ID: 969482994

View in Genome Browser
Species Human (GRCh38)
Location 4:7456763-7456785
Sequence ACCCCCCTACCCCTGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 319}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969482994_969483000 9 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969483000 4:7456795-7456817 TCTCTCGACGATCAGTGTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 35
969482994_969483004 28 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969483004 4:7456814-7456836 GAGGGAAGGATCACAGGCTTTGG 0: 1
1: 0
2: 5
3: 48
4: 382
969482994_969483003 22 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969483003 4:7456808-7456830 AGTGTGGAGGGAAGGATCACAGG 0: 1
1: 0
2: 2
3: 25
4: 311
969482994_969482999 6 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482994_969483005 29 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969483005 4:7456815-7456837 AGGGAAGGATCACAGGCTTTGGG 0: 1
1: 0
2: 3
3: 27
4: 273
969482994_969483001 10 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969483001 4:7456796-7456818 CTCTCGACGATCAGTGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 30
969482994_969483006 30 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969483006 4:7456816-7456838 GGGAAGGATCACAGGCTTTGGGG No data
969482994_969483002 14 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969483002 4:7456800-7456822 CGACGATCAGTGTGGAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969482994 Original CRISPR ACCCCCCTACCCCTGCCACA GGG (reversed) Intronic
900406860 1:2496586-2496608 GACCCCCTGCACCTGCCACAGGG + Exonic
900593329 1:3469323-3469345 CCCCACCTGCCCCTGCCACCCGG + Intronic
900606953 1:3527982-3528004 AGCCCCCTGCCACTGCCAGATGG - Intronic
901135209 1:6988601-6988623 CACCCCCTACCCCTGCGCCACGG + Intronic
901498935 1:9639581-9639603 AGCCCCCCACCCCGGCCCCAAGG + Intergenic
902718792 1:18290784-18290806 TCCCCCCTACCCCAGCCCCTTGG + Intronic
903628616 1:24748974-24748996 ACCCCCCTCCGCCTCCCAAAAGG - Intronic
903803770 1:25989565-25989587 ACTCTTCTACCCCTGCCAAAAGG - Exonic
904299172 1:29543098-29543120 GCTCCCCAACCCCTTCCACATGG + Intergenic
904782807 1:32963860-32963882 ACACCCCGCCCCCTGCCCCAGGG - Intronic
905228061 1:36492867-36492889 ATCCCCATCCTCCTGCCACAGGG - Intergenic
905548021 1:38815647-38815669 ACCCCCCTGCCCCCACCAGAAGG - Intergenic
906063325 1:42962352-42962374 GCCCCCATGCCCCAGCCACAGGG - Intergenic
906805440 1:48775955-48775977 ACCTCCTTACCTCTGCCACCTGG + Intronic
906935150 1:50208271-50208293 ACCCACCTCTCCCTGCCAAAGGG - Intergenic
906960197 1:50415548-50415570 GCCCCCCTGCCCCTGCTACCAGG + Intergenic
907421871 1:54353125-54353147 CCCCACACACCCCTGCCACAGGG + Intronic
907524485 1:55046302-55046324 ACTCCCATATCCCTGCAACACGG - Intronic
908599141 1:65719858-65719880 CCCCCCAACCCCCTGCCACAAGG - Intergenic
909704150 1:78561583-78561605 GCCCCCCTGCCCCAGCCACATGG + Intergenic
911734464 1:101321750-101321772 CCCTCCCTACCTCTGCCCCAGGG + Intergenic
913119697 1:115728452-115728474 ACCCCCCTACCCCTGAGAAGAGG - Intronic
913497169 1:119439018-119439040 ACCCTCCTGCTCCTGTCACAAGG - Intergenic
913500346 1:119467238-119467260 ACCCTCCTGCTCCTGTCACAAGG - Intergenic
913504852 1:119507494-119507516 ACCCTCCTGCTCCTGTCACAAGG - Exonic
913511183 1:119564083-119564105 ACCCTCCTGCTCCTGTCACAAGG - Intergenic
913515420 1:119601357-119601379 ACCCTCCTGCTCCTGTCACAAGG - Intergenic
914343032 1:146776451-146776473 ACCCCCCCACCCCTGCAACCAGG + Intergenic
915301407 1:154953626-154953648 ACCCCCCAACCCCACCCCCATGG + Intronic
915310763 1:155004851-155004873 ACACCCCCAGCCCTGGCACAGGG + Intronic
916595079 1:166235541-166235563 ACCCCCCTCCCCTTGCAAGATGG - Intergenic
917887284 1:179398856-179398878 TCCCCCCAACCCCTGCCACAAGG - Intronic
920102834 1:203528721-203528743 ACACCCATACCACTCCCACATGG + Intergenic
920344359 1:205296526-205296548 CACCCCCAACCCCTGCCACCAGG + Intergenic
923681178 1:236119888-236119910 ACGCCCCTACCCCTGCTTCCAGG - Intergenic
1062971758 10:1653934-1653956 ACTCCCCTCCCCCAGCCACACGG - Intronic
1064149425 10:12850174-12850196 ACCTTGCTAACCCTGCCACAGGG - Intergenic
1067261972 10:44700620-44700642 ACCTGCCTACCACTTCCACAGGG + Intergenic
1068613070 10:59082134-59082156 TGCCCCCTACCTCTGACACACGG + Intergenic
1069793463 10:71038341-71038363 CCCTCCCTGTCCCTGCCACATGG + Intergenic
1069819802 10:71220389-71220411 CCACCCCTACCCCTGCCAAATGG - Intronic
1069932073 10:71889636-71889658 TGCCCCCAACCCCTACCACAGGG + Intergenic
1070592966 10:77813328-77813350 ACCACCCCACCCCGGCCACCTGG + Intronic
1070961920 10:80505380-80505402 TCCCCAGCACCCCTGCCACAGGG - Intronic
1072095914 10:92179677-92179699 ATCTCCCTAACCCTGCCAAAAGG + Intronic
1072640076 10:97205213-97205235 CTGCCCCTACCCCTGCCCCAAGG + Intronic
1073015031 10:100391843-100391865 ACTCCCCAACCCCTGCCATACGG + Intergenic
1073177294 10:101564436-101564458 GCCCCCCCACCCCACCCACATGG - Intergenic
1074104990 10:110382704-110382726 ACATCCAAACCCCTGCCACACGG - Intergenic
1075269067 10:121033276-121033298 ATCCCCTAACCCCTGCCTCAGGG - Intergenic
1075381053 10:122018971-122018993 AGCGCCTTACCCCTGCCACAAGG - Intronic
1075631835 10:124005152-124005174 ACTCCACTACCCCAGTCACAGGG + Intergenic
1076658174 10:132037836-132037858 TTCCCCCTACCCCTGCCCCGGGG + Intergenic
1076999481 11:315577-315599 AAGCCCCTGCCCCTCCCACAGGG - Intergenic
1077174178 11:1181199-1181221 ACCCCCGGACCCCAGCCCCAGGG - Intronic
1077417919 11:2433449-2433471 AGCCCCCTACCCCAGCCACTGGG - Intergenic
1077490937 11:2860680-2860702 CCCCTCCTTCCCCTACCACAAGG - Intergenic
1078144337 11:8712786-8712808 ACTCCTCTACCCCTGGCTCAGGG + Intronic
1078547828 11:12258817-12258839 ATCACCCCATCCCTGCCACATGG - Intronic
1079089085 11:17468147-17468169 ATCCCCCTACCCCTAGCCCAGGG - Intronic
1079279863 11:19077368-19077390 TCCCCCCTTCCCCTGTCTCAGGG - Intergenic
1081861466 11:46335570-46335592 TCCCCCCAACCCCTGCCTCCAGG + Intronic
1082037380 11:47656398-47656420 ATCTTCCTACCCCTGCCTCACGG + Intergenic
1082852407 11:57777241-57777263 ACTGCCCTACCCTTGCCACCTGG + Intronic
1082971764 11:59030184-59030206 AGCCCACTTGCCCTGCCACAAGG - Intronic
1083331739 11:61901648-61901670 ACCCGCAGTCCCCTGCCACAGGG - Intronic
1084116412 11:67045273-67045295 CCCCACCTACCCCCGCCCCAAGG - Intronic
1084419693 11:69054114-69054136 ACCCCCCAGGCCCGGCCACAGGG - Intronic
1084562813 11:69913907-69913929 CCCACCCCACCCCTGCCAAATGG + Intergenic
1084777463 11:71387040-71387062 GCCCCCCTGCCCCGCCCACACGG + Intergenic
1084971146 11:72772757-72772779 ATCCCTGAACCCCTGCCACAGGG + Intronic
1084987631 11:72890409-72890431 GCACCCCTCCCCCTGCCCCAAGG + Intronic
1085347422 11:75777140-75777162 CCACCCCCACCCCTGCCTCAAGG + Intronic
1086261658 11:84947258-84947280 CGCCCCCTACCCCTGCCAGAAGG - Intronic
1089308225 11:117540394-117540416 ATCCCCCTACCCCTGTCCCGTGG + Intronic
1089596906 11:119586314-119586336 CCCCCCCCACCCATGCCACACGG + Intergenic
1090267141 11:125360232-125360254 ACCCCCACACACCTCCCACAGGG - Intronic
1091513569 12:1154858-1154880 ACCACCCTACCCCATCCAGAAGG + Intronic
1091632227 12:2170865-2170887 GCCCACCAACCCCTGCCTCAGGG - Intronic
1091905828 12:4188402-4188424 CACCCCCAACCCCTGCCCCACGG - Intergenic
1091919172 12:4290581-4290603 ACCCCCCTCCTCCTGCCCCCAGG + Intronic
1092154539 12:6273839-6273861 ACCCCACTCCCCATGCCCCAGGG - Intergenic
1092341790 12:7682933-7682955 ATCCGCCTACCTCTGCCTCAGGG - Intergenic
1093969370 12:25360924-25360946 ACCCCACATCCCCAGCCACAGGG + Intergenic
1096498925 12:52053976-52053998 AGCCCCCTGCCCCTCCCCCATGG - Intronic
1098771717 12:74560703-74560725 GCCCCCCTACCCCAGCCATGTGG - Intergenic
1098804913 12:75011240-75011262 TCTCCCCTAACCCTGCCACAGGG - Intergenic
1099909164 12:88808530-88808552 TCCCCCCTACCACCCCCACAAGG - Intergenic
1101155353 12:101922646-101922668 ACACCCCTACCGCTGCCATTTGG + Exonic
1101579150 12:106026315-106026337 ATCCCCCTACTCCAGCTACAGGG + Intergenic
1103075701 12:117980765-117980787 ACCCTCCTTCCCCTGCCCCCTGG - Intergenic
1103593570 12:122009408-122009430 ACGCCCCCACCCTTGCCTCACGG - Intergenic
1103703642 12:122860284-122860306 ACCCTCCACCCCCTACCACAGGG + Intronic
1103953801 12:124566081-124566103 ACTCCCCCACCCCGCCCACAGGG + Intronic
1104343251 12:127971830-127971852 TCACCCCCACCCCTGCCAAATGG + Intergenic
1104650274 12:130526085-130526107 AACCCCCCACCCCTGCCAACTGG - Intronic
1105255130 13:18739292-18739314 ACACCCTTTCCCCTTCCACAGGG - Intergenic
1106620131 13:31364754-31364776 ACCCCCCTACCCCGGCTCTATGG - Intergenic
1111811416 13:93096941-93096963 ACCCCCCCCCCCCCGCCATATGG + Intergenic
1113902953 13:113806680-113806702 AGCCTCCTGCCCCTGCCCCAGGG + Intronic
1114072820 14:19128041-19128063 ATCCTCCTACCCCTACCACAAGG - Intergenic
1114089442 14:19271931-19271953 ATCCTCCTACCCCTACCACAAGG + Intergenic
1114617122 14:24074243-24074265 ACTCCCCTAACCTTACCACAAGG - Intronic
1118748126 14:68788918-68788940 CCCCCCCCACCCCTGCCCCTTGG - Exonic
1118760963 14:68879908-68879930 AGCCCCCAACCCCTGCCCCAGGG - Intronic
1118787987 14:69062493-69062515 ACCACCCTACCAATGCCACCTGG + Exonic
1119202878 14:72771494-72771516 CCCACCCCACCCCTGCCACATGG + Intronic
1119668274 14:76499752-76499774 ACTCCTCTACCCCAGGCACACGG + Intronic
1121019814 14:90573029-90573051 GCCCCCCAACCCCCGCCCCAAGG - Intronic
1121410174 14:93744224-93744246 ACCACCCTTTCCCTGCCTCAGGG + Intronic
1121509470 14:94501666-94501688 GCCCCCCCACCCCCGCCCCAAGG + Intronic
1122036220 14:98951039-98951061 ACACCCCTACCCCCATCACATGG - Intergenic
1122113544 14:99516982-99517004 AACCTCCCACCCCTGCCACTTGG + Intronic
1122745290 14:103894150-103894172 ATCCCCCCACCCCCTCCACACGG - Intergenic
1122878332 14:104678927-104678949 ACCACCCCAGCTCTGCCACATGG - Intergenic
1122940513 14:104978984-104979006 ACCCCACTGGCCCTGCCCCAGGG + Intergenic
1123016479 14:105377951-105377973 ACCCCCATCCCGCAGCCACACGG - Intronic
1123056273 14:105572147-105572169 ACCCGCCTCCCCCTGGCACTGGG + Intergenic
1123057660 14:105579660-105579682 ACCCGCCTCCCCCTGGCACTGGG - Intergenic
1123080702 14:105692275-105692297 ACCCGCCTCCCCCTGGCACTGGG + Intergenic
1123081939 14:105699593-105699615 ACCCGCCTCCCCCTGGCACTGGG - Intergenic
1128993375 15:72278907-72278929 ACCCAGCTCTCCCTGCCACAGGG + Intronic
1129160963 15:73747553-73747575 CCTCCCCTACCCCTGCCCCAGGG - Intronic
1129394711 15:75237543-75237565 AGCCCCCTCCTCCTGCCCCAGGG - Intergenic
1129910586 15:79222895-79222917 TCCCCCTTCCCCCTGCCCCACGG + Intergenic
1130953646 15:88611775-88611797 ACCCCCCTCCCCTCGCCACCAGG - Intergenic
1132907218 16:2288894-2288916 CCTGCCCTCCCCCTGCCACAAGG + Intronic
1133132584 16:3686683-3686705 AGCCCCCAACCCCAGCCAGAGGG - Intronic
1133950512 16:10387827-10387849 CCCCCCCTCCCCCCGCCACCCGG + Intronic
1133998245 16:10763336-10763358 ACCCCCCTACCACTTCCTCGAGG - Intronic
1134468116 16:14497016-14497038 ACGCCCCTTCCCCTGCCTGAGGG + Intronic
1135288514 16:21214518-21214540 ACCCCCCAACCCCTGTCACCAGG - Intergenic
1135544797 16:23358322-23358344 TACCCCCTACCCCTCGCACATGG - Intronic
1136020610 16:27437563-27437585 TGCCACCTACACCTGCCACATGG + Exonic
1136231064 16:28885733-28885755 ACCAGCCCACCCCTTCCACATGG + Intronic
1136594638 16:31239670-31239692 TCCTCCCTGCCCCTGCCCCAGGG + Intergenic
1136655368 16:31706198-31706220 ACTCCCCTTCCCCTGACGCAGGG - Intergenic
1138237980 16:55401588-55401610 GCCCCCATACTCCTGCCTCAGGG + Intronic
1139436271 16:66938275-66938297 GCACCCCCACCCCTGCCCCAGGG - Intronic
1139990954 16:70938877-70938899 ACCCCCCCACCCCTGCAATCAGG - Intronic
1141523844 16:84598810-84598832 TCCCCCCCACCCCTGCCGCTTGG - Intronic
1141807606 16:86352167-86352189 TCCTTCCTCCCCCTGCCACATGG + Intergenic
1142202964 16:88769925-88769947 ACACCCCTTCCAATGCCACATGG + Intronic
1142319054 16:89369374-89369396 ACCCGCATGACCCTGCCACAGGG + Intronic
1142715622 17:1745447-1745469 ACCCCCCGACCCCTGCCGATGGG - Intronic
1142719445 17:1766675-1766697 CCGCCCCTCCCCCTGCCTCAGGG - Intronic
1143585259 17:7847657-7847679 CCCCACCTATCCCTGCCACCTGG + Exonic
1143829071 17:9636598-9636620 ACCCCTCTACCCCTCCTACGAGG + Intronic
1144343650 17:14331502-14331524 AGCCCCCAACCCCCACCACAAGG - Intronic
1144529452 17:16022009-16022031 ACCCCCCGACCACAGGCACAGGG - Intronic
1145191315 17:20843458-20843480 CCTCCCCTACCCCCGCCCCAGGG + Intronic
1145943647 17:28757839-28757861 ACCCCCCTTCCCCTCCCTCCAGG - Exonic
1146078725 17:29757768-29757790 CACCCCCCACCCCTGCCACTGGG - Intronic
1148150793 17:45395632-45395654 ACCCACCCACCCCTGCCACAGGG - Exonic
1149323704 17:55508216-55508238 TCCCCCTCACCCCTTCCACAAGG + Intergenic
1149637232 17:58180765-58180787 ACCCCTCCACGCCTGCCACAGGG - Intergenic
1149685300 17:58531550-58531572 ACCCACCTACCCTGGGCACAGGG - Intronic
1151702934 17:75752926-75752948 GCTCCCCTACCCCTGCCAGGTGG - Intronic
1152926593 17:83090340-83090362 ACCCCCCACCCCCCGCCCCAGGG + Intronic
1155177809 18:23316122-23316144 ACCCTCCAACTCCAGCCACAAGG + Intronic
1155488320 18:26371503-26371525 ACACTCCTACCTCTGCCACCTGG - Intronic
1156460967 18:37321071-37321093 CCCCCCCCATCCCAGCCACAGGG - Intronic
1156469181 18:37366886-37366908 ACCCATCTACCCGTGCCCCATGG + Intronic
1160567797 18:79798030-79798052 ACCCCCCACCCCCGGCCCCACGG - Intergenic
1160751780 19:737829-737851 CCCCTCCCGCCCCTGCCACAGGG - Intronic
1160932153 19:1575865-1575887 TGATCCCTACCCCTGCCACAGGG - Intronic
1161988759 19:7671989-7672011 ACCCACCTACCACGGCCACATGG + Intergenic
1163488348 19:17602753-17602775 ACCAACCTTCCCCTTCCACACGG - Exonic
1163530461 19:17845791-17845813 GCCGCCCCACCCCAGCCACAGGG - Intronic
1163745340 19:19043393-19043415 AGCCCCCTGCCTCTGCCCCAGGG - Intronic
1164388719 19:27798247-27798269 ACTCCCTCACCCCTGCCACCAGG + Intergenic
1165070800 19:33253848-33253870 AGCCCCCTACCCACCCCACAGGG - Intergenic
1165165237 19:33849425-33849447 ACCCCCCTACCCCCAGCAGAGGG + Intergenic
1165443927 19:35846253-35846275 ACCCCCCTACCCTGCCCACTGGG + Intronic
1165469707 19:35996161-35996183 AGACCCCTACCCCTTCCTCATGG - Exonic
1166288209 19:41845283-41845305 TCCCCCCTTCCCGTGCCCCAGGG - Intronic
1167198698 19:48049043-48049065 GCCCCCCTTCCCCTTCCACCAGG + Intronic
925443806 2:3910378-3910400 TGTCCCCTGCCCCTGCCACAGGG - Intergenic
926584883 2:14675065-14675087 ACCCCCCCGCCCCTGCTCCAGGG + Intergenic
928319759 2:30273818-30273840 AACCCCCGACCCCTGCCCCACGG + Intronic
929075308 2:38075450-38075472 ACGCCCCTACCCCAGCCTCTGGG + Intronic
929589201 2:43134285-43134307 GCCCCTCTTCCCCTGCAACAAGG + Intergenic
930100138 2:47596965-47596987 CACCCCCAACCCTTGCCACAGGG + Intergenic
930155137 2:48099106-48099128 ACCCCCTTCCCCCTCACACATGG + Intergenic
930672480 2:54165753-54165775 TCTTCCCTACCCCTGCCCCAAGG + Intronic
933636468 2:84713687-84713709 TCCCCCCAACCCCAGCCCCATGG - Intronic
933695323 2:85213138-85213160 CTCCCCCCACCCCAGCCACAGGG - Intronic
934553841 2:95277272-95277294 ACTCCCCTCCCCCAGCCAAAGGG - Intronic
934561816 2:95317443-95317465 TAGCCCCTGCCCCTGCCACAGGG - Intronic
935656661 2:105429136-105429158 ACCCTCCCTCCACTGCCACAAGG + Intronic
936043182 2:109165417-109165439 ACCCCACCACCCCTGCTAGAAGG + Intronic
936369713 2:111893622-111893644 CCCCTCCAACCCCTGCCACAGGG + Intergenic
936462629 2:112723904-112723926 ACCCTCCTACCCCCACCACTGGG + Intronic
937239756 2:120452416-120452438 CCCCCACCACCCCTGCCACATGG + Intergenic
937297387 2:120817878-120817900 ATCCCCTCAGCCCTGCCACATGG - Intronic
938894627 2:135737952-135737974 ACCCCCCTACCCTTCCTACAAGG + Intergenic
940011527 2:149060000-149060022 CCCTCCCTACCCCTCCCTCAAGG - Intronic
942251209 2:174049032-174049054 ACCCCCCTGCCCCAGCCACAGGG - Intergenic
942470430 2:176254192-176254214 ACCCCTCCACCCCTGCTACCTGG - Intergenic
947519026 2:230829561-230829583 AACCCCATGCCACTGCCACATGG + Intergenic
948443984 2:238017883-238017905 GCCCCCCAACCCCAGCCACTGGG + Intronic
948712280 2:239832745-239832767 ATGCCCCTGCCCCTGCCCCAGGG - Intergenic
948872836 2:240812245-240812267 ACCCCCAGCCCCCTTCCACAGGG - Intronic
1168830197 20:841516-841538 ACCCCCCATCCCCCGCCACCGGG + Intronic
1169065101 20:2690748-2690770 ACCCCCCAACCCCACACACACGG - Intergenic
1169071597 20:2736163-2736185 GTTTCCCTACCCCTGCCACAGGG - Intronic
1170576744 20:17668807-17668829 GCACCCCTACCCCTGTCCCAGGG + Intronic
1171392577 20:24811229-24811251 ACCGCCCTACCCAGCCCACATGG + Intergenic
1172152198 20:32798382-32798404 ACCCCCTTACCACTTCCACAGGG - Intronic
1172305066 20:33874965-33874987 ACCCACCTAGCCCTCCCAAAGGG + Intergenic
1172948804 20:38708629-38708651 ACCCAGCTACCCCTTCCCCAGGG - Intergenic
1173256071 20:41395075-41395097 ACCAGCCTGCCCCTCCCACACGG - Intergenic
1174218791 20:48936254-48936276 ACCCCCCCACCCCTGCCGGACGG + Intronic
1174900075 20:54490459-54490481 ACCCTCCCACTCCTGCCACATGG - Intronic
1175260736 20:57672646-57672668 ACCTCCCTGCCTCTGCCCCAGGG - Intronic
1175937929 20:62523467-62523489 TGCCCCCAACCCCTCCCACAAGG - Intergenic
1175941538 20:62539663-62539685 ACCCCCATATCCCAGCCACCAGG + Intergenic
1176253628 20:64139355-64139377 GGCTCCCTACCCCAGCCACAGGG - Intergenic
1179048724 21:37870225-37870247 ACCCCCCGGCCCCAGCCACCTGG + Intronic
1180001298 21:44996692-44996714 AGCCCCTTCCTCCTGCCACAGGG - Intergenic
1180079943 21:45482071-45482093 ACCCCCGGACCCGGGCCACATGG - Intronic
1180099306 21:45577031-45577053 ACCATCCCACCCCTGACACAGGG + Intergenic
1180181117 21:46119125-46119147 TCCCTCCTGCCCCTGCCTCAGGG + Intronic
1180491264 22:15850416-15850438 ATCCTCCTACCCCTACCACAAGG - Intergenic
1181120943 22:20668498-20668520 CCTCCCCTACCCCTGCCCCAGGG - Intergenic
1181235592 22:21446065-21446087 GCCCCCCTACCCCTGCAAGGAGG + Exonic
1181333909 22:22115524-22115546 CCTCCCCTACCCCCGCCCCAGGG - Intergenic
1182326640 22:29518362-29518384 GACCCCATCCCCCTGCCACATGG + Intronic
1183306601 22:37086244-37086266 ACCACCCCTCCCCTGCCCCAGGG + Intronic
1183986221 22:41572031-41572053 GCCCACCTTCCCCTTCCACAGGG + Exonic
1184465929 22:44668849-44668871 GCCCCCCAACCCCAGCCACCCGG - Intronic
1184485575 22:44776789-44776811 GCACCCCTACCCCCGCCACCAGG - Intronic
1184497242 22:44849072-44849094 AGCCCCCCACCCCTGCGCCAGGG - Intronic
1184770334 22:46593465-46593487 GCCCCCCAACCCCTGCCGCAGGG + Intronic
1184854053 22:47136833-47136855 ACCACCCTACCGATGCAACAGGG - Intronic
1185173358 22:49305886-49305908 AGCCCCCTGGCTCTGCCACAGGG + Intergenic
1185241538 22:49750019-49750041 TCACCCCTACCCCACCCACAGGG + Intergenic
950543767 3:13627069-13627091 ACCCCGCTGCCCCAACCACAAGG - Intronic
951553042 3:23894706-23894728 CCCCTCCTACCACTACCACAAGG + Intronic
952927748 3:38334160-38334182 ACCCCTCGACCCCTGCAACTGGG + Intergenic
953824656 3:46240449-46240471 CTCTCCCTACCCCTTCCACATGG + Intronic
954440799 3:50520997-50521019 ACCCTCCTTCCCTTTCCACAAGG - Intergenic
954847346 3:53571396-53571418 ACCCTACTGCCCCTGCCACAAGG - Intronic
955936745 3:64109579-64109601 CCTCCCCCACCCCTGCCCCAGGG - Intronic
959918806 3:111848302-111848324 ACCCCCCGCCACCTGCCACTAGG + Intronic
960868970 3:122230528-122230550 ATCCCCCACCCCCTGCAACAGGG + Intronic
962189966 3:133300165-133300187 ACCCCCCCATACCAGCCACAGGG - Intronic
962588988 3:136869468-136869490 ACCCCGCAACCCCTGCCTCCCGG - Intronic
963285441 3:143430538-143430560 ACTGCCCTGCCCCTTCCACAGGG - Intronic
966908376 3:184543989-184544011 ACCCCCCCACCCCCGCGACGTGG + Intronic
968612527 4:1563704-1563726 CCACCCCCACCCCTGCCCCAGGG + Intergenic
968984596 4:3868322-3868344 ACTCCCCAACCCCCGCCCCAGGG + Intergenic
969395078 4:6915337-6915359 AACCCCCTACCCCGGTCGCAGGG - Intronic
969482994 4:7456763-7456785 ACCCCCCTACCCCTGCCACAGGG - Intronic
973800195 4:54470269-54470291 ACCCTCCCACCACTTCCACAGGG - Intergenic
974062394 4:57047135-57047157 ACCCCCCAACCCATGACACATGG - Intronic
974410916 4:61539810-61539832 CCCCACCTACCCTTCCCACAGGG + Intronic
975579255 4:75892019-75892041 ACCCCCAAACCCCTGGCCCAGGG - Intronic
980100674 4:128538757-128538779 ATCCCTCTGCCCTTGCCACAAGG - Intergenic
982134403 4:152259499-152259521 ATGCCCCTCCCCCTGCCACAGGG + Intergenic
986593045 5:9391304-9391326 GCCCCTCTGCCCCTGCCTCAAGG - Intronic
987104701 5:14626558-14626580 ACCTGCCTACCCCAGTCACATGG + Intergenic
990042405 5:51390072-51390094 ACCCCCCTACCCATGCCCCGGGG + Intronic
990752562 5:59033249-59033271 ACCCCCCAATCCCTGTTACAGGG + Intronic
993633643 5:90317941-90317963 ACCCCCCTTCCCCAGTGACAGGG - Intergenic
997882076 5:137600296-137600318 ACCTCCTTCCCCCTGCCCCAGGG - Intergenic
997976401 5:138444105-138444127 ACCCCCCTTCCTCTGCCCTAGGG - Intronic
998000594 5:138621982-138622004 ACCACCCTACCCCTACACCATGG - Intronic
998424287 5:142013322-142013344 ACCCCCCGGCCCCAGCCCCAAGG - Intergenic
999087170 5:148903294-148903316 TGCCCCCAACCCCTGCCACCTGG - Intergenic
999243693 5:150141961-150141983 ACCCCCCTCTCCCTGCAGCATGG - Intronic
1000281032 5:159782204-159782226 ACCCCCTGTCCCCTGCCACAGGG - Intergenic
1001052552 5:168424686-168424708 AACCCCCTACCTCTGACTCATGG - Intronic
1001649069 5:173302367-173302389 TACCCCCCACCCCCGCCACAAGG - Intergenic
1002043718 5:176530895-176530917 ACCCCCCCAGCCCACCCACATGG - Exonic
1002045414 5:176538690-176538712 CCCCCCATCCCCCTGCCCCATGG - Intergenic
1002417477 5:179127949-179127971 ACCCCCTCACCTCCGCCACAGGG + Exonic
1002908464 6:1469927-1469949 AAGCCCCTACCCCTTCCTCAAGG - Intergenic
1003202328 6:3973326-3973348 ACCCGCCTCCACCTCCCACAGGG - Intergenic
1004440027 6:15641439-15641461 TCCCACCTACCCTTTCCACAGGG - Intronic
1006813138 6:36833577-36833599 ACCCCCAGGCCCTTGCCACATGG - Intronic
1007001851 6:38320793-38320815 TCCCACCTACCCATTCCACATGG - Intronic
1007252548 6:40505787-40505809 ACCCCCCAACCCCTGCCAGGAGG - Intronic
1007363445 6:41374115-41374137 CCACCCCTCCCCCAGCCACACGG - Intergenic
1007563564 6:42830622-42830644 GACCCCCTACCCCTGCCCCCTGG - Intronic
1008763438 6:54881907-54881929 TCCCCCTTCCCCCTGCCGCACGG + Intronic
1010744712 6:79547518-79547540 GCCTCCCTACCCCTGACCCAAGG + Intergenic
1015702917 6:136055797-136055819 GCCCCCTTGCCCATGCCACATGG - Intronic
1018173986 6:161163557-161163579 AACCCCCTCCCCATGTCACAGGG - Intronic
1018703415 6:166445778-166445800 TCCCACCTACCCCTGGCTCATGG - Intronic
1019348355 7:541426-541448 AGCCCCCTACCCCACCCCCAGGG + Intergenic
1022617962 7:31951872-31951894 ACCCCCTTCCCTCTTCCACAAGG + Intronic
1023125942 7:36954355-36954377 TCCCCCACACCCCTGCCTCAAGG - Intronic
1023822989 7:43990440-43990462 ACCCCCCAACCCCACCCACCAGG + Intergenic
1023873688 7:44275900-44275922 ACGCCCCCTCCCCTGCCCCAGGG - Intronic
1024771061 7:52723919-52723941 CCCCCCCTACCCCTACCCCCCGG + Intergenic
1025201835 7:56966915-56966937 CCTCCCCAACCCCAGCCACATGG - Intergenic
1025670111 7:63610013-63610035 CCTCCCCAACCCCAGCCACATGG + Intergenic
1026111235 7:67460420-67460442 ACCTCCCCACCCCTGCCCCCAGG + Intergenic
1026724779 7:72862825-72862847 ACCCCCCTCCCCCTGCTCCTAGG + Intergenic
1026796896 7:73371753-73371775 ACCCCCCGCGCCCTGCCTCAAGG - Intergenic
1026978793 7:74514670-74514692 ACCCCCCAACCCCTGCTCCAAGG - Intronic
1030830994 7:114221560-114221582 ACCCCCCTCCCCCAGCCATTGGG + Intronic
1033260821 7:139842660-139842682 ACCCCCCTACCCTATCCACCAGG - Intronic
1033372566 7:140724197-140724219 CCGCCCCTGCCCCTGCCCCACGG + Intronic
1035322766 7:158044316-158044338 CGCCCCCCACCCCTGCCTCAGGG - Intronic
1036706176 8:11048850-11048872 CCCTCCTTACCCCTGCCCCATGG + Intronic
1037155031 8:15689361-15689383 ACCCCCAGGCCCCAGCCACAAGG - Intronic
1038202673 8:25429594-25429616 ACCCCCCTACCCCATTCAAAAGG + Exonic
1039717055 8:40120810-40120832 ACCCCCCTCCCCCCGCCTGAAGG - Intergenic
1039916911 8:41866762-41866784 ACACTGCTACACCTGCCACATGG - Intronic
1040306345 8:46213864-46213886 TGCCGCCCACCCCTGCCACATGG - Intergenic
1040598740 8:48864147-48864169 TCCTCCCCACCCATGCCACAGGG - Intergenic
1041452900 8:58026090-58026112 TCCCCTTTACCCCTGCTACATGG + Intronic
1042490384 8:69391141-69391163 AAACCCCTACCCTTGCCTCATGG - Intergenic
1045412434 8:101932192-101932214 AGGCCCCCTCCCCTGCCACAGGG + Intronic
1045459133 8:102411901-102411923 ACCCCCTTCCCCCTCCCGCAAGG - Intronic
1046701934 8:117410689-117410711 CCCTCCCTAACCCTGCCCCAAGG - Intergenic
1047295672 8:123568620-123568642 AGCCCCCTAGCGCTGCCAGAAGG - Intergenic
1047342003 8:123990414-123990436 ACCATCCTACCCCAGCCAGAAGG - Intronic
1047872366 8:129098240-129098262 TCCCCCTCACCCCTGCCCCAAGG + Intergenic
1049255995 8:141614195-141614217 ACCTCCCTCCCCCTGCTCCAAGG - Intergenic
1049511053 8:143026815-143026837 ACCCCTCCTCCCCTGCCCCAAGG - Intergenic
1049593801 8:143474356-143474378 ACCCCCCAGCCCCAGCCACCAGG + Intronic
1051126162 9:13808160-13808182 AGCCCCCTACCTCCACCACAGGG + Intergenic
1052972559 9:34385895-34385917 ACCCCCCTCCCCATGTCAGAGGG + Intronic
1053505654 9:38641330-38641352 TCTCCCCTACTCCTGCCCCAGGG + Intergenic
1054455638 9:65428965-65428987 GACCCTCTACCCCTGCAACAAGG + Intergenic
1055798333 9:80001155-80001177 CCCCCCCTTCCCTTGACACACGG + Intergenic
1056970427 9:91196458-91196480 ACCCCACCACCCTGGCCACAGGG + Intergenic
1057239142 9:93392923-93392945 ACCCCCATCCCCCTGCCACCAGG + Intergenic
1057826966 9:98378723-98378745 ACCCTCCTCCCCTTGCCAAAGGG - Intronic
1058684517 9:107468407-107468429 ACCCCGCAACCACTGCCAAATGG - Intergenic
1058808621 9:108617450-108617472 ACCACCCTGCCCCATCCACAGGG - Intergenic
1060185273 9:121560338-121560360 TCCCCCCTCCCCCAACCACATGG - Intergenic
1060206622 9:121686212-121686234 TTCCCCCTACCCCTGCCCAAGGG - Intronic
1060215521 9:121736384-121736406 ACCCCCGAACCCCTGCTCCAGGG + Intronic
1060630347 9:125152101-125152123 ACCCCCCACCCCCTACCCCATGG - Intronic
1060661527 9:125407950-125407972 ACACCCCTTCCCCTTCCACGAGG + Intergenic
1060964740 9:127706281-127706303 ATCCCCCTGCCCCTGCCCCAAGG + Intronic
1060991161 9:127850020-127850042 CCACCCCCACTCCTGCCACAGGG + Intronic
1061309967 9:129755693-129755715 ACCCACCTCCCCCAGCAACAAGG - Intergenic
1061597386 9:131640746-131640768 ACCCCCCACTCCCTGCCCCACGG + Intronic
1062035341 9:134380307-134380329 CCCACCCTACCCCTGCCCCCAGG - Intronic
1062036150 9:134383455-134383477 CCCATCCTACCCCTGCCCCAGGG - Intronic
1062540854 9:137041033-137041055 CCCCCGCTTCCCCTGCCCCACGG - Intronic
1062610210 9:137370103-137370125 AGCCCCCCACCCCTGTCACCAGG - Intronic
1062628754 9:137454360-137454382 GCCCCCCCACCCCCGCCGCACGG + Intronic
1187279699 X:17848623-17848645 TCACCTCTACCCCTGCCCCAGGG + Intronic
1187372486 X:18721709-18721731 ACCCACCAACCCCATCCACATGG - Intronic
1187775955 X:22757592-22757614 ACCTCCCTACCCCTATCACCAGG + Intergenic
1190375432 X:49784314-49784336 ACCCCCCTTCCCCAACCACCAGG - Intergenic
1190537872 X:51447242-51447264 ACCCCCCAACCCCTACAGCAGGG - Intergenic
1192491574 X:71580135-71580157 GTCCCCCTACTCCTGCCCCAAGG - Intronic
1192549912 X:72045470-72045492 ACCCCTCCACCCCTGCCACGAGG - Intergenic
1193513396 X:82433411-82433433 ACCCCTCTACCACTGTCACCAGG + Intergenic
1193945554 X:87728803-87728825 ACCCCCCTCCCCTTCCCACCTGG + Intergenic
1193968476 X:88020104-88020126 ACCCTCCCACCCCTGCCACTTGG - Intergenic
1195310176 X:103624832-103624854 CCTCCCCTACCCCTGCCCCAGGG - Intronic
1195311773 X:103638791-103638813 CCTCCCCTACCCCTGCCCCAGGG - Intergenic
1195486034 X:105407291-105407313 ACCCCCCTACCCCGTTCAAAAGG - Intronic
1196520002 X:116661711-116661733 ACCCCCCAACCCCCACCCCATGG + Intergenic
1199856326 X:151761866-151761888 ACCCCCCAACTCTTGCCAGAAGG - Intergenic
1200116700 X:153772688-153772710 TCCCACCCACCCCTGCCGCATGG - Intronic