ID: 969482995

View in Genome Browser
Species Human (GRCh38)
Location 4:7456764-7456786
Sequence CACCCCCCTACCCCTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 591}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969482995_969483006 29 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969483006 4:7456816-7456838 GGGAAGGATCACAGGCTTTGGGG No data
969482995_969483001 9 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969483001 4:7456796-7456818 CTCTCGACGATCAGTGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 30
969482995_969483002 13 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969483002 4:7456800-7456822 CGACGATCAGTGTGGAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 74
969482995_969483000 8 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969483000 4:7456795-7456817 TCTCTCGACGATCAGTGTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 35
969482995_969483003 21 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969483003 4:7456808-7456830 AGTGTGGAGGGAAGGATCACAGG 0: 1
1: 0
2: 2
3: 25
4: 311
969482995_969482999 5 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482995_969483005 28 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969483005 4:7456815-7456837 AGGGAAGGATCACAGGCTTTGGG 0: 1
1: 0
2: 3
3: 27
4: 273
969482995_969483004 27 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969483004 4:7456814-7456836 GAGGGAAGGATCACAGGCTTTGG 0: 1
1: 0
2: 5
3: 48
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969482995 Original CRISPR CACCCCCCTACCCCTGCCAC AGG (reversed) Intronic
900359160 1:2279566-2279588 CTCCCCCCTCCCCCTGCAGCTGG - Intronic
901562141 1:10080894-10080916 CACCCCCATTCCCCAGCCTCTGG - Intronic
901643047 1:10702708-10702730 CACTGCCCCACCCCTGCCAGCGG + Intronic
902700766 1:18170211-18170233 TCCTCCCCTGCCCCTGCCACTGG - Intronic
902896926 1:19485549-19485571 CACCCCCCTCCCCCCGCGCCGGG + Intergenic
903650791 1:24920982-24921004 TATCCCCCTATCCCTGCCTCTGG + Intronic
904035860 1:27558197-27558219 CACCTCCCTACTCCTGGCCCAGG - Intronic
904043409 1:27597018-27597040 CTCCCCACTACCCAAGCCACTGG + Intronic
904365585 1:30009094-30009116 CGCCCCCCTCCCCCGGCCACTGG - Intergenic
905228062 1:36492868-36492890 CATCCCCATCCTCCTGCCACAGG - Intergenic
905274108 1:36806066-36806088 CACACACCCACCCCTCCCACAGG + Intronic
905280003 1:36842991-36843013 CCACCCCCTCCACCTGCCACAGG + Intronic
905322731 1:37129397-37129419 CACCCCCCACCCCCCGCCACAGG - Intergenic
905333848 1:37229699-37229721 CATCCCCCAACCCCAGCCCCTGG + Intergenic
906205696 1:43985256-43985278 CACCTGCCTTCCCATGCCACAGG + Exonic
906532944 1:46533759-46533781 CAGCCCCCTGCCTCTGCCTCTGG + Intergenic
906578829 1:46917549-46917571 CACCCCCCTGCCACCTCCACTGG - Intergenic
906836259 1:49086110-49086132 CCACCCCCTACCCCAACCACTGG + Intronic
907518762 1:55009663-55009685 CCACCCCCCACCCCTGCCTCTGG + Exonic
907783413 1:57588272-57588294 CACCCCCCTACCACCACCAAAGG + Intronic
908756549 1:67474109-67474131 CACCCCCCTCACCCTCCCAAAGG + Intergenic
908843055 1:68297837-68297859 CAGCCCCCTTCCCCTGCCAGTGG + Intergenic
908978996 1:69931217-69931239 CCCCACCCTACACCTCCCACTGG + Intronic
909656320 1:78037457-78037479 CTCCCCCCTACCCCAGCAAATGG + Intronic
911090491 1:94013416-94013438 CACCCACCTCCACCTGCCTCTGG - Intronic
911951971 1:104184735-104184757 AACCCCACTCCCCCTCCCACAGG - Intergenic
912387648 1:109280256-109280278 GATCCCCCTTCCCCTGCCCCAGG + Intronic
912433557 1:109642887-109642909 CACCCCACTTCCCCAGCCTCTGG - Intergenic
913339687 1:117746739-117746761 CACCCCCCTGCCACTTCCACTGG - Intergenic
914886991 1:151593668-151593690 CACTCCCCCACCCCCGCCATTGG - Intergenic
914944443 1:152051544-152051566 CCCCACCCCTCCCCTGCCACAGG - Intergenic
915310762 1:155004850-155004872 CACACCCCCAGCCCTGGCACAGG + Intronic
915524550 1:156467827-156467849 CACCCCTTCACCCCTGCCAAAGG - Intronic
916124440 1:161556781-161556803 CACCCCCCTACCCCTGTCCGAGG - Intergenic
916134332 1:161638131-161638153 CACCCCCCTACCCCTGTCCGAGG - Intronic
916221358 1:162448036-162448058 CACCCAACTACCCCAGCCCCTGG - Intergenic
917818372 1:178734393-178734415 CACCCCCTTACCCCTGCTACTGG - Intronic
919834926 1:201567056-201567078 CACCCCCCATCCCCAGCCACCGG + Intergenic
920237592 1:204518693-204518715 GCATCCCCTACCCCTGCCACTGG + Intronic
920306261 1:205020106-205020128 CACCCCATTGCCCCTGCCCCTGG + Exonic
920366689 1:205451536-205451558 CTCCCCCCAACTCCTGCCACAGG - Intronic
920377372 1:205516434-205516456 CGTCCCCCAACCCCTGCCCCTGG + Intronic
920555752 1:206903073-206903095 GACCTCCCTCCCCCTGGCACTGG + Exonic
920695674 1:208179870-208179892 CACCCCCCAACCCCTGCCTAAGG + Intronic
920911350 1:210220314-210220336 CACCCCTCTGCCCCTGCACCTGG - Intergenic
921007910 1:211112297-211112319 CACCCCTCCACCCCTCCCCCGGG + Intronic
921292483 1:213671358-213671380 CACCTCCCCACCCCAGCCCCTGG - Intergenic
921863519 1:220064415-220064437 CACCCTCCTCCTCCTTCCACAGG - Intronic
923240705 1:232082701-232082723 CTCCCCCCTACCCCCACCCCAGG - Intergenic
923458796 1:234188800-234188822 CACTCCCCTGCCACCGCCACTGG + Intronic
923525005 1:234765803-234765825 CACCACCCTGCTGCTGCCACTGG + Intergenic
1062795352 10:341084-341106 CACACCCCCACTCCTGCCAGAGG - Intronic
1062988879 10:1796236-1796258 CACACCCCGACCTCTCCCACAGG - Intergenic
1063103591 10:2973331-2973353 CTCCCCCTTGCCCCTGCCTCAGG - Intergenic
1063363966 10:5478748-5478770 CAGCCCCCAACCCATGCCAGAGG - Intergenic
1063414752 10:5864336-5864358 CTCCCCCCCACCCCTGCTATCGG + Intronic
1063960423 10:11301523-11301545 CACCCCGCTCCCGCTGCCCCCGG + Intronic
1064149426 10:12850175-12850197 CACCTTGCTAACCCTGCCACAGG - Intergenic
1066027054 10:31369360-31369382 CACCCTCCTACCCTAGCCTCTGG + Intronic
1067448607 10:46367900-46367922 CAGCCTCGGACCCCTGCCACAGG + Intergenic
1068072303 10:52210364-52210386 CACCCTCCTATTCCTGTCACTGG + Intronic
1069639135 10:69943776-69943798 CAGCCCCCGGCCCCTGCCCCGGG + Intronic
1069642379 10:69964142-69964164 CATCCCCCACCCCCAGCCACTGG - Intronic
1069686857 10:70324209-70324231 CACCCTCCTACCGCTGCCCGGGG + Intronic
1069858898 10:71457940-71457962 CAGCCCCCCACCCCTGCAAAGGG - Intronic
1069932072 10:71889635-71889657 CTGCCCCCAACCCCTACCACAGG + Intergenic
1070792602 10:79198423-79198445 CACCCCCCTCCTCCTTCCCCAGG + Intronic
1070961921 10:80505381-80505403 CTCCCCAGCACCCCTGCCACAGG - Intronic
1071124828 10:82321288-82321310 CCCACCCCCACCCCTGCCACAGG - Intronic
1071291630 10:84193478-84193500 TCCCCCCCTCCCCCTGCCAGGGG - Intergenic
1072677294 10:97477404-97477426 CACCCCCAAGTCCCTGCCACAGG - Exonic
1072879822 10:99215454-99215476 CGCCCCCCTACCCCGCCGACAGG - Intronic
1073520296 10:104122114-104122136 CACGGCCCCGCCCCTGCCACAGG + Intronic
1073966968 10:109001409-109001431 AACCCCCCTCCCCATTCCACAGG + Intergenic
1074827303 10:117223776-117223798 ACCCCACCTACCCCTGCCAGGGG + Intergenic
1075269068 10:121033277-121033299 CATCCCCTAACCCCTGCCTCAGG - Intergenic
1075406583 10:122199525-122199547 CACCCCTGTGCCCCTGCCCCAGG - Intronic
1076199208 10:128545074-128545096 CATCCTCCTCCCCCTGCCCCTGG + Intergenic
1076334219 10:129694202-129694224 CACCCCCCAAACCCTTCAACTGG - Intronic
1076606251 10:131691705-131691727 CCCCCCCCAACCCCTGCTCCCGG + Intergenic
1076658173 10:132037835-132037857 CTTCCCCCTACCCCTGCCCCGGG + Intergenic
1076730104 10:132434172-132434194 CACCCTCCCGTCCCTGCCACTGG - Intergenic
1077168910 11:1157790-1157812 CACCCATCTCCGCCTGCCACCGG + Intergenic
1077224397 11:1433814-1433836 CCACCCCCCACCCCTGGCACTGG + Intronic
1077417920 11:2433450-2433472 GAGCCCCCTACCCCAGCCACTGG - Intergenic
1077601925 11:3580540-3580562 TTCCCCCCTACCCCCACCACAGG + Intergenic
1077656498 11:4024239-4024261 CACCCACCTAACCCTGGCATAGG + Intronic
1077674148 11:4182412-4182434 CACCCCTCTGCCCCAGCCATAGG + Intergenic
1078717584 11:13854623-13854645 AGCTCTCCTACCCCTGCCACTGG + Intergenic
1081578976 11:44339069-44339091 CACCCCCCACCCCCGGCCTCTGG - Intergenic
1082067342 11:47911405-47911427 CTCTCCCCTCCCTCTGCCACAGG + Intergenic
1082811699 11:57482597-57482619 CACCCCCAAACCCCCGCCGCGGG - Intergenic
1083307562 11:61769228-61769250 CACCCCCCGGCCCCTTCCCCTGG + Intronic
1083331740 11:61901649-61901671 CACCCGCAGTCCCCTGCCACAGG - Intronic
1083659889 11:64247017-64247039 CCCTCCCCTACCCCTGCCCGGGG - Intergenic
1083745740 11:64735622-64735644 CACCCCACCACCCCGGCCCCCGG - Exonic
1084126134 11:67100201-67100223 CTCTCCCCTACCCCTGCCTTTGG - Intergenic
1084170541 11:67398899-67398921 CCCTCCCCTTCCCCTGCCGCAGG + Intronic
1084268392 11:68016590-68016612 CACCTGCCTGCCCCTGCCTCAGG + Intronic
1084273052 11:68039165-68039187 CACCCTCTTCCCCCTGCCCCGGG + Intronic
1084419694 11:69054115-69054137 CACCCCCCAGGCCCGGCCACAGG - Intronic
1084657906 11:70529693-70529715 CACTCCCCTCCCCCTCCCACTGG + Intronic
1084952969 11:72676918-72676940 CGCGCCCCTACCCCCGCCGCAGG + Intergenic
1084960247 11:72712700-72712722 CACTCCCCTCCCCCTGCCAGCGG + Intronic
1085122189 11:73974356-73974378 CAACCCCCCACCCCAGCCGCAGG - Intergenic
1085297422 11:75439000-75439022 TACCCCCATCCCCCTGCCTCTGG - Intronic
1085409454 11:76282577-76282599 CACCTCCCTGCACCTGCCCCGGG - Intergenic
1086105977 11:83147827-83147849 CACCCTCCTACCCCCGACCCGGG + Intergenic
1086143381 11:83523822-83523844 CCGCCCCCTGCCCCTGCCATTGG - Intronic
1086337123 11:85811170-85811192 CTCCCCGCTACCCCCGCCCCCGG + Intergenic
1086350132 11:85936131-85936153 CACCCCCCTTCTCCCGCCATTGG + Intergenic
1086611186 11:88757752-88757774 CACCATGCTACCTCTGCCACTGG + Intronic
1086825385 11:91489594-91489616 CACCCCCCTGCCACCTCCACTGG - Intergenic
1087600172 11:100304521-100304543 CACCCACTTAACCCTGCCACAGG - Intronic
1087615977 11:100487009-100487031 CACCCCCCTGCCACCTCCACTGG + Intergenic
1087642455 11:100769824-100769846 CATCCCCCTACACCTCCCCCTGG - Intronic
1088988467 11:114929761-114929783 CACTCCCCGACCCCTGACCCTGG + Intergenic
1089458823 11:118641091-118641113 CCCACCCCTACCCCTTCTACTGG + Intronic
1091387736 12:105318-105340 CCCCACCCTGCCCCTGCCAGCGG - Intronic
1091583238 12:1801160-1801182 CCACCCCCTGCCCCTGCCTCAGG + Intronic
1091745760 12:2991984-2992006 CCCCCCCCAACCCCCACCACAGG - Intronic
1091800492 12:3321694-3321716 CAGCACCCTTCCTCTGCCACTGG + Intergenic
1092154540 12:6273840-6273862 CACCCCACTCCCCATGCCCCAGG - Intergenic
1092159526 12:6308489-6308511 CACCCACCACCACCTGCCACTGG + Intergenic
1092290884 12:7158859-7158881 CAACCCCCCGCCCCTGCCCCAGG - Exonic
1092428071 12:8389883-8389905 TTCCCCCCTACCCCCACCACAGG + Intergenic
1092436281 12:8449235-8449257 CACCCCCCGCCCCCTGCGATGGG + Intergenic
1093707832 12:22295072-22295094 GTCCCCCCTACCTCTGCCCCTGG - Intronic
1095115333 12:38345161-38345183 CACCCCCCTGCCACCTCCACCGG + Intergenic
1095313797 12:40733488-40733510 CCTCCCCCTTCCCCTGCCAGAGG + Intronic
1096170477 12:49464890-49464912 CTGCTCCCTACCCCAGCCACAGG + Intronic
1096502272 12:52071386-52071408 CACCCCCTCACCCCTTCTACAGG - Intronic
1096580370 12:52581085-52581107 CAGCCCCCTGCCCCAGCCTCGGG - Intergenic
1096799643 12:54101608-54101630 CACCCCACCACCCCTGCCCCAGG - Intergenic
1097122944 12:56749955-56749977 CTCCTCCCACCCCCTGCCACTGG - Intronic
1097192706 12:57227053-57227075 CCTCCCCCAACCCCTGCCTCCGG + Intergenic
1097221713 12:57455108-57455130 CACCCCCATACCCCTACTTCAGG + Intronic
1098804914 12:75011241-75011263 TTCTCCCCTAACCCTGCCACAGG - Intergenic
1099955098 12:89345778-89345800 TACCCCCCTGCCCCTGCAAAAGG + Intergenic
1099989364 12:89707858-89707880 CCACCCCACACCCCTGCCACTGG + Intronic
1100565765 12:95791366-95791388 CATCCCCCTACCCCCGCAAAAGG - Intergenic
1101798976 12:108003903-108003925 CATAGCCCTCCCCCTGCCACTGG - Intergenic
1102896652 12:116603621-116603643 CACCCCCCAACCCCTGCCCCGGG - Intergenic
1103704760 12:122865499-122865521 CGCCCCCATACCTCCGCCACCGG - Exonic
1103716617 12:122948939-122948961 CACCCCCCAACCCCGCCCACAGG - Intronic
1103950914 12:124550487-124550509 CACCATCCTCCCCCTGCCAGTGG - Intronic
1104635946 12:130437889-130437911 CAGCCCCCTATCCCTGCCTGGGG - Intronic
1104770188 12:131356679-131356701 CCCCCGTCCACCCCTGCCACTGG - Intergenic
1104775584 12:131388423-131388445 CCCCTTCCTTCCCCTGCCACAGG + Intergenic
1104903009 12:132199186-132199208 CGATCCTCTACCCCTGCCACGGG - Exonic
1104980314 12:132570565-132570587 CACCCCCCAACCCCTGCCCTGGG - Intronic
1105847362 13:24304829-24304851 CACACCCCCACACATGCCACAGG - Exonic
1107267970 13:38579952-38579974 CATCCTCCTACCTCTGCCTCTGG - Intergenic
1108484532 13:50910370-50910392 CACCCTCCCACCCGAGCCACCGG - Intronic
1111615697 13:90659085-90659107 CCACCCCCTAGCCCTGCCCCTGG - Intergenic
1111988488 13:95090366-95090388 CACCCCCCGACCACCTCCACCGG + Intronic
1113049153 13:106189239-106189261 CTCCCCGCCACCCCTGCAACTGG - Intergenic
1113083365 13:106540307-106540329 CCCCCCCCCACCCCCGCCAATGG - Intergenic
1113522636 13:110951490-110951512 CACCCCCCACCCCCTCCCATGGG - Intergenic
1113558557 13:111258110-111258132 CACCACCCTCCCACAGCCACAGG + Intronic
1113858918 13:113468363-113468385 CTCCCCTCTCCCCCAGCCACTGG - Intronic
1113954465 13:114089807-114089829 CACCCTCCTCCCCCAGCCCCCGG + Intronic
1114270497 14:21097886-21097908 CACCCCCCAACCCCCGGCCCAGG - Intronic
1114635594 14:24185072-24185094 CACACCCTTTCCCCTACCACAGG + Intronic
1114926767 14:27411296-27411318 CATTCCCATAGCCCTGCCACTGG - Intergenic
1115299298 14:31865895-31865917 CACCCCCCTGCCACCTCCACTGG + Intergenic
1116785813 14:49287708-49287730 CTCTCCCCTACCCTTTCCACAGG + Intergenic
1117080831 14:52150533-52150555 CCCCCACCCACCCCTGCCACTGG - Intergenic
1117351232 14:54883824-54883846 CTCCACCCCACCCCTGCCCCAGG - Intronic
1117896006 14:60487281-60487303 CTCCTCCCTCCCCCAGCCACTGG + Intronic
1118303233 14:64633529-64633551 CACCATCCTATGCCTGCCACTGG + Intergenic
1118588680 14:67382732-67382754 CACCCCCCGTCCCCAGCCAGGGG + Intronic
1118760964 14:68879909-68879931 CAGCCCCCAACCCCTGCCCCAGG - Intronic
1119681555 14:76596095-76596117 CGCCCCCCACCCCCCGCCACTGG + Intergenic
1120704727 14:87734822-87734844 CCCCCCCATCCCCCTGCCATGGG - Intergenic
1120751808 14:88204585-88204607 CTCCCCCCTACCCCCGCTGCAGG + Intronic
1122283434 14:100637660-100637682 CAGCCCCTGAGCCCTGCCACTGG - Intergenic
1122347099 14:101067448-101067470 CACCCCTCTTCCCCAGCCCCTGG + Intergenic
1122374300 14:101248116-101248138 CACCCCCCGACCCCCGCACCAGG - Intergenic
1122694631 14:103546696-103546718 AACCCCCCTAACTCTGCCACAGG - Intergenic
1122736206 14:103843976-103843998 CACCCCTCTGCCCCTGCACCTGG - Intronic
1122824376 14:104362490-104362512 CACCCCCACACCCCCTCCACAGG - Intergenic
1122940512 14:104978983-104979005 CACCCCACTGGCCCTGCCCCAGG + Intergenic
1123056272 14:105572146-105572168 GACCCGCCTCCCCCTGGCACTGG + Intergenic
1123057661 14:105579661-105579683 GACCCGCCTCCCCCTGGCACTGG - Intergenic
1123080701 14:105692274-105692296 GACCCGCCTCCCCCTGGCACTGG + Intergenic
1123081940 14:105699594-105699616 GACCCGCCTCCCCCTGGCACTGG - Intergenic
1202860899 14_GL000225v1_random:80296-80318 CTCCACCACACCCCTGCCACAGG - Intergenic
1123419202 15:20117738-20117760 CAGTCCCCCACCCCTGCAACAGG - Intergenic
1123446661 15:20335761-20335783 CAGTCCCCCACCCCTGCAACAGG + Intergenic
1123528424 15:21124281-21124303 CAGTCCCCCACCCCTGCAACAGG - Intergenic
1124558803 15:30752157-30752179 CCCTCCCCTACCCCAACCACTGG + Intronic
1124667953 15:31609820-31609842 CACCCCCCTGCCACCTCCACTGG + Intronic
1124672455 15:31653588-31653610 CCCTCCCCTACCCCAACCACTGG - Intronic
1125473771 15:40030124-40030146 CACCCCCCAACCCCTGCCTGAGG + Intronic
1125529063 15:40399640-40399662 CACCCCCCAACCCCAGCCAGCGG + Intergenic
1125600962 15:40915630-40915652 CAACCCCCGCCCCCTGCCCCTGG + Intergenic
1125611384 15:40973484-40973506 CACCCTCCTTCTCCTGCCGCTGG + Intergenic
1126182088 15:45795243-45795265 CACGCCCCTACCCATACCATTGG - Intergenic
1126271359 15:46821379-46821401 CATCCCCCTACCCCAGCCTCTGG - Intergenic
1126702711 15:51382239-51382261 CACTCCCATACCCCTGACAAGGG - Intronic
1126907063 15:53379314-53379336 CACCCCCCAACCCCCGCCATTGG + Intergenic
1127503843 15:59579430-59579452 TAGCCCCCCACCCCTCCCACAGG + Intergenic
1128352193 15:66898643-66898665 CCCCGCCCCACACCTGCCACTGG + Intergenic
1128993374 15:72278906-72278928 CACCCAGCTCTCCCTGCCACAGG + Intronic
1129097556 15:73225195-73225217 CACCCCCCTGCCACCTCCACTGG - Intronic
1129160965 15:73747554-73747576 TCCTCCCCTACCCCTGCCCCAGG - Intronic
1129394712 15:75237544-75237566 CAGCCCCCTCCTCCTGCCCCAGG - Intergenic
1129834859 15:78695976-78695998 AGCCCCCAGACCCCTGCCACAGG + Intronic
1130563846 15:84979008-84979030 CTCCCTCCTACCCCTGTGACTGG - Intergenic
1130875648 15:88011790-88011812 CCCCTCCCTTCGCCTGCCACTGG + Intronic
1130903907 15:88226682-88226704 CAAACCCCCACCCCTGCCCCTGG + Intronic
1131261852 15:90891707-90891729 CACTCCCCAAGCCCTGCCACAGG - Intronic
1132016360 15:98320818-98320840 CACCTCCCCACGCCTGGCACGGG - Intergenic
1132516962 16:370391-370413 CTACCCCCTACCCCGGCCCCCGG + Intronic
1132692403 16:1187470-1187492 CACACCCCTGCCCCTGGCTCAGG + Intronic
1132721325 16:1317604-1317626 CCCCCCACTAGACCTGCCACGGG + Intronic
1132928941 16:2448793-2448815 CTCCGCCCCACCCCTGCCCCAGG + Intronic
1133448583 16:5884463-5884485 CACCCCCCTACCCCCGCCCCCGG + Intergenic
1134441269 16:14301163-14301185 CACCCCCACACCCCTGCCCAGGG - Intergenic
1135230073 16:20698243-20698265 CACACCCCTAGCCATGCCACCGG - Intronic
1136520874 16:30795011-30795033 CACCCCCCACCCCAGGCCACTGG + Intergenic
1136655369 16:31706199-31706221 CACTCCCCTTCCCCTGACGCAGG - Intergenic
1137292796 16:47063402-47063424 CACCCAGATACCCCTGCAACGGG + Intergenic
1137432172 16:48427235-48427257 CATCTCCCTGCCCCTGCCCCTGG - Intronic
1137673173 16:50291222-50291244 CCCCACCCTGCCCCAGCCACAGG - Intronic
1138130530 16:54475712-54475734 CACACCCTTCCCCCTCCCACCGG + Intergenic
1138235593 16:55379849-55379871 CCCACCCCTATCCCTGCCTCAGG + Intergenic
1138425856 16:56931804-56931826 CACTCCCCACCCCCTGCCTCGGG + Intergenic
1138445835 16:57062908-57062930 TTCCCCCCTACCCCAGCCCCTGG + Intronic
1138625568 16:58248918-58248940 CAGCCCCCTTCCCCTGCAAGGGG - Intronic
1139171452 16:64634909-64634931 CACACCCCTAGCCCTGACAACGG - Intergenic
1139468482 16:67166298-67166320 CACCCTCCCACCCCTTCCTCAGG + Exonic
1139577565 16:67851650-67851672 CTCCCCGCTACCCCCGCCCCAGG + Intronic
1139777978 16:69329235-69329257 AACCTCCCTACCCCTGCCCCCGG + Intronic
1139786002 16:69392599-69392621 CACCCCCCAACCCCAGTAACTGG + Intronic
1140409045 16:74730299-74730321 CCAACCCCCACCCCTGCCACAGG - Intronic
1140410994 16:74740215-74740237 CACCACCCTGCCCCACCCACGGG - Intronic
1140473351 16:75226858-75226880 CACCCCCATCCCCCGGCCACAGG + Intergenic
1141386175 16:83624335-83624357 AACGCCCCCACCCCTGCCCCAGG + Intronic
1141683735 16:85558406-85558428 CACCCCTCTTCACCTGCCACTGG + Intergenic
1141686821 16:85574973-85574995 CAGCCCCCTTGCCCTGCCAGCGG + Intergenic
1141945564 16:87307044-87307066 CATTCCCCGACCCCTGCCTCTGG + Intronic
1203137894 16_KI270728v1_random:1740974-1740996 CAGTCCCCCACCCCTGCAACAGG + Intergenic
1142715623 17:1745448-1745470 CACCCCCCGACCCCTGCCGATGG - Intronic
1142719447 17:1766676-1766698 CCCGCCCCTCCCCCTGCCTCAGG - Intronic
1142808907 17:2386178-2386200 CTCACCCCAATCCCTGCCACTGG - Exonic
1143015442 17:3889042-3889064 CACCCCCCTACCCTGGGCATAGG - Intronic
1143167282 17:4903128-4903150 CACCCTCCTCCCCCTCACACAGG - Intergenic
1144077100 17:11729294-11729316 CACCCCCCTTCTCCTGCTAGGGG + Intronic
1144137755 17:12314617-12314639 CACCCTCCTGCTGCTGCCACTGG - Intergenic
1144388936 17:14775996-14776018 CTGCCCCCTACCCCAGCCCCCGG + Intergenic
1144783666 17:17820186-17820208 CACCCCACAGCCCCTGCCAGGGG - Exonic
1144949590 17:18986774-18986796 CAGCACCGTACCCCTGCCCCAGG - Intronic
1145848703 17:28069073-28069095 CATCCCCCTCCCCCTGCCCTAGG + Intronic
1145865840 17:28241006-28241028 CCGCCCCCGACCTCTGCCACTGG - Intergenic
1145940676 17:28741877-28741899 CACCCACCTCCCACTCCCACTGG - Intronic
1146078726 17:29757769-29757791 CCACCCCCCACCCCTGCCACTGG - Intronic
1147969627 17:44212490-44212512 TTCCCCCCTCCCCCTGCCCCTGG - Intronic
1148150794 17:45395633-45395655 AACCCACCCACCCCTGCCACAGG - Exonic
1149637233 17:58180766-58180788 CACCCCTCCACGCCTGCCACAGG - Intergenic
1149685301 17:58531551-58531573 CACCCACCTACCCTGGGCACAGG - Intronic
1151064491 17:71134715-71134737 CATTGCCCTACCCATGCCACAGG + Intergenic
1152249300 17:79203303-79203325 CACCCTCAAACCACTGCCACAGG - Intronic
1152345913 17:79751594-79751616 CACCCTCCTCCCCCAGCCCCTGG - Intergenic
1152637624 17:81436581-81436603 CACTCCCCTACCCCCGCCCCAGG + Intronic
1152720184 17:81919769-81919791 CACCCCTCTTCCCCTTCCCCTGG - Exonic
1152720848 17:81923261-81923283 CACCCCCCCCCCCCCGCCCCCGG + Intronic
1152926592 17:83090339-83090361 CACCCCCCACCCCCCGCCCCAGG + Intronic
1155035013 18:22018761-22018783 CACCCCACCACCACTGCCAGTGG - Intergenic
1155060483 18:22223868-22223890 CATCTCCCTGCCCCTCCCACGGG - Intergenic
1155499590 18:26473402-26473424 CCTCCCCCTATCCCTGCTACAGG - Intronic
1155531434 18:26770874-26770896 CTCCCCCGAACCCCTGCCCCTGG - Intergenic
1160395088 18:78564827-78564849 CCACCCCCCACCCCCGCCACTGG + Intergenic
1160544032 18:79641078-79641100 CACTCCCCTGCCCCGGCCCCCGG + Intergenic
1160865278 19:1253424-1253446 CCCCCCCCCATCCCGGCCACTGG + Intronic
1161144378 19:2668813-2668835 CAGCCCCCTACCACAGCCATTGG - Intronic
1161260889 19:3337163-3337185 CAGCCCCACACCCCTGCCACCGG - Intergenic
1161282983 19:3455848-3455870 CACCCCCCTTTCCCTGCACCGGG + Intronic
1161374219 19:3930986-3931008 CACCCACCTCCCCCAGCCCCTGG + Intergenic
1161750670 19:6093925-6093947 CACCTCCCTTCCCCAGCCCCTGG - Intronic
1161942613 19:7415198-7415220 CACCTCCCTAACCCTGCTCCTGG + Intronic
1162818860 19:13210994-13211016 CACACCCCAACCCCTGGCTCCGG + Intronic
1163025610 19:14509773-14509795 CACCCCCCTACCCCAGAAGCTGG + Intergenic
1163280555 19:16314139-16314161 CACTCCCCTCCCCCAGCCCCTGG - Intergenic
1163521637 19:17795243-17795265 CACCCCCAAACCCCCACCACTGG - Intronic
1163586479 19:18167108-18167130 CGCCACCCCACCCCTCCCACAGG + Exonic
1163633410 19:18428035-18428057 CACCCCACCTCCCCAGCCACAGG - Intronic
1163745341 19:19043394-19043416 CAGCCCCCTGCCTCTGCCCCAGG - Intronic
1163783387 19:19261857-19261879 CACCCCCCTATCCCCGGCCCGGG - Intronic
1163866348 19:19776540-19776562 CACCGCCCTGCCCCTTCCTCTGG + Intergenic
1165070801 19:33253849-33253871 CAGCCCCCTACCCACCCCACAGG - Intergenic
1165077649 19:33289720-33289742 CACCCACCCACTCATGCCACTGG - Intergenic
1165165236 19:33849424-33849446 CACCCCCCTACCCCCAGCAGAGG + Intergenic
1165443926 19:35846252-35846274 AACCCCCCTACCCTGCCCACTGG + Intronic
1165712778 19:38024006-38024028 CACCCCCCTCCCCCTCCCCAAGG - Intronic
1165741879 19:38209730-38209752 CACTGCCCTCCCCCCGCCACCGG + Intergenic
1166288210 19:41845284-41845306 CTCCCCCCTTCCCGTGCCCCAGG - Intronic
1166704837 19:44903079-44903101 CCCACCCCTGCCCCTGACACTGG + Exonic
1166841231 19:45698525-45698547 CACCCCCCTGCTGCTCCCACAGG + Exonic
1167291131 19:48625829-48625851 CCCCTCCCTGCCCCTGCCATGGG + Intronic
1167367287 19:49061525-49061547 CAGCCCCCTCCACCTGCCCCCGG + Exonic
1167550167 19:50154811-50154833 CCCACCCCCACCCCTGCCCCAGG - Intronic
1167791913 19:51688541-51688563 CACCCCCCACCCCCACCCACTGG - Intergenic
1168089325 19:54071741-54071763 CACCCCCCAACCCCAGGCCCAGG - Intronic
1168419809 19:56194159-56194181 CAACCCCCTCCCCCAGCCCCTGG + Intronic
1168526143 19:57090208-57090230 CACCCACCTACCCCAGCCAGGGG - Intergenic
925043845 2:755778-755800 CAGCACCCTTCCCCTGCCAAGGG + Intergenic
925751638 2:7094992-7095014 CAACCCCCTACTCAGGCCACTGG - Intergenic
925948907 2:8893050-8893072 CCACCCCCTCCCCCTGCCTCTGG - Intronic
926144509 2:10388509-10388531 CCCCACCCCACCCCTGTCACTGG + Intronic
927338294 2:21950994-21951016 CACCCCCCCTCCCCTTCCTCTGG + Intergenic
927515683 2:23670397-23670419 CACCCCCCTGCCCATCACACCGG - Intronic
927712815 2:25336286-25336308 CACCCCCATTTCCCTGGCACTGG + Intronic
927927796 2:27025448-27025470 CACCCCCCTGCCCCCACCCCAGG - Intronic
928024508 2:27728708-27728730 CATCCCCCTACTCCTTCCAATGG + Intergenic
929075307 2:38075449-38075471 CACGCCCCTACCCCAGCCTCTGG + Intronic
929469997 2:42182301-42182323 CTCCCCCCTCCCCCCTCCACTGG + Intronic
930320482 2:49848409-49848431 CCTCCCCCTACCCCTCCAACAGG + Intergenic
932128723 2:69168588-69168610 CCCTTCCCTACCCCTGCCCCAGG + Intronic
933649018 2:84833992-84834014 CGCCCCATTACCCCTGCCACGGG + Intronic
933695324 2:85213139-85213161 CCTCCCCCCACCCCAGCCACAGG - Intronic
934602606 2:95669443-95669465 CTCCCCACCACCCCTGCCCCTGG + Intergenic
934793721 2:97083664-97083686 CACCTGCCCACACCTGCCACTGG + Exonic
935234160 2:101124129-101124151 CACTTCCCTCCCACTGCCACTGG + Intronic
936369711 2:111893621-111893643 ACCCCTCCAACCCCTGCCACAGG + Intergenic
936416746 2:112322338-112322360 CCGCCCCCCACCCCTGCCCCTGG + Intronic
936462628 2:112723903-112723925 GACCCTCCTACCCCCACCACTGG + Intronic
936535981 2:113311634-113311656 CTCCCCACCACCCCTGCCCCTGG + Intergenic
936554960 2:113488114-113488136 CACCCTCCTACCGCCTCCACTGG + Intronic
936885746 2:117308777-117308799 CACCTCCCTGCCTCTGCCCCAGG + Intergenic
938487164 2:131723274-131723296 CCCGCCCCTGCCCCTGACACTGG - Intronic
938970913 2:136431669-136431691 CACCCCCCTACCCCCACTCCAGG - Intergenic
940337340 2:152543266-152543288 CTCCCCCCAACCCCTGCCCCTGG + Intronic
940640740 2:156342354-156342376 CGCCCCCCTCCCCCGGCCCCCGG + Intergenic
940985697 2:160049952-160049974 CCTTCCCCTGCCCCTGCCACAGG - Intronic
941630400 2:167877959-167877981 CAGCCCCCTCCCCCAGCCTCTGG + Intergenic
941647416 2:168056334-168056356 CACGCCCCTCCCCCTCCCCCCGG - Intronic
942240983 2:173964269-173964291 CACTCCCCTCCCCCCGCCCCGGG - Intronic
942251210 2:174049033-174049055 CACCCCCCTGCCCCAGCCACAGG - Intergenic
943237346 2:185338909-185338931 AACACCCCTGCCCCAGCCACTGG - Intergenic
943240450 2:185377250-185377272 CACCTCCCTCCCCCAGCCAAGGG - Intergenic
945761743 2:213923181-213923203 TCCCCACCAACCCCTGCCACTGG - Intronic
946092899 2:217246542-217246564 CACCCACCCACCACTGGCACAGG + Intergenic
947935083 2:233997666-233997688 CTCCCCCCTACCCCAGCCTCTGG + Intronic
948252859 2:236544494-236544516 CAGCCCCCCAGCCCTGGCACTGG - Intergenic
948430695 2:237916658-237916680 CACACACACACCCCTGCCACTGG - Intergenic
948443983 2:238017882-238017904 TGCCCCCCAACCCCAGCCACTGG + Intronic
948465614 2:238150349-238150371 CACCCCACAACCCCTCCCAGGGG + Intronic
948872837 2:240812246-240812268 CACCCCCAGCCCCCTTCCACAGG - Intronic
948887701 2:240892354-240892376 CTGCCCCCTGCCCCTGCCCCTGG + Intronic
948918900 2:241052352-241052374 CAGCCCCCTCCCCCTGCTTCCGG + Exonic
949034429 2:241810096-241810118 CACCCACCTGCCCCTGCCCCAGG + Intronic
1168830196 20:841515-841537 GACCCCCCATCCCCCGCCACCGG + Intronic
1169117440 20:3074904-3074926 CATCCCCCTGCCCATGTCACTGG + Intergenic
1170576743 20:17668806-17668828 CGCACCCCTACCCCTGTCCCAGG + Intronic
1171262397 20:23746234-23746256 CAGCCCCCACCCCCTGACACCGG + Intergenic
1171426685 20:25052849-25052871 CAAACCCCTGCCCCAGCCACGGG - Intronic
1171480437 20:25451708-25451730 CTCCCCCCTCCCCCTACCCCAGG + Intronic
1171796791 20:29572740-29572762 CACCCCACCACCCCTGCCCCAGG + Intergenic
1171851456 20:30311426-30311448 CGCCCCACCACCCCTGCCCCAGG - Intergenic
1172152199 20:32798383-32798405 CACCCCCTTACCACTTCCACAGG - Intronic
1172245692 20:33443729-33443751 CGCCACCCTACCCCGGCCGCTGG + Exonic
1172305065 20:33874964-33874986 CACCCACCTAGCCCTCCCAAAGG + Intergenic
1172799059 20:37563887-37563909 CACCCCCATGCCCCAGCCATTGG - Intergenic
1172944697 20:38678067-38678089 CACACCCCTACCCCTGCCAGTGG - Intergenic
1173123172 20:40312549-40312571 GACCCCTCTTCCCCTGCCTCAGG + Intergenic
1173464710 20:43271711-43271733 CACCCCACATCCCATGCCACGGG - Intergenic
1174317218 20:49712907-49712929 CACCCCCCTTCCCCTTACAGAGG - Intronic
1175260737 20:57672647-57672669 CACCTCCCTGCCTCTGCCCCAGG - Intronic
1175262111 20:57681263-57681285 CACCCCTCCATCACTGCCACTGG + Intronic
1175442678 20:59002408-59002430 CACACCCCTGCACCTGCCTCAGG + Intronic
1175826371 20:61938598-61938620 CCCCACCCTGCACCTGCCACTGG + Exonic
1175919670 20:62444790-62444812 CACCCTCCTTCTCCTGCCCCAGG - Intergenic
1176042327 20:63072237-63072259 CGCCCACCGACCCCTCCCACGGG + Intergenic
1176147888 20:63573571-63573593 CACCCCTCTGCCCCAGCCAGGGG + Intronic
1176304242 21:5114971-5114993 CACACCCCCACCACTGCCAGGGG + Intergenic
1177879012 21:26669770-26669792 AACCCCCTTACCCCAGCCAAGGG - Intergenic
1178103239 21:29292388-29292410 CACCCCCCACCCCCTGCAGCAGG - Intronic
1178475367 21:32933041-32933063 CCCACCCCTACCCCCGCGACTGG - Intergenic
1178705363 21:34868479-34868501 CACTCCCCAACCACCGCCACTGG + Intronic
1179041830 21:37809931-37809953 CAACCCACCACCCCTGTCACTGG + Intronic
1179125629 21:38588330-38588352 CACCCTCCAAGCCCTGCCCCTGG + Intronic
1179505530 21:41837523-41837545 CAGCCCCCTCCCCCAGCCCCTGG - Intronic
1179585230 21:42370317-42370339 CACCCCCCTGCCCCAGCCTGGGG + Intergenic
1179600785 21:42476139-42476161 CCCCACCCTCCCCCTCCCACTGG + Intronic
1179852814 21:44147059-44147081 CACACCCCCACCACTGCCAGGGG - Intergenic
1179886024 21:44314578-44314600 CACCCCCCCATCCCTCCCAGAGG - Intronic
1180001299 21:44996693-44996715 CAGCCCCTTCCTCCTGCCACAGG - Intergenic
1180099305 21:45577030-45577052 CACCATCCCACCCCTGACACAGG + Intergenic
1180190647 21:46161002-46161024 CTCCCCCCTTCCCCTCCCCCGGG - Intergenic
1180250749 21:46585814-46585836 CACCCCCCTGCCACCTCCACTGG + Intergenic
1180552714 22:16553531-16553553 CAGTCCCCCACCCCTGCAACAGG + Intergenic
1180726145 22:17948118-17948140 CTCCCTCCCATCCCTGCCACTGG + Intronic
1180875941 22:19175317-19175339 CACCCTTTTACCCATGCCACGGG + Intergenic
1181120945 22:20668499-20668521 GCCTCCCCTACCCCTGCCCCAGG - Intergenic
1181472709 22:23150811-23150833 CCCCCCACTACCCTTGCCCCTGG + Intronic
1181494619 22:23281008-23281030 CACACACCTACCCAGGCCACAGG + Intronic
1181621652 22:24095425-24095447 CACCCCCCCACCACACCCACGGG + Intronic
1181776787 22:25165866-25165888 CACCCCCCAGTCCCTCCCACTGG - Intronic
1182246773 22:28964436-28964458 CACCCCTCTGCCCCTGGCCCAGG - Intronic
1182260572 22:29071147-29071169 CCCCCCCCACCTCCTGCCACCGG - Intergenic
1182685780 22:32121045-32121067 CGTCCCTCCACCCCTGCCACTGG + Intergenic
1182696886 22:32204113-32204135 CGCACCCCCACCCCCGCCACTGG + Intergenic
1183306600 22:37086243-37086265 CACCACCCCTCCCCTGCCCCAGG + Intronic
1183394923 22:37566291-37566313 CACCTCCCTCCCCCGGCCCCTGG + Exonic
1184366426 22:44054553-44054575 CAGCCCCCAACCCCTGCCCCTGG - Intronic
1184412916 22:44336298-44336320 CTCCGCCCTTCACCTGCCACTGG + Intergenic
1184770333 22:46593464-46593486 CGCCCCCCAACCCCTGCCGCAGG + Intronic
1184851651 22:47124667-47124689 CACTCCCCAAGCCCTGCCTCTGG - Intronic
1184854054 22:47136834-47136856 CACCACCCTACCGATGCAACAGG - Intronic
1185267554 22:49912204-49912226 CCCCCCCCAGCCCCTGCCACAGG - Intronic
1185287982 22:50010891-50010913 CACCCCCCGACGCCGGCCGCTGG - Intronic
949192288 3:1264867-1264889 CACCCCTCTCCCCCAGCCTCTGG + Intronic
949798634 3:7878579-7878601 AGGCCACCTACCCCTGCCACTGG + Intergenic
950043953 3:9937993-9938015 CTCCACCCTGCCCCTGCCTCAGG + Exonic
950176664 3:10879559-10879581 CACCCGCCTGCCCCAGCCAATGG + Intronic
950702093 3:14757708-14757730 TGCCCCACTACCCCTGCCCCTGG - Intronic
952927747 3:38334159-38334181 GACCCCTCGACCCCTGCAACTGG + Intergenic
953063831 3:39450957-39450979 CCTCCTCCTACCCCTGCCCCTGG + Intergenic
953167958 3:40482143-40482165 CATCCAGCTACCCCTGGCACTGG - Intronic
953614381 3:44477447-44477469 CACCGCCAGACCCCCGCCACGGG + Intronic
954412464 3:50376799-50376821 CACACCTCTCCCCCTTCCACAGG + Intronic
954623288 3:52007789-52007811 CACCCACGGACACCTGCCACAGG + Intergenic
954625412 3:52019635-52019657 CACCCCTCTGCCCCTCACACAGG - Intergenic
955060300 3:55487471-55487493 CGCCCCCCTTCCCCCGCCCCGGG - Exonic
956728878 3:72178369-72178391 CCCCACCCTACCCCTTCCCCAGG - Intergenic
957507164 3:81136824-81136846 CACCCCCTCACCCCCACCACAGG + Intergenic
958160417 3:89811591-89811613 ATCCGACCTACCCCTGCCACTGG + Intergenic
958481991 3:94654466-94654488 CACTCCCGAACCCATGCCACTGG - Intergenic
959017195 3:101148259-101148281 CACACCCCTGCCACTGCAACTGG - Intergenic
959360837 3:105389734-105389756 CTCCCCCCTACCCCCTCAACAGG + Intronic
959676618 3:109042911-109042933 CAACCCCCTCCCCCAGCCTCTGG - Intronic
960868969 3:122230527-122230549 CATCCCCCACCCCCTGCAACAGG + Intronic
961444756 3:126974186-126974208 CACCCCCCTACCCCAGCTCCTGG + Intergenic
962189967 3:133300166-133300188 CACCCCCCCATACCAGCCACAGG - Intronic
962284364 3:134074158-134074180 CACTCCCCTACCCTGGCCAAGGG + Intronic
962473196 3:135731825-135731847 ACCCCACCCACCCCTGCCACTGG - Intergenic
962973309 3:140424871-140424893 CACCCACCCTCCCCTACCACAGG - Intronic
963248288 3:143082908-143082930 CACCCCCCTTCCCCCACCTCAGG + Intergenic
963285442 3:143430539-143430561 CACTGCCCTGCCCCTTCCACAGG - Intronic
964316953 3:155455235-155455257 CACAACCCTCACCCTGCCACTGG + Intronic
964636028 3:158859306-158859328 CACCCTCCTAACCCCGCCATGGG - Intergenic
964831145 3:160885733-160885755 CACTCACCTACCCACGCCACGGG + Intronic
967324325 3:188224191-188224213 CACCTCCTTACCCAGGCCACCGG + Intronic
967709498 3:192688354-192688376 CACCCCCCAACCTCTGCCACAGG + Intronic
968030100 3:195476254-195476276 CAACCCCAAACCCCAGCCACTGG + Intergenic
968479204 4:826286-826308 CACCCCCCGCCCCCCGCCCCCGG - Intergenic
968984595 4:3868321-3868343 CACTCCCCAACCCCCGCCCCAGG + Intergenic
969239148 4:5888055-5888077 CAGCCCCCTCCCCCAGCCTCTGG - Intronic
969395079 4:6915338-6915360 CAACCCCCTACCCCGGTCGCAGG - Intronic
969466894 4:7362648-7362670 CACTGCCCTCACCCTGCCACAGG - Intronic
969482995 4:7456764-7456786 CACCCCCCTACCCCTGCCACAGG - Intronic
969513504 4:7633147-7633169 GACACCCCCACTCCTGCCACTGG - Intronic
969564496 4:7970163-7970185 CCCCAGCCTACCCCTGCCAGGGG - Intronic
970392634 4:15631065-15631087 CAGTCCCCTACCCCCACCACAGG + Intronic
970420053 4:15897666-15897688 CATCACCCTCCCCCTGCCTCAGG + Intergenic
970679302 4:18489082-18489104 CACCTCCCTCCCCCAGCCAAGGG + Intergenic
970791478 4:19862945-19862967 CTCCCCCCTCCCCCTGCCCCAGG + Intergenic
972189027 4:36568333-36568355 CACCCCCCTGCCACCTCCACCGG - Intergenic
972238941 4:37167830-37167852 CATCCCCCTGCCCCTCCAACAGG - Intergenic
972378893 4:38500536-38500558 CACCCTCCTATCCCTCCCAGAGG + Intergenic
973800196 4:54470270-54470292 CACCCTCCCACCACTTCCACAGG - Intergenic
973878142 4:55241729-55241751 CGCCCTCCTGCCCCTGCCATGGG + Intergenic
974410914 4:61539809-61539831 CCCCCACCTACCCTTCCCACAGG + Intronic
975139105 4:70902351-70902373 CCGCCCCCTCCCCCTGCCATTGG + Intronic
976207076 4:82633145-82633167 AACCCCCCTGCCCCAGCCTCTGG + Intronic
976401834 4:84615579-84615601 CCACCCCCTCCCCCTGCCACAGG + Intronic
977220015 4:94327439-94327461 CCACCCACTACCACTGCCACTGG - Intronic
978197737 4:105990592-105990614 CACCACCCTCCCCCTTCCAGGGG - Intronic
978378298 4:108098316-108098338 CACCCCCACAACCCCGCCACAGG - Intronic
979342354 4:119541053-119541075 CACTTCCCTTCCCCTCCCACTGG - Intronic
981938226 4:150256185-150256207 CACCCTCCTCCCGCTGCCCCGGG + Exonic
982134402 4:152259498-152259520 CATGCCCCTCCCCCTGCCACAGG + Intergenic
984344005 4:178497093-178497115 CACCTCCCTTCCCCAGCCTCTGG - Intergenic
984830169 4:183965722-183965744 CCCCCCACAACCCCCGCCACTGG - Intronic
984852566 4:184167046-184167068 TACCTCCCAACCCCTGCCCCAGG - Intronic
984958189 4:185066798-185066820 CAATCTCCTACCCCAGCCACAGG - Intergenic
984992714 4:185396646-185396668 CCGCCCCCTCCCCCTGCCCCCGG + Exonic
986232495 5:5879366-5879388 CATTCCCATACCCCTGCCAGAGG + Intergenic
987048536 5:14129779-14129801 TACCTCCCGACCCCTGCCCCAGG + Intergenic
987782202 5:22453568-22453590 TACCTCTCTACCCCTGCCTCTGG - Intronic
988214261 5:28250864-28250886 CACTCCCCAACCCCAGTCACAGG + Intergenic
988897299 5:35691587-35691609 CATTCCCCTACCCCTGACTCTGG - Intronic
989214580 5:38891635-38891657 AACCCACCTGCCCCTGCCCCAGG + Intronic
989738735 5:44742244-44742266 CCCTCCCTTACCCCTGCCATGGG + Intergenic
989798358 5:45503784-45503806 CACCCCCTTAACCCTGCCCCAGG + Intronic
990042404 5:51390071-51390093 TACCCCCCTACCCATGCCCCGGG + Intronic
990962495 5:61409260-61409282 CACCTCCCTAGCCCCTCCACTGG - Intronic
991189861 5:63857598-63857620 CTCCCCTCAACCCCTGCAACAGG + Intergenic
992762327 5:79961858-79961880 CAACCTCCTGCCACTGCCACTGG - Intergenic
993332179 5:86614716-86614738 CTACCCCCAACCCCTGCCCCTGG + Intergenic
993633644 5:90317942-90317964 CACCCCCCTTCCCCAGTGACAGG - Intergenic
995039017 5:107567555-107567577 CATCCACCCACCCCTGCCCCAGG + Intronic
995758938 5:115544256-115544278 CACCCCCCACCCCCCGCCAAGGG + Intronic
996370227 5:122745617-122745639 AACTCCCCAACCCCTGCCAATGG + Intergenic
996764767 5:127024756-127024778 CACTCCCCCACCCCTGCCAAAGG - Intronic
997438526 5:133892375-133892397 CATCCACCCACCCCTGCCCCTGG + Intergenic
997882077 5:137600297-137600319 CACCTCCTTCCCCCTGCCCCAGG - Intergenic
999257314 5:150216777-150216799 CACCCCCCAGCACCTGCCAGGGG + Intronic
999323337 5:150627862-150627884 CACCCTCCAGTCCCTGCCACTGG - Intronic
999411053 5:151350132-151350154 CACCACCCTCCCCCGGCCCCGGG + Intergenic
999776051 5:154814007-154814029 CAACCCCCTACACCACCCACCGG + Exonic
1000281033 5:159782205-159782227 CACCCCCTGTCCCCTGCCACAGG - Intergenic
1000330249 5:160199930-160199952 CTCCCACCTACCCCAGCCAGGGG + Intronic
1000717799 5:164668316-164668338 CACCCCCCCACCCCAGCCTTGGG + Intergenic
1001084698 5:168692116-168692138 CTGCCCCCTTCCCCTGCAACAGG + Intronic
1001134807 5:169093455-169093477 CACCCCCAAGCCCCTGCCCCAGG - Intronic
1001980802 5:176035912-176035934 CCCCTCCCTACCCCTGCGGCAGG + Intergenic
1002211973 5:177604616-177604638 CGCCCTCCTGCCCCTGCCCCAGG - Intronic
1002318747 5:178362552-178362574 CTCCCACCCACCCTTGCCACCGG + Intronic
1003202329 6:3973327-3973349 CACCCGCCTCCACCTCCCACAGG - Intergenic
1003581999 6:7348174-7348196 CACCCCCCTGCCACGTCCACGGG + Intronic
1003902058 6:10663533-10663555 CACTCCCCAACCCCTCCAACAGG + Intergenic
1004440028 6:15641440-15641462 CTCCCACCTACCCTTTCCACAGG - Intronic
1004793987 6:19060721-19060743 TACTCCCCAACCCCTGTCACTGG + Intergenic
1006521655 6:34574432-34574454 CAACCCCCTGTCCCTGCCTCGGG - Intergenic
1006534596 6:34688114-34688136 CACCCCCCAACCCCCACCCCTGG - Intronic
1006648862 6:35534779-35534801 CTCCCTCCCTCCCCTGCCACTGG + Intergenic
1006838915 6:37015720-37015742 ATCCTCCCTGCCCCTGCCACGGG + Intronic
1006898823 6:37486988-37487010 CACCCCCCTGCCACAGCCAAGGG - Intronic
1006922765 6:37637330-37637352 CACCCCCCCAACCTTGCCCCCGG - Exonic
1006983599 6:38163818-38163840 CCTCCCCCAACCCCTGCCCCAGG + Intergenic
1007087379 6:39158457-39158479 CTCCTCCCTACCCCTGTCATGGG - Intergenic
1007958096 6:45935281-45935303 CACCCCTCCCCGCCTGCCACTGG - Intronic
1008528567 6:52433568-52433590 CACCCCCCTGCCACCTCCACTGG - Intronic
1010058991 6:71600181-71600203 CACCCCCATACTCCTGCGATTGG - Intergenic
1011319935 6:86080218-86080240 CACCCCCCTGCCACTTCCACTGG - Intergenic
1012869893 6:104659960-104659982 CACTCCCCTACCACCCCCACTGG + Intergenic
1014132150 6:117846695-117846717 TCCCCACCCACCCCTGCCACTGG + Intergenic
1014489520 6:122044917-122044939 CATCTCCCAACCTCTGCCACAGG - Intergenic
1015744187 6:136492093-136492115 CTCCCCCCACCCCCTGCCCCTGG - Intronic
1016887939 6:148976264-148976286 CAACCCCCCACCCCCGCCAGAGG - Intronic
1017027834 6:150197268-150197290 CACTTCCCTGCACCTGCCACAGG + Intronic
1017991400 6:159492545-159492567 CTCCCCCCATCACCTGCCACTGG + Intergenic
1018113447 6:160559185-160559207 TACCCCCTTACCACTGCCAGAGG + Intronic
1018309733 6:162495434-162495456 CACCTCCCTCCCCCAGCCACTGG - Intronic
1018902495 6:168058551-168058573 CACCCCCCAACCCCCGCCCCCGG - Intronic
1019208029 6:170378925-170378947 CACACCCCCACCCTTGGCACTGG - Intronic
1019341667 7:511415-511437 CCCCCTCCTCCCCCAGCCACTGG - Intronic
1019484419 7:1282706-1282728 ATCCCCCCTACCCCAGCCCCTGG + Intergenic
1019539911 7:1546860-1546882 CACCCACCAACTCCTGCCAAAGG - Exonic
1019883166 7:3881248-3881270 CCCTCCCCTACCCATGCAACAGG + Intronic
1020419582 7:7986367-7986389 CCCCCCCCTCCCCCTGCTCCCGG - Intronic
1021639359 7:22722891-22722913 CACCCCCGTACCCCTTTCCCTGG - Intergenic
1022759548 7:33332990-33333012 CAACCCCCTCCCCCAGCCCCTGG + Intronic
1023096742 7:36669118-36669140 TATTCCCCTAACCCTGCCACAGG - Intronic
1023779377 7:43641972-43641994 CCCTCCCCTGCCCCTGCCCCGGG - Intronic
1028142935 7:87291682-87291704 ACCCCACCCACCCCTGCCACTGG + Intergenic
1029005981 7:97210206-97210228 CACCCCCCACCCCCTCCAACAGG + Intergenic
1029232370 7:99081074-99081096 CACTCCCGGACCCCTGCCCCAGG - Intronic
1029738923 7:102480642-102480664 CTCCCCCTGACCCCTGCCTCTGG + Intergenic
1029756924 7:102579805-102579827 CTCCCCCTGACCCCTGCCTCTGG + Exonic
1029774863 7:102678865-102678887 CTCCCCCTGACCCCTGCCTCTGG + Intergenic
1029976771 7:104842282-104842304 CACCCCCCCACCCCCGCAAAAGG - Intronic
1030830993 7:114221559-114221581 TACCCCCCTCCCCCAGCCATTGG + Intronic
1032016599 7:128384037-128384059 CACACCCCCACCCTTGCCTCAGG - Intergenic
1033537290 7:142323859-142323881 CACCCTCCTACCCCTCCCCAGGG - Intergenic
1033977325 7:147117377-147117399 GAACCCCCAACCCCTGCCAAGGG - Intronic
1035334677 7:158120183-158120205 CACTACCCTACCCCAGCCCCTGG - Intronic
1035564449 8:631844-631866 CGCCCCCCGACCCCCGCCCCAGG + Intronic
1035634485 8:1133994-1134016 CTCCCCCCTCCACCTCCCACAGG + Intergenic
1036066134 8:5383742-5383764 CACCCCACTTCCCCAGCCTCCGG + Intergenic
1036133350 8:6136569-6136591 CACCCCCCGACCCCCACAACTGG + Intergenic
1036258130 8:7221327-7221349 TTCCCCCCTACCCCCACCACTGG + Intergenic
1036310179 8:7679923-7679945 TTCCCCCCTACCCCCACCACTGG + Intergenic
1036351631 8:8015631-8015653 AACCCCCCTACCTAGGCCACGGG - Intergenic
1036830056 8:12014444-12014466 TTCCCCCCTACCCCCACCACAGG + Intronic
1038291176 8:26251216-26251238 CCCCCCCCCGCCCCTGCCCCCGG - Intergenic
1038635855 8:29286652-29286674 CAGCCCCCAACCTCAGCCACTGG - Intergenic
1039158715 8:34592938-34592960 CACTCCCCCACCCCGGCCCCTGG - Intergenic
1040027727 8:42796886-42796908 CACCCCCCTACCCCCGCCGTGGG + Intergenic
1041188613 8:55329144-55329166 CATGCCCCTGCCCCTGCCCCAGG + Intronic
1041691643 8:60693438-60693460 CACCCCACAAGCCCTGCCAGAGG - Intronic
1042279659 8:67042098-67042120 CACCCCCAACCCCCTGCCACTGG + Intronic
1042629740 8:70803941-70803963 ACCCCACCTATCCCTGCCACTGG - Intergenic
1042694635 8:71543284-71543306 CACCCCCCAACCTCTGCTCCAGG - Intronic
1043040836 8:75259929-75259951 CACCCCCCTGCCACCTCCACTGG + Intergenic
1045412433 8:101932191-101932213 CAGGCCCCCTCCCCTGCCACAGG + Intronic
1046431767 8:114136003-114136025 CCCCCCACCACCTCTGCCACTGG - Intergenic
1047150938 8:122262099-122262121 TAGCCCCCAACCCCTGCAACAGG + Intergenic
1047229166 8:122981206-122981228 CAACCCCCTTCCCCTGCCCAGGG - Intergenic
1047445367 8:124914513-124914535 CTCACCCCTATCCCTTCCACTGG - Intergenic
1048147947 8:131863897-131863919 CTCCCTCCAACCCCTGACACAGG + Intergenic
1049103608 8:140597473-140597495 CACCCCCCCCCCCCCGCCCCAGG + Intronic
1049510074 8:143022821-143022843 GAGCCCCCTGCCCCTCCCACAGG - Intronic
1049571351 8:143371624-143371646 CAGCCCCCCAACCCTGACACTGG - Intronic
1049584909 8:143428623-143428645 CACCCCCCTCCCCCCACCCCCGG + Exonic
1049615360 8:143573506-143573528 CACCGCCCCACCCCTTCCTCCGG + Intergenic
1049898046 9:129070-129092 CACCCTCCTACCGCCTCCACTGG - Intronic
1049936379 9:504815-504837 GAGGCCCCTACCCCTGCCTCGGG + Intronic
1050304834 9:4297669-4297691 CACCTCCCTACCCCTTCCCCAGG + Intronic
1051770412 9:20572195-20572217 CACCCCTCTGTCCCTGCCCCTGG - Intronic
1052628255 9:31004657-31004679 GACCTCCCTCCCCCTGCCAAGGG + Intergenic
1053697384 9:40650682-40650704 CACCCCCCCACCCCCCCCCCCGG - Intergenic
1053741124 9:41139368-41139390 CACCCTCCTACCACCTCCACTGG - Intronic
1053789232 9:41674682-41674704 CACCCCACCACCCCTGCCCCAGG - Intergenic
1054143058 9:61543599-61543621 CATCTCCCTCCCCCTGCCCCAGG - Intergenic
1054155908 9:61640081-61640103 CACCCCACCACCCCTGCCCCAGG + Intergenic
1054177513 9:61886035-61886057 CACCCCACCACCCCTGCCCCAGG - Intergenic
1054346334 9:63968857-63968879 CACCCTCCTACCACCTCCACTGG - Intergenic
1054444110 9:65295507-65295529 CACCCTCCTACCACCTCCACTGG - Intergenic
1054475679 9:65571081-65571103 CACCCCACCACCCCTGCCCCAGG + Intergenic
1054486161 9:65725998-65726020 CACCCTCCTACCACCTCCACTGG + Intronic
1054660018 9:67694773-67694795 CACCCCACCACCCCTGCCCCAGG + Intergenic
1054687225 9:68291929-68291951 CACCCTCCTACCACCTCCACTGG + Intronic
1054735286 9:68744551-68744573 CAGCCCCCTCTCCCTGCAACAGG - Intronic
1055505819 9:76948052-76948074 CACCCTCCTTCCCCAGCCTCTGG + Intergenic
1055705446 9:78995611-78995633 CAGCCCCTTACCCCAGCCACTGG + Intergenic
1056756642 9:89385869-89385891 CGCCCACCCACCCCTGCCAAGGG + Intronic
1056807855 9:89742771-89742793 CAGCCCCCAACCCCAGCCCCTGG - Intergenic
1057139590 9:92718451-92718473 CTCCTTCCTCCCCCTGCCACGGG - Intronic
1057142224 9:92734585-92734607 CTCCCTCCTCCCCCTCCCACAGG + Intronic
1057270051 9:93645502-93645524 CACCCACCTCCCACAGCCACAGG - Intronic
1058808622 9:108617451-108617473 CACCACCCTGCCCCATCCACAGG - Intergenic
1059322354 9:113479598-113479620 CATCCCCCAACCCCAGCCCCAGG - Intronic
1059459323 9:114419972-114419994 CAGCCCCCTACCCCGGCCCCTGG + Intronic
1059969771 9:119653732-119653754 CAATCCCCCATCCCTGCCACTGG - Intergenic
1060206623 9:121686213-121686235 CTTCCCCCTACCCCTGCCCAAGG - Intronic
1060224743 9:121783973-121783995 CACCCCTCTGCCCCTGCAGCTGG + Exonic
1060301337 9:122376131-122376153 CCCCCGCCTCCCCCAGCCACAGG - Intronic
1060649871 9:125316327-125316349 TAACCCCCTACCCCTGCGACAGG + Intronic
1060917059 9:127397772-127397794 CAGCCCCCTACCCCTCCCCTCGG + Intronic
1060991159 9:127850019-127850041 CCCACCCCCACTCCTGCCACAGG + Intronic
1061423854 9:130487036-130487058 CACCCCCCTCCCCAGGCCTCAGG + Intronic
1061921198 9:133783466-133783488 CACCCCCCCACCCCAGTCCCTGG - Intronic
1062036152 9:134383456-134383478 CCCCATCCTACCCCTGCCCCAGG - Intronic
1062348846 9:136128875-136128897 CACACCCCTGCCCCAGCCCCTGG - Intergenic
1062396528 9:136355036-136355058 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396555 9:136355119-136355141 CACCCGGCTACCCCTACCCCAGG - Intronic
1062396570 9:136355161-136355183 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396586 9:136355203-136355225 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396602 9:136355245-136355267 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396618 9:136355287-136355309 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396634 9:136355329-136355351 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396650 9:136355371-136355393 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396666 9:136355413-136355435 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396682 9:136355455-136355477 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062396698 9:136355497-136355519 CACCCGGCTACCCCTCCCCCAGG - Intronic
1062538364 9:137030684-137030706 CACCCACCTCCCCCGGCCAGCGG + Exonic
1185504184 X:619597-619619 CCCACCCCCACCCCTGCCCCAGG - Intergenic
1185532897 X:835846-835868 CAGTCCCCCACCCCTGCAACAGG + Intergenic
1186193897 X:7093160-7093182 CATCCCCCTCCCCCAGCCCCTGG + Intronic
1186732873 X:12429087-12429109 CAGCTCCCTTCCCCTGACACAGG - Intronic
1187279698 X:17848622-17848644 CTCACCTCTACCCCTGCCCCAGG + Intronic
1187366362 X:18668815-18668837 CTCCCCCCTCCCCCAGCCCCTGG - Intronic
1187639427 X:21272617-21272639 TACCACCCTGCCCCTGCCAGGGG - Intergenic
1187975957 X:24705692-24705714 CTCCCCCCCTCCCCTGCCCCTGG + Intronic
1189114924 X:38332383-38332405 CACCCCCCATCCCCTGTCAGTGG + Intronic
1189698680 X:43693808-43693830 CACTCCCCTCCCCCAGCTACAGG + Intronic
1190531372 X:51380967-51380989 TCCACCCCTACCCCTGCCTCTGG - Intergenic
1192911522 X:75609555-75609577 CACACCCCTCCCACTGCCTCTGG - Intergenic
1193044160 X:77034192-77034214 ACCCCACCCACCCCTGCCACTGG + Intergenic
1193881592 X:86929483-86929505 CACTCCCCTTCCCCAGCCTCTGG - Intergenic
1194823292 X:98531490-98531512 CCCTCCCCTACTCCTGGCACTGG + Intergenic
1195310178 X:103624833-103624855 TCCTCCCCTACCCCTGCCCCAGG - Intronic
1195311775 X:103638792-103638814 TCCTCCCCTACCCCTGCCCCAGG - Intergenic
1195852278 X:109295948-109295970 CCCTCCCCTACCCCTGGCAGTGG - Intergenic
1196225140 X:113157604-113157626 CACCCCTCTACCACTTCCACCGG - Intergenic
1196675697 X:118418574-118418596 CACCCCCCTGCCACTTCCACTGG - Intronic
1197153987 X:123250121-123250143 CTCCCTGCTACCCCTGCCCCAGG - Intronic
1198203553 X:134445364-134445386 CACCCCTCTGCACCTGCCAGGGG + Intergenic
1198212907 X:134531725-134531747 CTCCCTCCTACCCCAGCCCCTGG + Intergenic
1198416884 X:136429381-136429403 CACCTCCCTGCTCCTGCCCCTGG + Intergenic
1198841860 X:140865593-140865615 CACCACCCTACCCCTGCTGCTGG + Intergenic
1199333585 X:146590727-146590749 CTACCCGCTACCTCTGCCACTGG - Intergenic
1200341237 X:155398590-155398612 CACTCCCCTACTCCAGCCCCTGG - Intergenic
1200762995 Y:7056922-7056944 AAACCCCCTTCCCCTGCCTCGGG - Intronic
1202107040 Y:21383116-21383138 CAACCCCCCACCCCCGCGACCGG + Exonic
1202604511 Y:26627283-26627305 CACCCCGCTGCCCCTGCGAAAGG + Intergenic