ID: 969482992

View in Genome Browser
Species Human (GRCh38)
Location 4:7456762-7456784
Sequence CCCCCCTACCCCTGCCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 487}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969482992_969483002 15 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969483002 4:7456800-7456822 CGACGATCAGTGTGGAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 74
969482992_969483003 23 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969483003 4:7456808-7456830 AGTGTGGAGGGAAGGATCACAGG 0: 1
1: 0
2: 2
3: 25
4: 311
969482992_969483005 30 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969483005 4:7456815-7456837 AGGGAAGGATCACAGGCTTTGGG 0: 1
1: 0
2: 3
3: 27
4: 273
969482992_969482999 7 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482992_969483000 10 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969483000 4:7456795-7456817 TCTCTCGACGATCAGTGTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 35
969482992_969483001 11 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969483001 4:7456796-7456818 CTCTCGACGATCAGTGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 30
969482992_969483004 29 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969483004 4:7456814-7456836 GAGGGAAGGATCACAGGCTTTGG 0: 1
1: 0
2: 5
3: 48
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969482992 Original CRISPR CCCCCCTACCCCTGCCACAG GGG (reversed) Intronic
900478267 1:2886393-2886415 CTCCCCTACCCCTGCCCCAGTGG + Intergenic
900551007 1:3255533-3255555 GCCCCCTCCCCGTGCCACTGTGG - Intronic
900593331 1:3469324-3469346 CCCACCTGCCCCTGCCACCCGGG + Intronic
900871542 1:5307607-5307629 CCTATCTACCCCTGCCACAAAGG + Intergenic
900957156 1:5893043-5893065 ACCCCACACCCCTGCCACCGTGG - Intronic
901040316 1:6359472-6359494 TCCCCCAACCCCTGCTTCAGAGG + Intronic
901221712 1:7587164-7587186 CCCCCCACCTCCTGCCACAGAGG - Intronic
901302346 1:8209001-8209023 CCTCCCTTCACCTGTCACAGTGG + Intergenic
902548681 1:17206380-17206402 CCTCCCCAGCCCTGCCACCGGGG - Intronic
903929864 1:26855966-26855988 TCCACCTTCCCCTGCCTCAGGGG + Exonic
904274622 1:29372252-29372274 CCAGCCTTCCCCAGCCACAGAGG + Intergenic
904385438 1:30138923-30138945 ACACCCTACCCCAGCCACTGTGG - Intergenic
904406307 1:30290720-30290742 ACACCCTACTCCTGCCACATCGG + Intergenic
904559396 1:31386574-31386596 CACCCCAACCCCAGACACAGGGG - Intergenic
905046222 1:35004689-35004711 CCTCCCCACCCCCGCCTCAGGGG - Intronic
905746863 1:40425464-40425486 CTCCCCTACCCCTGCCACCACGG - Intergenic
905888176 1:41502844-41502866 CCCCCTGACCCCAGCCTCAGAGG - Intergenic
905891563 1:41521530-41521552 CCCACCTTCCCCTTTCACAGAGG - Intronic
906063323 1:42962351-42962373 CCCCCATGCCCCAGCCACAGGGG - Intergenic
906269003 1:44459692-44459714 TCCACCTACCCCTTACACAGTGG - Intronic
906543198 1:46603981-46604003 CGCCCCGACCCCAGGCACAGAGG + Intronic
906719079 1:47992803-47992825 CCCCAATACTCCTGCCACTGGGG + Intronic
907297595 1:53465229-53465251 CTCCCCTACCCCAGCTAGAGAGG - Intronic
907330067 1:53664936-53664958 TCCCCCTCCTCCTGCCACAGAGG - Intronic
910509272 1:87985301-87985323 TCCCCCTAGCCCAGCCAGAGAGG - Intergenic
912754411 1:112312542-112312564 CCCCTCAGCCCCGGCCACAGTGG + Intergenic
913403368 1:118461488-118461510 GCCCCCTCCACCTGCCTCAGTGG - Intergenic
914044077 1:144077111-144077133 CCCCCCCCCCCCCGCCACCGCGG + Intergenic
914343034 1:146776452-146776474 CCCCCCCACCCCTGCAACCAGGG + Intergenic
914490735 1:148148863-148148885 CTCCCTTACCCCCGCCCCAGGGG + Intronic
915200932 1:154228109-154228131 CCCCCCAACCCCCGCCAAAAAGG - Intronic
915285237 1:154848096-154848118 CCCCCCCTCCCCAGCCAGAGTGG + Intronic
915307542 1:154989319-154989341 CCCCACACCCCCTGCTACAGAGG + Intronic
915310764 1:155004852-155004874 CACCCCCAGCCCTGGCACAGGGG + Intronic
916059942 1:161091498-161091520 CTACTCCACCCCTGCCACAGAGG - Intergenic
916164980 1:161958591-161958613 CTCCCCTCCCGCAGCCACAGAGG + Exonic
917658682 1:177155449-177155471 CCCCCCAACCCCTTCCAGTGAGG - Intronic
919618380 1:199835470-199835492 CCCCCCTTCCCCTGCCTGAGTGG + Intergenic
920048037 1:203146151-203146173 CTCCCCCACCCCTGACACTGAGG - Intronic
920286107 1:204881072-204881094 CACCTCTGCCCCTGCCCCAGGGG - Intronic
920371129 1:205479989-205480011 CCCCCCTACCCCTGCCAGCCTGG - Intergenic
920684944 1:208102197-208102219 CCTCCCAACACCTGCCGCAGAGG + Intronic
920920169 1:210292217-210292239 CCCCCCAACCCCCGCCGCTGGGG - Intergenic
921233022 1:213092832-213092854 CCCTCCTACCACTCCCTCAGAGG - Intronic
921594767 1:217042593-217042615 CCCCCCTGCCCTTGCCCCACAGG + Intronic
921712523 1:218387225-218387247 CCCTCCCACCCCTGCCATACTGG - Intronic
922496448 1:226062068-226062090 CGCCCCTCCCGCTGCCGCAGCGG + Intronic
923135272 1:231111583-231111605 CCCCCTTATTCCTGCCAGAGCGG + Intergenic
924709984 1:246523618-246523640 CCCCTCCACCCCACCCACAGTGG + Intergenic
1062826058 10:569763-569785 CCTCCCTACCCCTGCCTTTGTGG - Intronic
1063711056 10:8479012-8479034 CCCCCCTCCTCCTCCCACTGTGG - Intergenic
1064294858 10:14069739-14069761 TCTCCCTGCCCCTGCCCCAGTGG + Intronic
1064410029 10:15097104-15097126 TCCCCCCACCCCCGCTACAGGGG - Exonic
1065046584 10:21751874-21751896 CCCCCCCCCCCCGCCCACAGAGG - Intergenic
1067470755 10:46536172-46536194 CCACCCTGCCCCTGCCACACAGG + Intergenic
1069576724 10:69535906-69535928 CCCCACAACCCCTGGGACAGTGG - Intergenic
1069793465 10:71038342-71038364 CCTCCCTGTCCCTGCCACATGGG + Intergenic
1070383856 10:75906064-75906086 CAGCTCCACCCCTGCCACAGAGG + Intronic
1070572352 10:77649945-77649967 CCCCCCCACCCCAGCCTCAGAGG - Intergenic
1071531647 10:86394037-86394059 CTCCCCTCCCCGTGCCCCAGCGG + Intergenic
1072037563 10:91577505-91577527 CCCCTCTTCCCCAGCCAGAGGGG - Intergenic
1073147698 10:101291622-101291644 CCCCCCAACTCCTGCCCCAAAGG - Intergenic
1073259234 10:102176095-102176117 CCCCTCTAGCCCTCTCACAGGGG + Intergenic
1073351995 10:102826489-102826511 CCCACCCACCACTTCCACAGAGG - Intergenic
1073455437 10:103634059-103634081 CGCTCCTACCTCTGCCACACAGG - Intronic
1074421135 10:113309668-113309690 CCCCCCACCTCCTCCCACAGGGG + Intergenic
1075125618 10:119696659-119696681 CCTCGCTTCCCCTGCCACAGAGG - Intergenic
1075351806 10:121730938-121730960 CCACCATTTCCCTGCCACAGGGG - Intergenic
1076140033 10:128071270-128071292 CCCGCCTCCCCCTTACACAGAGG + Intronic
1076305334 10:129462076-129462098 CCCCCCCTCCCCTGCCCCACTGG - Intergenic
1076658175 10:132037837-132037859 TCCCCCTACCCCTGCCCCGGGGG + Intergenic
1076702791 10:132282935-132282957 CTCCCCGACCCCAGCCTCAGAGG - Intronic
1076796011 10:132798850-132798872 CTCCCCTTCTCCCGCCACAGAGG - Intergenic
1076817737 10:132923040-132923062 CACCCCGACCCCTGCCGCCGTGG - Intronic
1077121601 11:911238-911260 CCCCCCGACCCCCGCCTGAGTGG + Intronic
1077174176 11:1181198-1181220 CCCCCGGACCCCAGCCCCAGGGG - Intronic
1077181609 11:1219533-1219555 CTCCCCTCCCCCGACCACAGCGG - Intergenic
1077475943 11:2790535-2790557 CCCCCCTTCCCATCCCACACAGG + Intronic
1077490935 11:2860679-2860701 CCCTCCTTCCCCTACCACAAGGG - Intergenic
1077497213 11:2892147-2892169 GCCCCCTTCCCCAGCCGCAGGGG + Intronic
1077880578 11:6346495-6346517 TCCCCCAACCCCGCCCACAGTGG + Intergenic
1078091573 11:8267786-8267808 CCCACCTACCCCAGCCAGCGTGG + Intronic
1078338224 11:10480600-10480622 CCTCCCTACCCCATCCTCAGAGG - Intronic
1079089084 11:17468146-17468168 TCCCCCTACCCCTAGCCCAGGGG - Intronic
1079323260 11:19470057-19470079 CACCCCTACCTCAGCCCCAGTGG - Intronic
1080804432 11:35639600-35639622 CCACCCTACCCCTGCCAGTGAGG + Intergenic
1082789537 11:57337982-57338004 CCCCCTGACCCATGCCACTGGGG + Intergenic
1083297948 11:61725339-61725361 CCCCCCAACCCCATCCCCAGTGG - Intronic
1083861781 11:65423823-65423845 CCGCCCCACCCCAGCCTCAGCGG - Intergenic
1084216671 11:67650657-67650679 CCGCCCTACCCCCGAAACAGCGG + Exonic
1084562815 11:69913908-69913930 CCACCCCACCCCTGCCAAATGGG + Intergenic
1084971147 11:72772758-72772780 TCCCTGAACCCCTGCCACAGGGG + Intronic
1085016073 11:73174806-73174828 GACCCCTACCCCTGACACACTGG - Intergenic
1085416356 11:76321485-76321507 CCCCCCGACACCAGCCAGAGTGG + Intergenic
1085542439 11:77284914-77284936 GCATCCTACCCCTGCCCCAGAGG + Intronic
1085656038 11:78316035-78316057 TCCCCCTCCCCCTGCCATATTGG + Intronic
1089549154 11:119257297-119257319 CCACCTTACCCCAGCCAGAGTGG - Intronic
1091289260 11:134428214-134428236 GCCCCTTACCCCTGCCCCAGAGG - Intergenic
1091664189 12:2407189-2407211 CCCCCCTTTCCCTGCCGAAGTGG - Intronic
1092065933 12:5589685-5589707 CCCCCTTCCCCCTGCCCCACAGG - Intronic
1092123710 12:6061585-6061607 CCACCCTGCCCCTGCCACCCAGG + Intronic
1092177954 12:6423856-6423878 CCCTTCTACCCCTTCCCCAGGGG + Intergenic
1092200766 12:6581143-6581165 GGCCCCTGCCCCTGCCTCAGAGG - Exonic
1092229854 12:6770298-6770320 AGCCCCCACCCCTGCCACACAGG - Intronic
1092350017 12:7748675-7748697 TCCCTCTGCCCCTGCCTCAGGGG + Intronic
1093870996 12:24290639-24290661 CCCCCCTCTCCCAGCCACACTGG + Intergenic
1095913299 12:47450673-47450695 CCACCTTACTCCTGCAACAGTGG + Intergenic
1096877929 12:54644944-54644966 GCCCCCTGCCCCTGCCAAGGTGG - Intronic
1097224744 12:57470740-57470762 CTGTCCTCCCCCTGCCACAGTGG - Exonic
1097405106 12:59179689-59179711 CCACCTTACTCCTGCAACAGGGG + Intergenic
1097417703 12:59333602-59333624 CACCCCTACCCCAGACAGAGTGG + Intergenic
1097802095 12:63925840-63925862 TTCCCCTAACCCAGCCACAGTGG + Intronic
1098394670 12:70005411-70005433 CCCCCCTCCCCCAGCCATTGTGG - Intergenic
1099812811 12:87606409-87606431 CCCACCTACCTCTGGCAAAGGGG + Intergenic
1099899027 12:88684355-88684377 CTCCCCTGCCCCTGGAACAGAGG + Intergenic
1100329924 12:93572621-93572643 CACCCCCACCCCAGCCGCAGGGG + Intronic
1101577783 12:106013952-106013974 CCATCCGTCCCCTGCCACAGAGG + Intergenic
1101579151 12:106026316-106026338 TCCCCCTACTCCAGCTACAGGGG + Intergenic
1101656242 12:106722935-106722957 GTCCCCTCCCCCAGCCACAGGGG + Intronic
1102099502 12:110267504-110267526 CCTCTCTCCCCTTGCCACAGCGG + Intergenic
1102212573 12:111138089-111138111 CCCCTTTACCCCTCCCACAGAGG + Intronic
1102516270 12:113448906-113448928 CCCCCTTACCCCTGTCCCATTGG + Intergenic
1102585484 12:113920018-113920040 CCACGCCGCCCCTGCCACAGTGG + Intronic
1102978802 12:117225564-117225586 CCACCCCACCCCTGCCACCCAGG - Intronic
1103162390 12:118740265-118740287 CCCTGCTACCCCAGCCGCAGTGG - Intergenic
1103526898 12:121575205-121575227 CTCCCCTGCCCCTGCCCAAGGGG + Intronic
1104013282 12:124947035-124947057 CCCTCCCACCTCAGCCACAGAGG + Exonic
1104664067 12:130635041-130635063 CCCAGCTCCCCCTGCCCCAGGGG + Intronic
1105234460 13:18535094-18535116 CCACCCCACTCCTGCCCCAGAGG - Intergenic
1106109000 13:26760660-26760682 CCGCCCCCCCCTTGCCACAGCGG - Exonic
1107500913 13:40974692-40974714 GCCCCCTAGCCATCCCACAGAGG - Intronic
1107816762 13:44251332-44251354 CCCCCCACCCCCAGCCACTGAGG + Intergenic
1108406655 13:50109940-50109962 TCCCCCATCCCCTGCCACAAAGG + Intronic
1108569307 13:51733563-51733585 ACCACCTACTGCTGCCACAGTGG - Intronic
1108582932 13:51842181-51842203 TACCCCTACCCCAGCCCCAGTGG - Intergenic
1111656138 13:91155916-91155938 CCCTCCTACCACTGACACACAGG + Intergenic
1111964449 13:94846840-94846862 CACCCCAACCCCCGCCACAGTGG - Intergenic
1112431323 13:99352886-99352908 TGCCCCTACCCCGGACACAGGGG - Intronic
1112461731 13:99608473-99608495 CTCCGCTGCCCCTGGCACAGGGG + Intronic
1112871242 13:103973303-103973325 CACCCCTACTCCTGCCACCCAGG - Intergenic
1113298476 13:108988596-108988618 CCCACCCACACATGCCACAGTGG + Intronic
1113709660 13:112455040-112455062 CCCTGCTCCCCCTGCCTCAGTGG - Intergenic
1114073201 14:19131772-19131794 TCCACCTCCCCCTGCCACAGAGG - Intergenic
1114089065 14:19268211-19268233 TCCACCTCCCCCTGCCACAGAGG + Intergenic
1115387365 14:32813395-32813417 CCCCCCAACCCCTTTCCCAGAGG + Intronic
1116352901 14:43888168-43888190 CCCACCTACTCCTGCTCCAGGGG - Intergenic
1117658906 14:57984208-57984230 CCACCCTACCCCTGGGACAGTGG - Intergenic
1118880353 14:69820209-69820231 CCCAACTACCCCAGCCGCAGGGG - Intergenic
1119671547 14:76523733-76523755 TCCCTCTTCCCCTGCCAGAGGGG - Intergenic
1121509472 14:94501667-94501689 CCCCCCCACCCCCGCCCCAAGGG + Intronic
1122211835 14:100178556-100178578 CTCCCCTTCCCCAGCCACAGTGG - Intergenic
1122582753 14:102781473-102781495 CACCCCTTCCCCTGCCACTTTGG - Intronic
1122740584 14:103869588-103869610 ATCCCCCACCCCTGCCACACAGG - Intergenic
1122776575 14:104119471-104119493 CCTCCCTGCCTCTGGCACAGGGG + Intergenic
1122827551 14:104377549-104377571 CCCCCATACCCCAACCTCAGAGG + Intergenic
1122885871 14:104710027-104710049 CCCACCTGTCCCTGCCAGAGGGG - Intronic
1122940515 14:104978985-104979007 CCCCACTGGCCCTGCCCCAGGGG + Intergenic
1124375384 15:29126105-29126127 CCCACCCACCCCTGGCTCAGGGG + Intronic
1124804442 15:32867345-32867367 CCCTGCTCTCCCTGCCACAGTGG + Intronic
1125213556 15:37242504-37242526 CCCCCTTACTCCTGCAACAATGG + Intergenic
1125759193 15:42085365-42085387 ATCTCCTACCCCTGCCAGAGAGG - Intronic
1128064082 15:64753733-64753755 CACCCCAACCCCGGGCACAGAGG - Intronic
1128916336 15:71566454-71566476 CCCCACAACCCCTGTCACAGAGG - Intronic
1128990682 15:72257339-72257361 CCCCCATACCTCTGCTCCAGTGG + Exonic
1129231112 15:74197661-74197683 CCCCCCTTCACCAGCCCCAGTGG + Intronic
1129333567 15:74839758-74839780 CACCCCTACCCCTAGCCCAGGGG + Intronic
1130652900 15:85772389-85772411 CCACCCTGGCCCTGCCAGAGGGG + Intronic
1130875652 15:88011792-88011814 CCTCCCTTCGCCTGCCACTGGGG + Intronic
1131410760 15:92205734-92205756 CACCCCTCCCCCTGCAGCAGTGG - Intergenic
1131524451 15:93141816-93141838 CCAGCCTACCACAGCCACAGAGG + Intergenic
1131559217 15:93424704-93424726 CCCGCCTAGGCCTCCCACAGTGG - Intergenic
1133002680 16:2858925-2858947 CCCCCCAGCGGCTGCCACAGTGG + Intergenic
1133006016 16:2882420-2882442 CCCCACTACCCCGGCCACCTTGG - Intergenic
1133167429 16:3958043-3958065 CCCCCCCAGCCCTGGCACAGTGG - Intronic
1133581033 16:7144943-7144965 CCCCTCTCCCCCTCCCCCAGTGG + Intronic
1134376252 16:13677294-13677316 CCACCTTACCCCTGCCAGAATGG - Intergenic
1135548551 16:23381193-23381215 CTCCACCACCCCTGCCCCAGAGG - Exonic
1135954551 16:26945344-26945366 CTCCTCTACTCCTTCCACAGAGG - Intergenic
1136246541 16:28979385-28979407 CCCCTCTCTCCCTCCCACAGTGG + Exonic
1136269841 16:29141910-29141932 CCCCCCCCCGCGTGCCACAGAGG - Intergenic
1136395818 16:29991861-29991883 CCACCCTTCCCCTCCCCCAGGGG - Intronic
1136594640 16:31239671-31239693 CCTCCCTGCCCCTGCCCCAGGGG + Intergenic
1136751369 16:32638319-32638341 TGCCCCCACCCCTTCCACAGAGG - Intergenic
1136784676 16:32927375-32927397 GCCCCCTACCACCCCCACAGAGG - Intergenic
1136885107 16:33926431-33926453 GCCCCCTACCACCCCCACAGAGG + Intergenic
1137613604 16:49834830-49834852 CTCCCCTCCCCCAGCAACAGGGG + Intronic
1138241960 16:55434617-55434639 CCCCCCAACCCCGGCCACCCAGG + Intronic
1138442251 16:57042088-57042110 CCCCCCTGCCCCAGCCTCAGAGG - Intronic
1138480915 16:57302936-57302958 TCACCTTACCCCTGCCACACTGG - Intergenic
1138700717 16:58860035-58860057 CCCAGCAACCCCTGACACAGTGG - Intergenic
1141149113 16:81552018-81552040 CCTCCCTGCCCCTGCCGCCGAGG - Intronic
1141670871 16:85491096-85491118 CCCCCCAAGCCCTGTCGCAGGGG + Intergenic
1141680767 16:85542403-85542425 CCACACTGCACCTGCCACAGGGG + Intergenic
1141682484 16:85552768-85552790 CCCCCCTTCCCCTGCTGCAGTGG - Intergenic
1141987100 16:87587242-87587264 CGCCCCTTCCCCCGCCACAGAGG - Intergenic
1142204739 16:88777565-88777587 TCCCACTGCCCCTGCCTCAGCGG - Intronic
1142434576 16:90048010-90048032 CCCCCCGCCCCCTCTCACAGCGG - Intergenic
1203053503 16_KI270728v1_random:897574-897596 TGCCCCCACCCCTTCCACAGAGG - Intergenic
1143077513 17:4357057-4357079 TCCCCCCACCCCTGCCCCATCGG + Intronic
1144484455 17:15653215-15653237 CTCCCCTACCCCTTCCACTGTGG + Intronic
1144649041 17:16995926-16995948 CCACACTACCCCAGCCAGAGAGG - Intergenic
1144674316 17:17152251-17152273 CCCGCCTACCCCTCCCACAGCGG - Intronic
1144786517 17:17835391-17835413 CTCCCCTAGCCCAGCCCCAGGGG + Intronic
1145191316 17:20843459-20843481 CTCCCCTACCCCCGCCCCAGGGG + Intronic
1145225221 17:21122977-21122999 ATCCCCTTCCCCTGCCAAAGTGG - Intergenic
1145263720 17:21369487-21369509 GCCCTCTAGCCCTGCCCCAGAGG + Intergenic
1145799487 17:27673841-27673863 CCCCTCCACCCCACCCACAGTGG + Intergenic
1146159531 17:30552474-30552496 CCCCTCCACCCCACCCACAGTGG - Intergenic
1146511249 17:33450735-33450757 ACTCCCCACCCCTGCCACAGAGG - Intronic
1146649546 17:34598265-34598287 CCCCTCTCCCCATGGCACAGTGG - Intronic
1146916699 17:36682591-36682613 CTCCCCTGTCCCTGCCCCAGTGG - Intergenic
1147144977 17:38479526-38479548 GCCCCCTACCACCCCCACAGAGG - Intronic
1147176247 17:38657922-38657944 CACCCCTACTCCTGCCACACAGG - Intergenic
1147430394 17:40367127-40367149 CCCCCTGCCCCCAGCCACAGGGG + Intergenic
1147605915 17:41773629-41773651 CACCCCTTCCCCAGCAACAGAGG + Intronic
1148443808 17:47725809-47725831 CACCCCTAGCCCTGACAGAGGGG + Intergenic
1149685298 17:58531549-58531571 CCCACCTACCCTGGGCACAGGGG - Intronic
1150484636 17:65535255-65535277 CCCCTCCACCTCTGCCACAGTGG + Intronic
1151553466 17:74835143-74835165 GCCCCCTTCCACTTCCACAGAGG + Intronic
1151901353 17:77017533-77017555 GTCCCCTCTCCCTGCCACAGAGG - Intergenic
1152007565 17:77691996-77692018 CGTCCCTACCCCCGTCACAGTGG + Intergenic
1152157647 17:78645299-78645321 TGCCCCTACCGTTGCCACAGAGG - Intergenic
1152261984 17:79272231-79272253 CCCCCCGCCCCCAGCCACAAAGG - Intronic
1152354326 17:79799331-79799353 CCTCCCTCCCACTTCCACAGTGG - Intronic
1152563923 17:81091798-81091820 CCAAGCTGCCCCTGCCACAGAGG + Intronic
1152580237 17:81162567-81162589 CAGCCCTGCCCCTGCCACTGAGG + Intronic
1152614515 17:81331605-81331627 GCCCCCTCCCCCTGCCCCACAGG - Intergenic
1152741876 17:82022014-82022036 CCTCCCTTCCCAGGCCACAGAGG + Intronic
1152750738 17:82061351-82061373 CCCCGCTCCTCCTCCCACAGAGG - Exonic
1152778545 17:82216415-82216437 CCCACCTTGCTCTGCCACAGAGG - Intergenic
1153135524 18:1912929-1912951 CCCCCCTACCCCCACCCCACAGG - Intergenic
1153226613 18:2905285-2905307 CCCCCCCGCCCCACCCACAGAGG - Intronic
1154376968 18:13818678-13818700 CACCCCTACACCTGCCTGAGTGG - Intergenic
1154515084 18:15154763-15154785 CCACCCCACTCCTGCCCCAGAGG + Intergenic
1155911681 18:31511374-31511396 CCCCGCTCCTCCTGCCACTGGGG - Intronic
1156449458 18:37258818-37258840 CCCTCCTACCCCTGTCAAGGTGG + Intronic
1156455932 18:37294111-37294133 CACCCTCACCCGTGCCACAGTGG - Intronic
1157479900 18:48047062-48047084 CCTCCCAATCCCTGCCACTGAGG - Intronic
1158649621 18:59273684-59273706 CACCCCTAGTCCTGCCTCAGTGG + Intronic
1159395168 18:67846733-67846755 CCCCCCTTCCCCTTCCCCACTGG + Intergenic
1160410262 18:78670955-78670977 CCCCACCGTCCCTGCCACAGCGG - Intergenic
1160519996 18:79501609-79501631 CCCCCCTCCCCCCGCCAAAAAGG + Intronic
1160569392 18:79806361-79806383 CACCCCAAACCCTGACACAGCGG - Intergenic
1160865282 19:1253426-1253448 CCCCCCCATCCCGGCCACTGGGG + Intronic
1160994884 19:1877963-1877985 CTCCCTTACCCCCGCCCCAGGGG - Intronic
1161504330 19:4635930-4635952 CCCCCTTACCCCTCTCCCAGTGG - Intergenic
1161516436 19:4699277-4699299 CCTCCCTTCCCCTGCACCAGAGG - Intronic
1162363942 19:10236552-10236574 CCCCCCGCCCCCCGCCACCGGGG - Intergenic
1164130934 19:22361281-22361303 TCCCCCCACCCCTCCCACAGTGG - Intergenic
1164925203 19:32124798-32124820 CCCTCCTCCCCCTCCCACACTGG + Intergenic
1165717582 19:38056324-38056346 CCCCCCTAAACCTGCCATGGAGG + Intronic
1165879372 19:39031806-39031828 CCCCGCTACCGCTCCCACTGTGG + Intronic
1165984469 19:39755926-39755948 CCCCTCTACTCCAGACACAGTGG + Intergenic
1166353904 19:42215993-42216015 CCCCTCTGCTCCTGCCACACTGG + Intronic
1166375637 19:42325576-42325598 GCCCCCTCGCCCTCCCACAGCGG + Intergenic
1166704875 19:44903217-44903239 TCCACCTCCCCCTGCCACAGAGG + Exonic
1167004531 19:46766969-46766991 CCCCTCTACACCTTCCACACTGG - Intronic
1167113556 19:47475696-47475718 CCCCTTCACCCCTGTCACAGAGG - Intronic
1167145969 19:47680988-47681010 CACCCCTGCCGCTGCCACCGGGG + Exonic
1167477341 19:49708793-49708815 CCACACTACCCCAGCCCCAGCGG + Exonic
925063568 2:911974-911996 CACCCCTGCCCCTTCCACAGCGG - Intergenic
925443805 2:3910377-3910399 GTCCCCTGCCCCTGCCACAGGGG - Intergenic
925458437 2:4039724-4039746 TCCCCCCACCCCTCCCACAGTGG + Intergenic
925973238 2:9122373-9122395 CCCCCCAACCCTTGCCCCACTGG + Intergenic
926537829 2:14135170-14135192 CCCCACTACCCCTCCCACTGTGG - Intergenic
926804620 2:16695633-16695655 CCACCTTACCCCAGCCACAATGG - Intergenic
927108622 2:19848447-19848469 CCTCCCTAGCCCTGCCATAAAGG - Intergenic
927120986 2:19963128-19963150 CCACCCCACCCCTACCACACAGG + Intronic
927669504 2:25057224-25057246 CCTACCTACCCCTACCCCAGTGG - Intronic
928096960 2:28410641-28410663 CACCTCTTCCCCTCCCACAGCGG + Intronic
928231860 2:29505269-29505291 ACCCCCTTCCCCTCCCCCAGAGG - Intronic
928683879 2:33728302-33728324 CCCCCTGGCCCCTGCCAGAGCGG - Intergenic
929075309 2:38075451-38075473 CGCCCCTACCCCAGCCTCTGGGG + Intronic
929314993 2:40466214-40466236 AACCCCTGCCCTTGCCACAGTGG - Intronic
929609406 2:43258865-43258887 GCCCCCTCCCCCTGCCAAAAAGG + Intronic
930073644 2:47389570-47389592 ACCCCTTTCCCCTGCCAGAGGGG + Intergenic
930672481 2:54165754-54165776 CTTCCCTACCCCTGCCCCAAGGG + Intronic
931155348 2:59622273-59622295 CCCCACTACCCCTGCAAGGGAGG - Intergenic
931235722 2:60410917-60410939 CCCCCCCCCCCCACCCACAGGGG - Intergenic
931720449 2:65063604-65063626 CGCCCCCACCCCTACCCCAGAGG + Intronic
931808524 2:65831490-65831512 CCCCCCTCCCCACCCCACAGAGG + Intergenic
932292555 2:70594778-70594800 CATCCCTACCCCAGCCACATTGG + Intergenic
932827311 2:74953500-74953522 CTCCCCTCCCCCTGCCTCAGTGG + Intergenic
933627236 2:84614715-84614737 CCACCCTACCCCTGCAAGAATGG - Intronic
933799578 2:85950008-85950030 CAGCCCTACCTCTGTCACAGGGG - Intergenic
933808246 2:86015638-86015660 CCTTCCCTCCCCTGCCACAGTGG + Intergenic
934261290 2:91478463-91478485 CCCCCCGCCCCCTGCCGCCGCGG + Intergenic
934896918 2:98127375-98127397 CCTCCCCACCCCTGCCACCCAGG - Intronic
936416748 2:112322340-112322362 GCCCCCCACCCCTGCCCCTGGGG + Intronic
937239758 2:120452417-120452439 CCCCACCACCCCTGCCACATGGG + Intergenic
937288469 2:120767698-120767720 TCACCCTGCCCCAGCCACAGTGG + Intronic
938077219 2:128346240-128346262 CCCACCTGCCCCTGCCCCTGGGG - Intergenic
938312497 2:130302168-130302190 TCCCCCCACCCCCACCACAGTGG - Intergenic
939220085 2:139290713-139290735 CCCCTCTACCCTAGGCACAGTGG + Intergenic
939275170 2:139990782-139990804 CCCCCCTCCCCCCGCCTCCGTGG - Intergenic
939708653 2:145487264-145487286 CCACCCTACCCCTGCCAGAATGG + Intergenic
941526322 2:166610764-166610786 GCCCCCTCCCCCTGCCTAAGGGG - Intergenic
943022057 2:182586985-182587007 ACCCCCCACCCCTGCCAAACTGG - Intergenic
943604905 2:189965601-189965623 CCACCTTACTCCTGCAACAGTGG + Intronic
945498842 2:210543093-210543115 CCCCCCTCTCCCAGCCACTGTGG - Intronic
946225202 2:218260873-218260895 CCCCTCTCCCCCTGCCACCTAGG - Intronic
946410982 2:219515030-219515052 CCCCGCTGCCCCAGCCCCAGTGG + Exonic
946691090 2:222308611-222308633 CACCCCTCCCACTGCCAAAGTGG - Intergenic
947097154 2:226578984-226579006 TCCCCCTTCCCCTGTCAAAGGGG - Intergenic
947257149 2:228180136-228180158 CCTCCCGATCCCTGCCCCAGCGG - Intronic
947639241 2:231697046-231697068 TCCCTCTGCCCCAGCCACAGTGG - Intergenic
948205563 2:236161115-236161137 CCACCCTCCCTCTGCCCCAGCGG + Intergenic
948458927 2:238119874-238119896 CCCCCCCACCCCAGCCCCTGGGG + Intronic
948591169 2:239051157-239051179 CCTCCCTGCCCTTGCCACGGAGG + Exonic
948780740 2:240320183-240320205 CCCACGGGCCCCTGCCACAGTGG - Intergenic
949009033 2:241668070-241668092 CCCCCCACCCACTGCCATAGGGG - Intronic
1169068164 20:2706113-2706135 CCTCCCCAGCCCTGGCACAGGGG - Intronic
1170693592 20:18637275-18637297 ACCCCTTCCCCCTGCCACACAGG + Intronic
1171459837 20:25292247-25292269 CCCCACTCCCGCTCCCACAGGGG - Intronic
1171562075 20:26135200-26135222 CCCCACCACCCCTGCCACCACGG + Intergenic
1171823753 20:29876798-29876820 CCACCCTACCCTGGCCAAAGGGG + Intergenic
1172098201 20:32470845-32470867 GGCCCCTGCCCCTGCCAAAGGGG + Intronic
1172126306 20:32627124-32627146 CCCCCCTCCCCCGGCCTCCGGGG + Intergenic
1172245695 20:33443731-33443753 CCACCCTACCCCGGCCGCTGGGG + Exonic
1172619221 20:36308147-36308169 CTGGCCTACCCCTGCCACAGCGG - Intronic
1172774666 20:37400058-37400080 CCCCCCAACTCCTACCACACAGG - Intronic
1172845778 20:37929302-37929324 TGCTCCTACTCCTGCCACAGTGG - Intronic
1173078786 20:39846271-39846293 CCCCACTACCCCTACCTCAAAGG + Intergenic
1174218793 20:48936255-48936277 CCCCCCCACCCCTGCCGGACGGG + Intronic
1174365723 20:50055142-50055164 CCCCCCCACCCCACGCACAGAGG + Intergenic
1174411607 20:50340253-50340275 TCCCTCTACCCCTGCCACACTGG + Intergenic
1174981446 20:55399611-55399633 GCCCCTTTCCCCTGCCATAGTGG + Intergenic
1175260734 20:57672645-57672667 CCTCCCTGCCTCTGCCCCAGGGG - Intronic
1175418413 20:58816423-58816445 CCCCCTTTCCCCTGCCTAAGGGG + Intergenic
1175820145 20:61904665-61904687 CCCTCCTCCCCGTGACACAGAGG + Intronic
1175826375 20:61938600-61938622 CCACCCTGCACCTGCCACTGGGG + Exonic
1175877444 20:62237066-62237088 GGGCCCCACCCCTGCCACAGAGG + Intronic
1175931912 20:62497548-62497570 CCCCCCTTCCCCTGCTACACAGG - Intergenic
1176032092 20:63017546-63017568 ACCCCCCAGCCCTGCCACTGTGG - Intergenic
1176778446 21:13163379-13163401 CCACCCCACTCCTGCCCCAGAGG - Intergenic
1177731550 21:25033792-25033814 CACCTCTAACTCTGCCACAGTGG - Intergenic
1179547558 21:42122927-42122949 CCCCCCAAGGCCTGCCCCAGCGG + Exonic
1180181503 21:46120495-46120517 CCTCCCTTCCCTTCCCACAGGGG + Exonic
1180367489 22:11954045-11954067 CCCCCCAAACACAGCCACAGTGG - Intergenic
1180491642 22:15854125-15854147 TCCACCTCCCCCTGCCACAGAGG - Intergenic
1180979709 22:19872788-19872810 CCCACCTACCCCTCACACACTGG - Intergenic
1181120942 22:20668497-20668519 CTCCCCTACCCCTGCCCCAGGGG - Intergenic
1181333908 22:22115523-22115545 CTCCCCTACCCCCGCCCCAGGGG - Intergenic
1181625333 22:24119031-24119053 TCCCCATACCCCAGCCCCAGAGG + Intronic
1182129505 22:27840597-27840619 GGCCCCTTCCCCTCCCACAGAGG - Intergenic
1182273678 22:29171556-29171578 CCCATCTACCCCTGCTCCAGAGG - Intergenic
1182549480 22:31093235-31093257 CCCCACTGCCCCTTCCACGGAGG + Intronic
1183036446 22:35144263-35144285 CCCCCCCACCCCCTCCACAGCGG - Intergenic
1183102173 22:35590876-35590898 CCACCCCACCCCTTCCCCAGTGG - Intergenic
1183225474 22:36546965-36546987 CTCTCCTCTCCCTGCCACAGAGG - Intergenic
1183310926 22:37109184-37109206 CCACCCTACCCCTGCCTCGCAGG - Intronic
1183951389 22:41354911-41354933 CCACCCTACCCCTGCCGGGGTGG + Intronic
1183984502 22:41562096-41562118 CTCTCCTACCCCAGCCCCAGTGG - Intronic
1184465104 22:44664306-44664328 GGCCCCTGCCCCAGCCACAGTGG - Intergenic
1184647463 22:45903838-45903860 CTCCCGTCCCCCTGGCACAGTGG - Intergenic
1184947061 22:47811107-47811129 CCCATCTACCCCGGCCCCAGAGG + Intergenic
1185173359 22:49305887-49305909 GCCCCCTGGCTCTGCCACAGGGG + Intergenic
949505089 3:4719898-4719920 TCCCCCTGCCCCAGCCCCAGGGG - Intronic
950483398 3:13258817-13258839 CCCCCCTCCCCACCCCACAGGGG + Intergenic
952455342 3:33467032-33467054 GCCCCCTCCCCCTCCCACACAGG - Intergenic
952474318 3:33690920-33690942 CTCCCCACCCCCTGCCACTGTGG - Intronic
954411147 3:50371741-50371763 CCCCCCAACCCCTTCCCCATCGG - Intronic
954663711 3:52239295-52239317 GCCCCCCTCTCCTGCCACAGAGG - Intergenic
954878452 3:53818480-53818502 ACACCCTGCCCCTGCTACAGTGG + Intronic
955028043 3:55189306-55189328 CCCAGCTTCCCCTCCCACAGGGG - Intergenic
955336310 3:58089005-58089027 CCTTCCCTCCCCTGCCACAGTGG + Intronic
955531361 3:59876418-59876440 CCTCCCTGCCCCTGTCCCAGTGG - Intronic
955972115 3:64445786-64445808 CTCCCCTACCCCAGCTACAGCGG - Intergenic
956260595 3:67336187-67336209 CACCCCTGCCCCTTCCCCAGTGG + Intergenic
956274824 3:67487184-67487206 TCCCCCCACCCCTCCCACAAAGG - Intronic
958864381 3:99484148-99484170 CTGCCCAAACCCTGCCACAGTGG + Intergenic
960630698 3:119727611-119727633 CCCTGCTCCCCCTGCCCCAGTGG - Intronic
961485141 3:127210907-127210929 CCACCCTCCCCATTCCACAGAGG + Intergenic
962316162 3:134360731-134360753 CAAACCTACCCTTGCCACAGAGG - Intronic
962493039 3:135911929-135911951 CACCCCTACCCCAGCCACCATGG + Intergenic
964285433 3:155112753-155112775 CTCCTCTCCCCTTGCCACAGAGG - Intronic
966020735 3:175205900-175205922 CCACCTTACCCCTGCAACAATGG + Intronic
966040122 3:175474091-175474113 CCACCTTACCCCAGCCACAATGG - Intronic
967821488 3:193843024-193843046 CCCCCCTCGCCAAGCCACAGAGG + Intergenic
967981963 3:195071187-195071209 CACGCCTGTCCCTGCCACAGTGG - Intronic
968129869 3:196186820-196186842 ACCTCCTCCGCCTGCCACAGAGG + Intergenic
968921351 4:3523843-3523865 CACCCCCACCCCCACCACAGTGG + Intronic
969315960 4:6381448-6381470 CACACCTACCCCTGCCACCCAGG + Intronic
969395077 4:6915336-6915358 ACCCCCTACCCCGGTCGCAGGGG - Intronic
969482992 4:7456762-7456784 CCCCCCTACCCCTGCCACAGGGG - Intronic
969655814 4:8497907-8497929 CCCCCCCACGCCAGCCCCAGTGG - Intergenic
973715377 4:53670695-53670717 CCCCCTCAGCCCTGCCACACTGG + Intronic
974062392 4:57047134-57047156 CCCCCCAACCCATGACACATGGG - Intronic
974892266 4:67896642-67896664 ACCCCCAACCCCTGCCACCGTGG - Intergenic
975556639 4:75672538-75672560 CCCCCCTCTCCCTGCCACCGCGG - Intronic
975613161 4:76221151-76221173 GTCCCCTTCCCCTGCCACAATGG - Intronic
975718360 4:77227281-77227303 CCCCCTATCCCCTCCCACAGTGG - Intronic
976672284 4:87666647-87666669 CCCTCCTACATCTGCCCCAGAGG - Intergenic
977265048 4:94843995-94844017 CCCCCATACCCCAGCCCCTGGGG - Intronic
977707731 4:100089867-100089889 CCACCTTACCCCTGCCAGAATGG - Intergenic
977813948 4:101391731-101391753 CCACCTTACCCCAGCCAGAGTGG + Intergenic
979851411 4:125574627-125574649 CCCCCATTCCCCAGCAACAGTGG - Intergenic
980563040 4:134502068-134502090 CCCCCCTTCCCCTCCCCCCGTGG + Intergenic
980873637 4:138638577-138638599 TCTCCCCACTCCTGCCACAGAGG + Intergenic
982812341 4:159841619-159841641 CCACCCTACCCCAGCCAAAATGG - Intergenic
984490767 4:180431762-180431784 GCCCCGTTCCCCCGCCACAGAGG - Intergenic
984791566 4:183619579-183619601 CCCCCCTCCCCCTGCAGGAGGGG - Intergenic
984907298 4:184640488-184640510 ACCCCCTGCCCCTGCCCCACAGG - Intronic
985408801 4:189662475-189662497 ACTCCCTTCGCCTGCCACAGTGG + Intergenic
985445606 4:190019613-190019635 CCACCCTACCCTGGCCAAAGGGG + Intergenic
986256681 5:6106761-6106783 CCTCTCTACCCCAGCCACAGAGG - Intergenic
987269376 5:16290385-16290407 CCCCTCTGCTCCTGCCACAATGG - Intergenic
987374788 5:17223896-17223918 CCACCCTGCCCCTGCCAAACAGG + Intronic
988367774 5:30323527-30323549 CCCCCCTACCCCTGCAAGAATGG - Intergenic
988567004 5:32327532-32327554 CCCCCCTCGGCCTCCCACAGTGG + Intergenic
990042407 5:51390073-51390095 CCCCCCTACCCATGCCCCGGGGG + Intronic
990233939 5:53746061-53746083 CCCCTCTAGCCCTCTCACAGGGG - Intergenic
991654163 5:68886370-68886392 TCCCCCTACCCCCACCCCAGAGG + Intergenic
991975029 5:72177098-72177120 AACCCTCACCCCTGCCACAGAGG - Intronic
995526028 5:113051248-113051270 TCCCCCTACCCCCACCACCGAGG + Intronic
996494793 5:124141278-124141300 TGCCCCTTCCCCTGCCAGAGTGG + Intergenic
997356372 5:133265520-133265542 CTGCCCCACCCCTGCCCCAGAGG - Intronic
998036997 5:138925917-138925939 CTCCTCTGCCCCTGCGACAGAGG - Intronic
999736850 5:154519284-154519306 CCCCTCTCCCCTTGCCACACTGG + Intergenic
999737689 5:154524916-154524938 CCCCTCTCCCCTTGCCACACTGG + Intergenic
1000281030 5:159782203-159782225 CCCCCTGTCCCCTGCCACAGGGG - Intergenic
1000317949 5:160111071-160111093 CCCTCCTTGCCCTCCCACAGTGG - Intronic
1002277793 5:178114559-178114581 CCCCCCGACCCCAACCACATAGG + Intronic
1002437677 5:179241969-179241991 CCCCCCCACCACAGCCACTGGGG - Intronic
1003087162 6:3069050-3069072 CGCCCCGACCTCTGGCACAGAGG - Intronic
1003257258 6:4485309-4485331 CCACTCTGCCCCAGCCACAGTGG + Intergenic
1003353153 6:5339679-5339701 CCCACCTTGACCTGCCACAGTGG + Intronic
1004216766 6:13711220-13711242 CCCGCCTCCCCCTGCCTCAGCGG - Exonic
1005039363 6:21587706-21587728 CCCCTCAACCCCTGCCACCCCGG + Intergenic
1005996994 6:30937469-30937491 ACCCCCTATCCCTGCCAGACCGG - Intergenic
1006167268 6:32072269-32072291 CCCACCAGCCCCAGCCACAGAGG - Intronic
1006641615 6:35492332-35492354 CTCCCCTACCCGCCCCACAGCGG + Intronic
1006775665 6:36590554-36590576 CCTCCCTACCCCTGAAAAAGAGG + Intergenic
1007001849 6:38320792-38320814 CCCACCTACCCATTCCACATGGG - Intronic
1007087376 6:39158455-39158477 CCTCCCTACCCCTGTCATGGGGG - Intergenic
1007568083 6:42868783-42868805 CATCCCTACTCCTGCCACATAGG + Intergenic
1007925436 6:45646163-45646185 CCCGCCTCCCCCTACCATAGGGG - Intronic
1009390617 6:63139519-63139541 CCCACTCACCCCAGCCACAGTGG + Intergenic
1010744714 6:79547519-79547541 CCTCCCTACCCCTGACCCAAGGG + Intergenic
1012445983 6:99307537-99307559 CCTCCCCACTGCTGCCACAGTGG - Intronic
1012492486 6:99797841-99797863 CTCCCCTACCCCAGCCAGAGTGG - Intergenic
1013599236 6:111688851-111688873 CCCCCTCACCCCGGACACAGCGG - Intronic
1015173297 6:130278630-130278652 CCTCCCTACAACTGGCACAGTGG + Intronic
1015702915 6:136055796-136055818 CCCCCTTGCCCATGCCACATGGG - Intronic
1015845812 6:137519733-137519755 CCCCCCCGCCCCTGCCATGGTGG + Intergenic
1016022987 6:139255453-139255475 CCCCCCATCCCCTGCCACATAGG + Intronic
1016961401 6:149675801-149675823 CCCGCCTACACCTCCCAAAGTGG + Intronic
1018796571 6:167190080-167190102 CTCCTGTACCCCTGCCACACCGG - Intronic
1018819748 6:167365037-167365059 CTCCTGTACCCCTGCCACACCGG + Intronic
1019346011 7:531211-531233 CCCCCCACCCCCTGCCACCCTGG - Intergenic
1019471441 7:1223652-1223674 CCACCTTCCTCCTGCCACAGCGG + Intergenic
1019472100 7:1226689-1226711 CCCCTCTCCCTCTGCCTCAGAGG - Intergenic
1019556530 7:1634214-1634236 CCCACCTTCCCCTGCAACTGTGG + Intergenic
1019570646 7:1710443-1710465 CCCCCTCACCCCTGCCACTAAGG + Intronic
1020191515 7:6002529-6002551 ACCCCCTACCCCCGCCCCAGAGG - Exonic
1022091396 7:27110220-27110242 CAACCCTACCCCTGCCAACGCGG - Exonic
1023125940 7:36954354-36954376 CCCCCACACCCCTGCCTCAAGGG - Intronic
1023480581 7:40629510-40629532 GCCCCCTATTCCTGCCACATAGG - Intronic
1023925239 7:44664179-44664201 CTCCCCTTCCCCCACCACAGTGG - Intronic
1024393692 7:48843028-48843050 CCCCTCTAGCCCTCTCACAGGGG - Intergenic
1024401555 7:48929387-48929409 CCCCTCTAGCCCTCTCACAGGGG + Intergenic
1024783563 7:52880070-52880092 ACCCCCTACCCCTCCAACACAGG - Intergenic
1025275788 7:57580491-57580513 CCCCACCACCCCTGCCACCACGG - Intergenic
1026090479 7:67295694-67295716 ACCCCCTACCCCCACCCCAGAGG - Intergenic
1026199855 7:68205391-68205413 CAGCCCCACCCCTGACACAGAGG + Intergenic
1026319180 7:69254179-69254201 ACCCCCTAACACTGCCACATTGG - Intergenic
1026706784 7:72700818-72700840 CCCCCCTCGCCCTCCCAAAGTGG - Intronic
1026745956 7:73013179-73013201 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1026749609 7:73041323-73041345 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1026753257 7:73069433-73069455 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1026756908 7:73097469-73097491 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1027032063 7:74897737-74897759 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1027090498 7:75296017-75296039 ACCCCCTACCCCCACCCCAGAGG - Intergenic
1027094143 7:75323945-75323967 ACCCCCTACCCCCACCCCAGAGG - Intergenic
1027097786 7:75351912-75351934 ACCCCCTACCCCCACCCCAGAGG - Intergenic
1027120075 7:75511007-75511029 ACCCCCTACCCCCACCCCAGAGG - Intergenic
1027271754 7:76524602-76524624 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1027321561 7:77015757-77015779 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1027325195 7:77043680-77043702 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1029014853 7:97305280-97305302 CCCCCCTAGGCCGGGCACAGTGG - Intergenic
1029234186 7:99099592-99099614 ACCTCCCACCGCTGCCACAGTGG - Intronic
1029398886 7:100328912-100328934 ACCCCCTACCCCCACCCCAGAGG - Intergenic
1029717430 7:102339017-102339039 ACCCCCTACCCCCACCCCAGAGG + Intergenic
1030503568 7:110390164-110390186 CCCCTCTACCACTGTCACAGAGG - Intergenic
1034921572 7:155087616-155087638 CCCCCCCACCCCCGGCACAGTGG - Intergenic
1034990179 7:155543042-155543064 CCGCCTCACCCCTCCCACAGAGG + Intergenic
1035171941 7:157021807-157021829 CACCCCAACCCCGGCCGCAGTGG + Intergenic
1036185632 8:6620450-6620472 GCACCCTACCCCTGCCTCCGAGG + Intronic
1036927193 8:12918544-12918566 CCTCTCTTCCCCTGCCACAGTGG - Intergenic
1037449632 8:19003733-19003755 CCCCCCACCCCCTGCCAGTGTGG - Intronic
1040277684 8:46022284-46022306 CCCCCCAAGGCCTGGCACAGAGG + Intergenic
1041452902 8:58026091-58026113 CCCCTTTACCCCTGCTACATGGG + Intronic
1041636917 8:60155305-60155327 TCCCCCAACCCCTCCCACAATGG - Intergenic
1042077790 8:65015321-65015343 CACCTCTGCCCCTGCCACAATGG + Intergenic
1044813896 8:96091011-96091033 CCTCCCAACCCCAGCCAAAGGGG - Intergenic
1044847950 8:96399948-96399970 ACCCCCTACCCCTGACAGAGAGG - Intergenic
1045792077 8:105995563-105995585 TCCCCCTCCCCCTCCCACAAAGG + Intergenic
1046195394 8:110857541-110857563 CTCCCCTTGCCCTGCCAAAGTGG - Intergenic
1049359065 8:142203282-142203304 TGCCCCTACCCCTGTCCCAGGGG - Intergenic
1049410472 8:142471758-142471780 CCCCCTTCCTCCCGCCACAGAGG - Intronic
1049414174 8:142487891-142487913 CCCCCATCCCCCTTCTACAGAGG + Intronic
1049446673 8:142634534-142634556 CACCCTAGCCCCTGCCACAGAGG + Intergenic
1049476889 8:142801038-142801060 CCCACCTAGCCCTGCCCCACTGG - Intergenic
1049479062 8:142811360-142811382 CCCACATTCCCCTGGCACAGGGG - Intergenic
1049547229 8:143238682-143238704 TGCCCCTACCCCAGCTACAGTGG + Intergenic
1049645397 8:143733662-143733684 CCCCCCTCCCCCGGCCCGAGCGG - Intronic
1051575911 9:18615310-18615332 TACCCCTCCCCCTGCCACACAGG - Intronic
1052537599 9:29767055-29767077 CCCCCCTACTCCTGCAAGAATGG + Intergenic
1053409669 9:37907395-37907417 GCCCCATTCCCCTGCCCCAGAGG + Intronic
1053900727 9:42793072-42793094 GCCCCCAACCCCCGCCCCAGAGG - Intergenic
1054254401 9:62799712-62799734 CCACCCTACCCTGGCCAAAGGGG - Intergenic
1054336895 9:63815889-63815911 CCACCCTACCCTGGCCAAAGGGG + Intergenic
1054455639 9:65428966-65428988 ACCCTCTACCCCTGCAACAAGGG + Intergenic
1055405446 9:75969023-75969045 CCCCCCACCCCCCGCCATAGAGG - Intronic
1055654214 9:78437270-78437292 CCTCCCTACTCCTTCCACAATGG - Intergenic
1056496210 9:87157884-87157906 CCCACCTCCCCATGCCTCAGGGG - Exonic
1056702708 9:88924281-88924303 CCCCCCGACCCCCACCCCAGAGG - Intergenic
1057239144 9:93392924-93392946 CCCCCATCCCCCTGCCACCAGGG + Intergenic
1057293933 9:93824597-93824619 CACCCCTGCCCCTTGCACAGTGG - Intergenic
1057641784 9:96830586-96830608 CCCAACCTCCCCTGCCACAGTGG + Intronic
1058495079 9:105548552-105548574 TCCCCATGCCCCTGCAACAGAGG - Intronic
1058906636 9:109487318-109487340 CCTCCCTGCTCTTGCCACAGTGG - Intronic
1059357110 9:113708504-113708526 TCTCTCTTCCCCTGCCACAGTGG + Intergenic
1060185271 9:121560337-121560359 CCCCCCTCCCCCAACCACATGGG - Intergenic
1060617074 9:125026995-125027017 CCCCGCACCCCGTGCCACAGAGG - Intronic
1060733058 9:126050013-126050035 CCCCCCCACCCCCGTCCCAGGGG - Intergenic
1060964741 9:127706282-127706304 TCCCCCTGCCCCTGCCCCAAGGG + Intronic
1060991162 9:127850021-127850043 CACCCCCACTCCTGCCACAGGGG + Intronic
1061509170 9:131049976-131049998 CCTCCCTCCCTCTGCCAGAGAGG + Intronic
1062015297 9:134288227-134288249 CTCCCCTGCCCCTGCTCCAGAGG + Intergenic
1062538522 9:137031409-137031431 CCCACCTGCCCCTGGCCCAGCGG - Exonic
1062628756 9:137454361-137454383 CCCCCCCACCCCCGCCGCACGGG + Intronic
1203376830 Un_KI270442v1:383316-383338 CCACCCTACCCTGGCCAAAGGGG + Intergenic
1185982333 X:4793327-4793349 CTCCCCTTCCCCTTCCACCGCGG - Intergenic
1186979120 X:14939939-14939961 CCCTCCTCCCCCTCCCACTGTGG + Intergenic
1187789766 X:22937549-22937571 CCCCCGTTTCCCTGCCCCAGTGG + Intergenic
1189197159 X:39162323-39162345 ACCCTCTACCCCTGCCTTAGAGG + Intergenic
1190057680 X:47191159-47191181 CCCCCCAAACCCTGCCTCCGAGG - Intronic
1190301940 X:49062148-49062170 CCCAGCTTCCCATGCCACAGCGG - Intronic
1191194392 X:57705775-57705797 CCCCCCTCCCCCTTCCTCAATGG + Intergenic
1192549910 X:72045469-72045491 CCCCTCCACCCCTGCCACGAGGG - Intergenic
1193607214 X:83583505-83583527 CCCCACTGCCACTGCTACAGCGG + Intergenic
1194727726 X:97417785-97417807 CCCCTCTGCCCCTGCCCCAGTGG + Intronic
1194874430 X:99169144-99169166 CCACCTTACCCCTGCCAGAATGG + Intergenic
1195310175 X:103624831-103624853 CTCCCCTACCCCTGCCCCAGGGG - Intronic
1195311772 X:103638790-103638812 CTCCCCTACCCCTGCCCCAGGGG - Intergenic
1196258324 X:113548776-113548798 CCCCCCTGCAACTGTCACAGTGG + Intergenic
1196419645 X:115508566-115508588 CCCCCCCACCCCTGCCGATGGGG + Intergenic
1196663363 X:118292004-118292026 CCCCTCTTCCCTTGCCAGAGTGG + Intergenic
1198311232 X:135426761-135426783 CCCTCCCATCCCTGCTACAGAGG + Intergenic
1199711128 X:150470454-150470476 CCCCCTTACCAGTGCCTCAGTGG + Exonic
1200116698 X:153772687-153772709 CCCACCCACCCCTGCCGCATGGG - Intronic
1200213589 X:154357623-154357645 CTCCCCTGCCTCTGCCACACAGG - Exonic
1201064908 Y:10088621-10088643 CCACCCTACCCTCGCCAAAGGGG - Intergenic