ID: 969482999

View in Genome Browser
Species Human (GRCh38)
Location 4:7456792-7456814
Sequence TCATCTCTCGACGATCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969482981_969482999 29 Left 969482981 4:7456740-7456762 CCTTGGGTGCCTGCTGCTTGTCC 0: 1
1: 0
2: 0
3: 29
4: 273
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482994_969482999 6 Left 969482994 4:7456763-7456785 CCCTGTGGCAGGGGTAGGGGGGT 0: 1
1: 0
2: 3
3: 41
4: 319
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482983_969482999 20 Left 969482983 4:7456749-7456771 CCTGCTGCTTGTCCCCCTGTGGC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482990_969482999 8 Left 969482990 4:7456761-7456783 CCCCCTGTGGCAGGGGTAGGGGG 0: 1
1: 0
2: 2
3: 35
4: 384
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482992_969482999 7 Left 969482992 4:7456762-7456784 CCCCTGTGGCAGGGGTAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 487
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
969482995_969482999 5 Left 969482995 4:7456764-7456786 CCTGTGGCAGGGGTAGGGGGGTG 0: 1
1: 0
2: 6
3: 72
4: 591
Right 969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969482999 Original CRISPR TCATCTCTCGACGATCAGTG TGG Intronic
902931166 1:19732521-19732543 TCCTCTCTAGATGATCAATGAGG + Intronic
907803169 1:57791762-57791784 GCATCTCTGGACTGTCAGTGGGG - Intronic
911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG + Intronic
917886139 1:179386974-179386996 TCATCTCTAGAAGGTCAGTTTGG + Intronic
924239449 1:242027047-242027069 TCATCACTCTATGATCAGAGTGG + Intergenic
1068286155 10:54938809-54938831 ACATCTCTCTAAGATCAGAGCGG - Intronic
1074748846 10:116563729-116563751 TCATCTCTAGAAACTCAGTGTGG - Intronic
1078369684 11:10734627-10734649 TCATGTCTGGGGGATCAGTGTGG + Intergenic
1093343951 12:18017072-18017094 TCAGCTCTAGAAGATCAGTTTGG - Intergenic
1095899648 12:47314682-47314704 TCATCTGTCAAAGAGCAGTGAGG + Intergenic
1103922175 12:124404728-124404750 TCAGCTCTCGGGGATCTGTGGGG - Intronic
1104121835 12:125807337-125807359 TCTTCTCTCTACGGCCAGTGGGG + Intergenic
1116269854 14:42749280-42749302 TCCTCTCTCATCAATCAGTGGGG - Intergenic
1121855051 14:97260559-97260581 TCATCTCTAGAAGTTCAGTTTGG - Intergenic
1130174901 15:81558518-81558540 TCAGCTCTAGAAGATCAGTTTGG + Intergenic
1131693595 15:94853326-94853348 TCAGCTCTAGAAGTTCAGTGTGG + Intergenic
1146439122 17:32877832-32877854 TCATCTCTCCAGGATTATTGCGG + Intergenic
1146965391 17:37024268-37024290 TAATCTCTCAAGGCTCAGTGAGG - Intronic
1157564675 18:48671949-48671971 TTATCTCTCGAAGGTCATTGTGG + Intronic
1159170460 18:64759416-64759438 TCAGCTCTATACGATCAGTTTGG - Intergenic
1165280101 19:34789249-34789271 TCATATCTCGATGAACAGTTAGG + Intergenic
926646971 2:15300710-15300732 ACATCTCTCTCCGCTCAGTGTGG - Intronic
936927104 2:117748640-117748662 TCATCTCTTGACGGGCAGCGAGG - Intergenic
937509427 2:122577426-122577448 TCAGCTCTTGGCGAGCAGTGGGG + Intergenic
939526322 2:143299498-143299520 TCATATCTCAACGATTATTGAGG - Intronic
942384362 2:175425662-175425684 TCATCTCTGGAAGTTCAGTTTGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
960699065 3:120423483-120423505 TCATCTCACAAAGATCTGTGAGG + Intronic
962866788 3:139453718-139453740 TCCTCCTTCGAGGATCAGTGAGG - Intronic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
971182017 4:24337546-24337568 TCATCTCCCCACGCTCAGTAGGG - Intergenic
977997594 4:103514171-103514193 TCATCTCTAGAAGGTCAGTTTGG + Intergenic
984322794 4:178214125-178214147 TCATCTCGCAAAGATCAGAGAGG + Intergenic
1006726846 6:36205385-36205407 TCATCTCTGGAGCAGCAGTGTGG - Intronic
1013988147 6:116221529-116221551 TCATCTTTGGACGATGATTGAGG + Intronic
1021232292 7:18100588-18100610 TCATCTCTTGAAGTTCAATGGGG + Intronic
1046095332 8:109552314-109552336 TCATCTCTGGATGATCACTGGGG + Intronic
1047159450 8:122361164-122361186 TCATCTCTCTCAGATCAGTTTGG + Intergenic
1049134730 8:140885907-140885929 TCATCTCTCCAGGATCATTCTGG + Intronic
1055388225 9:75787972-75787994 TCAGCTCTGGAAGATCAGTTTGG + Intergenic
1058758788 9:108109357-108109379 TAATTTCTTGACCATCAGTGGGG + Intergenic
1193165746 X:78278079-78278101 TCAGCTCTAGAAGATCAGTTTGG - Intronic
1197231074 X:124004248-124004270 TCTTCTCTGGACTATGAGTGGGG - Intronic