053432791 9:38054264-38054286 CCCACAAGGGGCCAAGAAGCAGG + Intronic
1053736624 9:41106876-41106898 GCCACGGGGGGAAGAGGAGCTGG - Intergenic
1053736695 9:41107112-41107134 GCCAGGGGAGGAAAAGCAGCTGG - Intergenic
1054691676 9:68324288-68324310 GCCAGGGGAGGAAAAGCAGCTGG + Intergenic
1055026649 9:71729278-71729300 GCCAAAGGGGGAAAAGAAGTGGG - Intronic
1055816471 9:80212819-80212841 TCCAGAGGAGGCCAAGCAGCAGG - Intergenic
1056064611 9:82921118-82921140 GCCAAATGGGCACAAGCATCTGG - Intergenic
1056185379 9:84129471-84129493 GGCAGAGGGGGAGAAGCAGTGGG + Intergenic
1057298884 9:93865197-93865219 ACCACAGGTGGACAAACAGAAGG + Intergenic
1061725441 9:132579969-132579991 TCCCCAGGGCGACAAGCAGCTGG - Intergenic
1061996765 9:134190089-134190111 GCCACAGGGAGCCCAGCAGGGGG - Intergenic
1062035848 9:134382210-134382232 GCCACAGGGGCAGCAGCAGGCGG - Intronic
1062103778 9:134741752-134741774 GGCACAGGAGGCCAAGCAGACGG - Intronic
1062379281 9:136279398-136279420 GCCCCAGGGGGACAGGCAACAGG - Intergenic
1190180346 X:48186321-48186343 GACACATGGGGAAAAGCAGTTGG + Exonic
1194810250 X:98380261-98380283 GCCCCAGGGTGCCCAGCAGCAGG - Intergenic
1199609312 X:149599608-149599630 GCCAAAGGGGGACAAAGATCGGG + Exonic
1199629805 X:149769746-149769768 GCCAAAGGGGGACAAAGATCGGG - Intergenic
1199683390 X:150242975-150242997 GCCACTGGGAGACAGGCAGGAGG + Intergenic
1200135532 X:153872811-153872833 GCCACAGGGGGACGAACGGAGGG + Intronic
1200251871 X:154558297-154558319 GCCACAGGGTGACACACAGATGG - Intronic
1200265896 X:154646119-154646141 GCCACAGGGTGACACACAGATGG + Intergenic
1201242203 Y:11969835-11969857 GCCAAGGGGGGAGAAACAGCAGG - Intergenic
1202124714 Y:21557567-21557589 GGCACACGGGGACAACCAGGAGG - Intergenic
1202154294 Y:21871813-21871835 GGCACACGGGGACAACCAGGAGG + Intergenic