ID: 969484188

View in Genome Browser
Species Human (GRCh38)
Location 4:7462685-7462707
Sequence CTCTGGGTCTGGCACGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969484178_969484188 10 Left 969484178 4:7462652-7462674 CCTCTTGTTCATCCTGGCGACCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 362
969484180_969484188 -2 Left 969484180 4:7462664-7462686 CCTGGCGACCTCAGTCCCTGGCT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 362
969484183_969484188 -10 Left 969484183 4:7462672-7462694 CCTCAGTCCCTGGCTCTGGGTCT 0: 1
1: 0
2: 2
3: 79
4: 629
Right 969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 362
969484176_969484188 22 Left 969484176 4:7462640-7462662 CCAGGGATGGAGCCTCTTGTTCA 0: 1
1: 1
2: 2
3: 26
4: 159
Right 969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 362
969484175_969484188 28 Left 969484175 4:7462634-7462656 CCTTTTCCAGGGATGGAGCCTCT 0: 1
1: 0
2: 1
3: 22
4: 180
Right 969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969484188 Original CRISPR CTCTGGGTCTGGCACGCAGG AGG Intronic
900369467 1:2324892-2324914 ATCTGGGTCAGGGAAGCAGGTGG + Intronic
900500396 1:3001647-3001669 CTCTGTGCCTGGCACGAACGAGG + Intergenic
900561642 1:3309970-3309992 CTGTGGGTCAGGCTCGCATGGGG - Intronic
900615779 1:3565090-3565112 CACAGGGCCTGGCACGCAGTGGG + Intronic
900967635 1:5970046-5970068 CCCTGGGCCTGGCAGGAAGGCGG - Intronic
901440836 1:9277342-9277364 GTCTCGGTCTGCCACCCAGGCGG + Intergenic
901497535 1:9630476-9630498 CCCTGTGTCTGGCACCCAGAGGG - Intergenic
901689902 1:10965988-10966010 CTCAGGGCCTGGCACACAGTAGG - Intronic
902145306 1:14393812-14393834 GTCTGGCTCTGTCACTCAGGCGG - Intergenic
902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG + Intronic
903285748 1:22275715-22275737 GTCTGGTTCAGGCACCCAGGGGG - Intergenic
903289249 1:22297419-22297441 ACCTGGGCCTGGCACTCAGGGGG + Intergenic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904349384 1:29895125-29895147 AGCAGGGTCTGGCACGCAGCAGG - Intergenic
904789745 1:33010443-33010465 CTCTTGGTCTGGAACCCATGGGG + Intronic
904906759 1:33902981-33903003 CCCTGTGTCTGGCAGGAAGGAGG - Intronic
904912995 1:33949383-33949405 CCCTGGCTCTGCCAGGCAGGCGG + Intronic
905242147 1:36588268-36588290 CTCAGGGCCTGGCACACAGTAGG + Intergenic
905251841 1:36654301-36654323 TTGTGGGTCTGGGATGCAGGGGG - Intergenic
905284955 1:36873191-36873213 CACAGGGCCTGGCACTCAGGTGG + Intronic
905287154 1:36889018-36889040 GCATGGGCCTGGCACGCAGGAGG - Intronic
905741296 1:40373811-40373833 ATCTGCGTCCGGCACCCAGGAGG + Exonic
906212547 1:44020152-44020174 CTCAGGGCCTGGCACACAGTGGG - Intronic
907890267 1:58630451-58630473 CTCTTGGTCTGGAACCCATGGGG + Intergenic
912963099 1:114213475-114213497 CTATGGGTCTGGAACGGAGTTGG + Intergenic
913243554 1:116851718-116851740 CTCAGTGTGTGGCACCCAGGAGG + Intergenic
914791923 1:150885895-150885917 GTCTGGCTCTGTCACCCAGGCGG + Intergenic
915014435 1:152719891-152719913 GTCTGGGTCTGGCAGGGAGCTGG - Exonic
915300602 1:154949420-154949442 CTCTGGGTGTTCCAGGCAGGTGG - Intronic
915623173 1:157098569-157098591 CTCAGGGTCTAGGATGCAGGAGG + Intronic
915873249 1:159584817-159584839 CTCTGTTTGTGGCACACAGGTGG + Intergenic
915894256 1:159799137-159799159 CTCTGGGTCTGGCCTACAGAGGG - Intergenic
919811356 1:201410728-201410750 CTCCTGGTCTGGCACTCAGCAGG + Intronic
920505200 1:206510788-206510810 CTCTGGGCCTGGCACTCTGCTGG - Intronic
920505356 1:206511845-206511867 ATCGGGGGCTGTCACGCAGGCGG - Intronic
920710396 1:208289096-208289118 CTTTGGGTCTGGAACTCAGTAGG + Intergenic
921044407 1:211463701-211463723 GTCTGGTTCTGTCACCCAGGCGG - Intergenic
921755871 1:218855393-218855415 CTCTGGGTCTGTGATGCAAGGGG - Intergenic
922440837 1:225653579-225653601 CTACGGGTCTGGCGCCCAGGAGG - Intergenic
922466045 1:225846067-225846089 CTGTGGCTCTGGCAGGAAGGAGG - Exonic
924473437 1:244363554-244363576 CTCTGGGTGGGGCCCCCAGGAGG + Intronic
1062768211 10:81068-81090 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1062997454 10:1880490-1880512 CTCTGGGTCTTGTTCTCAGGAGG + Intergenic
1063077901 10:2734695-2734717 CTCTGGGTCAGCCACACAGACGG - Intergenic
1065341448 10:24710603-24710625 CTCAGTGTCTGGCACTCAGAAGG + Intronic
1065801465 10:29356697-29356719 CCCTGGGTCTGGCTCCCAAGGGG + Intergenic
1065977555 10:30855957-30855979 CTCTGTGCCTGGCACACAGGAGG + Intronic
1067051977 10:43026795-43026817 GCCTGGGTCTGCCAGGCAGGAGG + Intergenic
1067202395 10:44184687-44184709 GTCTGGGTCTGGAATGCTGGTGG + Intergenic
1068271489 10:54732271-54732293 CTCTGGCTCTGGCTCTCTGGAGG - Intronic
1070189587 10:74099594-74099616 CTCAGGGTCTGGCACATAGTAGG + Intronic
1070491677 10:76982418-76982440 CACAGGGCCTGGCACTCAGGGGG + Intronic
1070828576 10:79405202-79405224 CTCTGAGTTTGGCAAGCTGGAGG - Intronic
1070963036 10:80512247-80512269 CGCAGGATCTGGCACGCAGCAGG - Exonic
1071634556 10:87238501-87238523 GTCTGGCTCTGTCATGCAGGAGG + Intergenic
1071660688 10:87499520-87499542 GTCTGGCTCTGTCACGCAGGAGG - Intergenic
1072739122 10:97899155-97899177 ATCTGGGACTGGCACTCAGCTGG - Intronic
1072741289 10:97911542-97911564 TGCTGGGGCTGGCACCCAGGAGG - Intronic
1072743253 10:97922854-97922876 CTCAGTGCCTGGCACACAGGAGG + Intronic
1073726476 10:106237015-106237037 CTCTGGGTTTTGCAGGCAGTAGG + Intergenic
1074077014 10:110137777-110137799 CACAGGGTCTGGCACACAGATGG - Intergenic
1074500771 10:114022029-114022051 AACTGGGTCTGGAAGGCAGGGGG + Intergenic
1074979729 10:118609902-118609924 TGCTGAGTCTGGCACCCAGGTGG + Intergenic
1075640019 10:124057748-124057770 CTCTGGCCGTGGCAGGCAGGAGG + Intronic
1076655997 10:132023780-132023802 CGCTGAGTCCGGAACGCAGGAGG + Intergenic
1076791879 10:132781004-132781026 TGCTGGGGCTGGCAGGCAGGTGG + Intronic
1077325457 11:1962058-1962080 CTCTTGGGCTGGCCCCCAGGCGG + Intronic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1080687915 11:34530798-34530820 CTCTGGGGTTGGGACGGAGGTGG + Intergenic
1081482969 11:43506187-43506209 CACTGTGTCTGGCACACAGCAGG - Intergenic
1081622603 11:44627855-44627877 CTCTGTGTCTGGCAGGTAGGGGG + Intergenic
1081670397 11:44939109-44939131 CACAGGGGCTGGCACGCAGTAGG - Exonic
1081981029 11:47267351-47267373 CGCTGTGTCTGGCACACAAGAGG - Intronic
1082095785 11:48128083-48128105 GTCTGGGCCTGGCACGGAGCAGG - Intronic
1082771005 11:57207344-57207366 CTAAGGGGCTGGCAGGCAGGCGG + Intergenic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1084105623 11:66978412-66978434 CTCTGGGCCTGGCACATAGTAGG + Intergenic
1084363552 11:68684193-68684215 CTCTGGGGCTGGGACCCCGGGGG + Intronic
1084403972 11:68960546-68960568 GTGTGGGTCAGGCACGGAGGTGG - Intergenic
1084589032 11:70079455-70079477 CTCTGGGTCTGGCCCTGGGGAGG - Intronic
1084960340 11:72713104-72713126 CTCAGGGTCTGACAGGCAGCTGG + Intronic
1085306512 11:75488992-75489014 CACTGGGCCTGGCACCAAGGAGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1090452391 11:126818184-126818206 CACTTCGTCTGGCACGCAGCTGG - Intronic
1090877784 11:130806344-130806366 CCCTGTGTGTGGCACCCAGGAGG + Intergenic
1202808438 11_KI270721v1_random:17237-17259 CTCTTGGGCTGGCCCCCAGGCGG + Intergenic
1091503224 12:1039499-1039521 CTCTTGCTCTGTCACCCAGGTGG - Intronic
1091606286 12:1954694-1954716 CTCTGCATCTGGCACAGAGGAGG + Intronic
1091630985 12:2160848-2160870 GTCTTGGTCTGTCACCCAGGCGG + Intronic
1098092884 12:66922868-66922890 CTCTGAGCCTGGCACACAGTGGG + Intergenic
1098273490 12:68791310-68791332 GTCTCGGTCTGTCACCCAGGCGG - Intronic
1100072271 12:90735216-90735238 CTCTGGGTCTGTGATGCAAGGGG + Intergenic
1101326881 12:103723651-103723673 CTCTGGGTCTGCCGGGCTGGCGG - Intronic
1101330632 12:103755156-103755178 CTCTGTGCCTGGCACACAGTAGG - Intronic
1101711734 12:107273808-107273830 CTCTTGCTCTGACACCCAGGCGG - Intergenic
1102453577 12:113057714-113057736 CGCAGGGTCTGGGACGCAGTTGG + Exonic
1102699946 12:114830362-114830384 GTCTTGGTCTGTCACCCAGGTGG + Intergenic
1102960030 12:117086455-117086477 CTCTCGCTCTGTCACCCAGGTGG + Intronic
1103804447 12:123561519-123561541 GTCTGGCTCTGTCACTCAGGCGG + Intergenic
1103914473 12:124369406-124369428 CACTGGGGCTGCCAGGCAGGAGG + Intronic
1104323339 12:127772756-127772778 ATCTGGGTCTGGAACACAGCAGG + Intergenic
1104569095 12:129909421-129909443 CTCTGCGTGTGCCAGGCAGGTGG + Intergenic
1104978280 12:132561729-132561751 CACTGTCTCTGGCACGCACGCGG - Intronic
1104984403 12:132588520-132588542 CTCAGGGCCTGGCACGCAACAGG + Intergenic
1105293828 13:19071559-19071581 CTCTGGCCCAGGCACCCAGGTGG - Intergenic
1105370640 13:19798975-19798997 ATCTGGCTCTGTCACCCAGGTGG + Intergenic
1106032381 13:26014904-26014926 CTCTGTGTCTGGCATACAGAAGG - Intronic
1107050269 13:36039955-36039977 GTCTGGCTCTGTCACCCAGGTGG + Intronic
1108574706 13:51781391-51781413 CACTGGGTCTGGCACTCAGTGGG - Intronic
1112120130 13:96400883-96400905 CTCTGAGTCTGGAAACCAGGAGG - Intronic
1112602430 13:100869535-100869557 CTGTGGATCTGGCACACAGTGGG - Intergenic
1113784866 13:112997140-112997162 CTCTGGGTCTGCCACTGAGCTGG - Intronic
1114779774 14:25525644-25525666 GTCTTGCTCTGTCACGCAGGCGG + Intergenic
1114893801 14:26960391-26960413 CTCTAGGCATGTCACGCAGGTGG - Intergenic
1115482703 14:33877383-33877405 ATCTGGCTCTGTCACCCAGGTGG - Intergenic
1115910122 14:38247015-38247037 CTCAGTGTCTGGCATGTAGGAGG - Intergenic
1117111085 14:52455410-52455432 CTGTGTGTCTGGCAAGCAGCAGG + Exonic
1118316903 14:64731173-64731195 CTCTGGGGCTGGGACGCTGGGGG + Intronic
1121245851 14:92460352-92460374 CACTGTGTCTGGCACACAGTAGG + Intronic
1121720784 14:96107250-96107272 CACAGGGTCTAGCACACAGGAGG - Intergenic
1121736884 14:96224998-96225020 CACTGGGTGTGGCACAAAGGAGG - Intronic
1122032428 14:98922519-98922541 CTCTGGGTTTGGCACAATGGTGG + Intergenic
1122606887 14:102952780-102952802 CTCTGGCTCAGGCTCGTAGGTGG - Intronic
1122703332 14:103605004-103605026 AGCAGGGCCTGGCACGCAGGAGG - Intronic
1122903649 14:104792260-104792282 TCCAGGGTCTGGCACGCTGGCGG - Intronic
1123449170 15:20349578-20349600 GTCTGGGGCTGACACCCAGGAGG - Intergenic
1125215529 15:37269291-37269313 CTCTGGGTCTGACAGGCCAGGGG - Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125475725 15:40046949-40046971 CTGTGGGTCTGTCACAGAGGTGG - Intergenic
1125584962 15:40813531-40813553 GTCTGGGTCTGGGTCACAGGAGG - Intronic
1126682235 15:51213600-51213622 GTCTGTGTGTGGCACACAGGAGG + Intronic
1128649646 15:69401145-69401167 CTCTGGGACTGGCTAGGAGGAGG + Intronic
1128725125 15:69982436-69982458 CTCTAGGTCTGGCACAGATGTGG + Intergenic
1128801437 15:70499592-70499614 CCCAGGGCCTGGCATGCAGGAGG - Intergenic
1129685633 15:77684787-77684809 CCCTGGGCCTGGCACACAGTAGG - Intronic
1129695130 15:77736363-77736385 CCCAGGGTCTGGCACACAGTAGG - Intronic
1129704179 15:77785170-77785192 CTCAGGGCCTGGCACACAGTGGG + Intronic
1129784960 15:78304014-78304036 CTCTGGGTCCTGCACCTAGGAGG - Intergenic
1130369092 15:83268347-83268369 TTCTGGGCCTGGCACACAGTGGG - Intronic
1130656061 15:85792949-85792971 CTCAGGGCCTGGCACACAGCAGG + Intronic
1130671774 15:85919296-85919318 GTCTGGCTCTGTCACCCAGGTGG + Intergenic
1132039208 15:98511183-98511205 CCCAGGGCCGGGCACGCAGGTGG + Intronic
1132134599 15:99322751-99322773 CTCTGTGCCTGGAACACAGGAGG - Intronic
1132134916 15:99326366-99326388 CTCTGTGCCTGGAACACAGGAGG - Intronic
1132457111 16:30044-30066 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1132959233 16:2612886-2612908 CTGTGGGAGTGGCTCGCAGGTGG + Intergenic
1132972293 16:2694861-2694883 CTGTGGGAGTGGCTCGCAGGTGG + Intronic
1133304846 16:4802450-4802472 CGCCGGGTCTGTCCCGCAGGAGG - Exonic
1134017372 16:10898566-10898588 CTCTGGGCCTGGCACACAGTGGG - Intronic
1134060946 16:11199136-11199158 CTTGGGGACTGGCACCCAGGGGG + Intergenic
1134067829 16:11240657-11240679 CTCTGTGCCTGGCATGCAGAAGG + Intergenic
1134441037 16:14299853-14299875 CTCTGTGCCTGGCACACAGAGGG + Intergenic
1135042489 16:19128576-19128598 GCCTGAGTCTGGCACGCAGTGGG - Intronic
1135603592 16:23803735-23803757 CTATGGGACTGGCAAACAGGAGG - Intergenic
1135614233 16:23897049-23897071 CACAGGGTCTGGCACACAGTAGG - Intronic
1135732985 16:24909798-24909820 CTCTTGTTCTGTCACCCAGGTGG - Intronic
1136009420 16:27353292-27353314 CTCTTGCTCTGTCACCCAGGTGG - Intronic
1136010852 16:27362763-27362785 CTCTGGGTCGGGCTGGCAGGAGG - Exonic
1137280732 16:46974068-46974090 CTCTGGGTCTGGCTCCCTCGGGG + Intergenic
1137539337 16:49351330-49351352 CTCAGTGCCTGGCACGCAGTAGG + Intergenic
1137645277 16:50067794-50067816 CTCAGTGTCTGGCACACAGTTGG - Intronic
1138489737 16:57369780-57369802 CACAGTGCCTGGCACGCAGGAGG - Intergenic
1140427748 16:74875045-74875067 GGCAGGGCCTGGCACGCAGGAGG + Intronic
1141111815 16:81276226-81276248 CTCTGGGTTTGGCACTTTGGAGG + Intronic
1141613463 16:85197104-85197126 CTCTGTGCCTGGCATGCAGGAGG - Intergenic
1141764554 16:86049883-86049905 CACTGGGCCTGGCGCACAGGAGG - Intergenic
1142662502 17:1440969-1440991 GTCTGGCTCTGTCACCCAGGCGG + Intronic
1143974669 17:10821088-10821110 CACAGGGTCTGGCACAGAGGAGG + Intergenic
1144853578 17:18256402-18256424 CTCTGAGCCTGACACGGAGGTGG + Intronic
1144951686 17:18997845-18997867 CTCTGTGTCTGGCATGGAGCTGG - Intronic
1146208959 17:30927017-30927039 CTATGGGCCTGGTGCGCAGGTGG + Intronic
1146354959 17:32126129-32126151 CTCAGGGCCTGGCACCCAGCAGG + Intergenic
1146626548 17:34439509-34439531 CCCTGGGTGTGGCACACAGTAGG + Intergenic
1146703365 17:34980972-34980994 CACCGGGTCCGGGACGCAGGCGG - Intronic
1148773009 17:50077691-50077713 CTCAGGGGCTGGCACACAGTTGG - Intronic
1148826307 17:50396900-50396922 CTCAGAGTCGGGCACGGAGGTGG + Intronic
1148836883 17:50470082-50470104 CTCTGGCTCTGGCACGGCTGGGG - Intronic
1148905614 17:50909949-50909971 CACAGGGACTGGCACACAGGTGG - Intergenic
1150231940 17:63558697-63558719 CTTTGGGTTGGGCAGGCAGGAGG - Intronic
1151975990 17:77483745-77483767 CTCTGGGAATGGTGCGCAGGAGG + Intronic
1152243841 17:79175148-79175170 ATGGGGGTCTGACACGCAGGTGG + Intronic
1152386433 17:79977511-79977533 CACAGGGCCTGGCACGCAGCAGG + Intronic
1152880818 17:82813877-82813899 CTCTGGGCTGGGCACGCAGGAGG + Intronic
1152891376 17:82883499-82883521 CTCTGAGTGTGGCTCGCATGGGG + Intronic
1152946358 17:83199549-83199571 CCCTGGCTCTGGCAGGCAGGTGG + Intergenic
1152961100 18:80565-80587 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1153528459 18:6019991-6020013 CTTAGGGTCTGGCACACAGTAGG - Intronic
1156613256 18:38752205-38752227 CTTTGGCTCTGGCAGGCAGCAGG + Intergenic
1160226031 18:77011585-77011607 CTCTGGGAGTGGCAGGCAGCCGG - Intronic
1160378568 18:78431649-78431671 CTCTAGGTCTGGAAAGCAGTGGG - Intergenic
1161457768 19:4378102-4378124 CACAGGGCCTGGCACCCAGGTGG + Intronic
1161625054 19:5321588-5321610 CTCTGGGCCTGGCACACAGTGGG - Intronic
1161701423 19:5797999-5798021 CACAGGGTCTGGTACACAGGAGG + Intergenic
1161795396 19:6383492-6383514 CCCTGTGCCTGGCCCGCAGGAGG - Exonic
1163279505 19:16306956-16306978 CTCTGGATCTGGCACCTGGGTGG + Intergenic
1164207255 19:23069259-23069281 CACTGGGTCTTGTACCCAGGTGG - Intergenic
1164210723 19:23095210-23095232 CACTGGGTCTTGTACCCAGGTGG + Intronic
1164997413 19:32732429-32732451 CTCTGGGGCTGGGAACCAGGGGG + Intronic
1165061524 19:33207316-33207338 CTCTGGGTCTCGCAGGCCCGAGG - Exonic
1166062603 19:40336061-40336083 CTCTGGGTTTGGCATGGAGGTGG - Intronic
1166318941 19:42004483-42004505 CCCAGGGTCTGGCACACAGTTGG - Intronic
1166738879 19:45102364-45102386 AGCTGGGACTGGCACCCAGGGGG - Intronic
1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG + Intronic
1166838489 19:45681983-45682005 TACTGGGCCTGGCACGCAGTTGG - Exonic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167464954 19:49645794-49645816 CCTTGGGGCTGGCATGCAGGAGG + Intronic
1168126722 19:54288065-54288087 CTGTGGGTTTGTCACGCAGGGGG - Intergenic
1168340057 19:55617567-55617589 CTCAGGGCCTGGCAGGCAGGAGG - Exonic
1168678962 19:58299858-58299880 CTCTGGCTCTGGCATCCTGGAGG - Exonic
925384059 2:3449768-3449790 CTCTGGGTCAGGCACGGTGATGG - Intronic
926731531 2:16039294-16039316 CACTGGCTGTGGCAGGCAGGTGG - Intergenic
927088854 2:19695147-19695169 CTCCAGGTCTGGCATGCAGTGGG - Intergenic
927091301 2:19714833-19714855 CTCCAGGTCTGGCACACAGTGGG - Intergenic
927099498 2:19777026-19777048 CTCAGTGTCTGGCACCAAGGAGG + Intergenic
928088190 2:28358704-28358726 CAATGGGCCTGGCACGCAGTTGG - Intergenic
928201712 2:29251445-29251467 CTCAGGGTCTGGCACATAGTAGG - Intronic
928289753 2:30026800-30026822 CTCTGGCTCTGCCACACAGTCGG - Intergenic
933992989 2:87647057-87647079 CTGTGGCTCTGGGATGCAGGTGG - Intergenic
934665257 2:96164910-96164932 CTCTGCGTCTGGTAGGGAGGAGG - Intergenic
936059065 2:109282806-109282828 CTCCAGGGCTGGCAGGCAGGAGG + Intronic
936300867 2:111303822-111303844 CTGTGGCTCTGGGATGCAGGTGG + Intergenic
937043356 2:118837419-118837441 CTCTGCCTTTGGCAGGCAGGTGG - Intergenic
938383300 2:130848541-130848563 CCCTGGGAATGCCACGCAGGAGG - Intronic
940479131 2:154206024-154206046 GTCTGGCTCTGTCACCCAGGTGG + Intronic
940511986 2:154627365-154627387 GTCTTGGTCTGTCACCCAGGTGG + Intergenic
943864333 2:192909435-192909457 ATCTGGCTCTGTCACCCAGGTGG + Intergenic
944893823 2:204144096-204144118 CTCTGGTTCTGGGTCCCAGGAGG + Intergenic
946049941 2:216854263-216854285 CCCTGGGTCTAACACACAGGAGG - Intergenic
947729507 2:232420177-232420199 CACGGGGCCTGGCACGTAGGGGG + Intergenic
947740536 2:232482832-232482854 CTCTGGGCCAGGCACCCACGTGG + Exonic
947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG + Intronic
947912189 2:233808749-233808771 CTATGGGTCAGGCACACATGAGG - Intronic
947913744 2:233818954-233818976 CTTTGTCTCTGGCACGCAGTAGG + Intronic
947947445 2:234118480-234118502 CTCTGGGGCTGGGACATAGGAGG + Intergenic
948292063 2:236832841-236832863 CACTGGCTCTGGCACGTAGTAGG + Intergenic
948523641 2:238557683-238557705 CTCTGGGTCAGGCAGGAAAGTGG + Intergenic
948830948 2:240598027-240598049 CTCTGTGTCCGGCAGGTAGGTGG - Exonic
948831943 2:240602584-240602606 CACTGGGTTTGGCTCGCCGGGGG - Intronic
948943500 2:241207924-241207946 CTCTAGCTCTGGCACTCTGGGGG + Intronic
1169900504 20:10547824-10547846 TACTGGGTCTGGCACACAGATGG - Intronic
1170094237 20:12628747-12628769 GTCTGGCTCTGTCACTCAGGTGG + Intergenic
1170617455 20:17965640-17965662 GTCTGGCTCTGTCACCCAGGCGG - Intronic
1172798102 20:37557184-37557206 CTCTGTGCCTGGCACATAGGTGG + Intergenic
1173644616 20:44625742-44625764 CTCTGGGACTGGGACAGAGGAGG + Intronic
1173839375 20:46147382-46147404 CTCAGGGCCTGGCACACAGTAGG - Intergenic
1173849160 20:46207084-46207106 CTCAGGGCCTGGCATGGAGGAGG + Intronic
1174174215 20:48634880-48634902 CTCAGGACCTGGCACCCAGGGGG - Intronic
1174305166 20:49609841-49609863 CACTGTGTCTGGCACTCAGTAGG - Intergenic
1174367192 20:50063755-50063777 CTCTGGGTCAGGCCCCCCGGTGG + Intergenic
1175795044 20:61765977-61765999 CTCTGGGATTGGCTCCCAGGAGG + Intronic
1175885405 20:62287876-62287898 CACAGGGCCTGGCAGGCAGGAGG - Intronic
1176033914 20:63027109-63027131 CTCTGGGTCTACCAGGAAGGTGG + Intergenic
1176722966 21:10406654-10406676 CTCTTGCTCTGTCACCCAGGCGG - Intergenic
1177868083 21:26536906-26536928 ATCTGGGCCTGGCACACAGTAGG - Intronic
1181627748 22:24133090-24133112 CTCAGGGTGGGGCAGGCAGGGGG + Intronic
1181756815 22:25029726-25029748 CTCTGGGTATGGCCAGCCGGGGG + Intronic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1183208627 22:36436064-36436086 CACCGGGTCTGGCACGCGGCAGG + Intergenic
1183371462 22:37434914-37434936 CTCAGGGTCTGGCATGCAGATGG + Intergenic
1183613156 22:38924170-38924192 CTCTGGCTCTGGCTCGCTGCAGG - Intergenic
1183648880 22:39142387-39142409 CTCTGGGCCTGGTACACAGCAGG + Intronic
1183703771 22:39464401-39464423 CTCTGTGCCTGGCACGTAGAAGG + Intronic
1183717670 22:39543361-39543383 CTTTGGGTCGGGGAGGCAGGGGG - Intergenic
1184088191 22:42278528-42278550 GTCTGGATCTGCCGCGCAGGGGG - Intronic
1184101825 22:42344796-42344818 CTCTGGGCCTGGCCCACAGTAGG + Intergenic
1184797532 22:46740707-46740729 CCCTGGGTCTGACACACAGCAGG - Intergenic
1185416806 22:50715072-50715094 CGCTGGGTCGGGCAGGCATGGGG + Intergenic
950075953 3:10187393-10187415 CTCTGGGTCAGACAGGAAGGCGG + Intronic
950101602 3:10360199-10360221 CTCTGGGACTGCCACTTAGGTGG + Intronic
950183682 3:10932310-10932332 CCCAGGGCTTGGCACGCAGGAGG - Intronic
951185888 3:19712507-19712529 CTCTGGATGTGGCACTCATGGGG + Intergenic
952530554 3:34258112-34258134 CTCTGGGTCTGTGACTCTGGAGG - Intergenic
953201522 3:40782093-40782115 CTCTGGGTGTGGCAAGTGGGTGG + Intergenic
954502276 3:51029722-51029744 CTCTGACTCTGGCAAGCATGAGG - Intronic
954649791 3:52154156-52154178 CGCAGGGCCTGGCACGCAGGAGG + Intronic
954912497 3:54121735-54121757 GCCTGGGTCGGGCGCGCAGGGGG + Intergenic
957574114 3:81986797-81986819 GTCTGGCTCTGTCGCGCAGGTGG + Intergenic
959562449 3:107798254-107798276 CTCTGGGTGTTGCACGTTGGTGG - Intronic
960704400 3:120468256-120468278 CTCTGGGACAGGCAAGAAGGAGG + Intergenic
961007615 3:123415345-123415367 CTCTGGCTCTGGCGTGGAGGTGG - Intronic
961479983 3:127173415-127173437 GTCTGGGTCTGGGTGGCAGGGGG - Intergenic
966797865 3:183732887-183732909 GTCTTGCTCTGGCACCCAGGTGG + Intronic
967962504 3:194937347-194937369 ATCTGGGTCTTGCAGGCAGGAGG + Intergenic
969032397 4:4225731-4225753 CTCAGGGCCTGGCACGAAGTGGG - Intronic
969066403 4:4485262-4485284 CACTGTGTCTGGCACACAGTAGG + Intronic
969264224 4:6054684-6054706 AGCTGGGTCTGGGATGCAGGCGG - Intronic
969449455 4:7264776-7264798 CTCAGGGTCTGGCCTGCAGCTGG - Intronic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
969605809 4:8201773-8201795 CTCCGGGCCTGGCACACAGCTGG - Intronic
969658173 4:8509921-8509943 CCCTGGGTGTGGCACCCAAGGGG + Intergenic
970094454 4:12446351-12446373 TGCTGGGTCTGGCACTCATGCGG - Intergenic
970569615 4:17366853-17366875 CTATGGGTCAGGAACCCAGGCGG - Intergenic
972493415 4:39610017-39610039 GTCTGGCTCTGTCACCCAGGTGG + Intronic
973259450 4:48147052-48147074 CTCTGTTTCTGGCATGCAGTAGG + Intronic
974043935 4:56881559-56881581 CTCTGGGTCTTGGAGGCTGGTGG + Intergenic
975172448 4:71247707-71247729 CTCTGTGTTTGGCTCACAGGTGG + Intronic
976207570 4:82637473-82637495 CTCAGGGTCTGGCACATAGCAGG - Intronic
976520128 4:86017201-86017223 CGCTGGGTTTCGCAGGCAGGCGG + Exonic
978373265 4:108050468-108050490 GTATGGATCTTGCACGCAGGAGG + Intronic
981661969 4:147178128-147178150 CTCTGCATCTGGAACCCAGGAGG - Intergenic
984705462 4:182844488-182844510 CCCAGGGTCTGGAACTCAGGAGG - Intergenic
986357037 5:6938774-6938796 CTCCAGGTCTGGCACCCAGCAGG - Intergenic
986712484 5:10498125-10498147 ATCTGGCTCTGTCACCCAGGTGG - Intergenic
986858708 5:11903294-11903316 CTCAGGGTCTGGCAAGCCGCGGG + Intronic
988513667 5:31887020-31887042 CACTGGTTCTTGCACCCAGGCGG - Intronic
989780275 5:45256342-45256364 GTCTGGCTCTGTCACCCAGGTGG - Intergenic
997401921 5:133610676-133610698 CTCTGGGTCTGGTTGGCGGGGGG - Intronic
997740451 5:136248390-136248412 CACAGGGTCTGGCACACAGCAGG + Intronic
999102865 5:149041378-149041400 CTCTGGGACTTGCTCCCAGGAGG + Intronic
999540152 5:152562439-152562461 CTCTGGATCTGGCCCACAGAGGG - Intergenic
999695596 5:154186144-154186166 TCCTGGGTCTGGCACACAGTAGG - Intronic
1000799946 5:165713425-165713447 CTCAGGCTCTGCCACCCAGGTGG + Intergenic
1001098848 5:168797298-168797320 CTCTGGGGCTGCCAGTCAGGTGG + Intronic
1001381205 5:171307824-171307846 CACTGGGCCTGGCACGTAGTAGG - Exonic
1001847849 5:174937574-174937596 CACTGGGTCCTGCAGGCAGGGGG - Intergenic
1002089541 5:176796334-176796356 CTCTGGGGCTGCCCTGCAGGTGG + Intergenic
1002679671 5:180950973-180950995 CTCTGGCTCTGGCACAGAGCAGG - Intergenic
1003872755 6:10415016-10415038 CTCTCGGTCTCGCACCCAAGTGG + Exonic
1006424931 6:33958081-33958103 CTGTGGCTATGGCACTCAGGAGG - Intergenic
1006523866 6:34587912-34587934 ACCTGCGTCTGGCACCCAGGAGG - Exonic
1007105422 6:39280277-39280299 AGCGGGGTGTGGCACGCAGGAGG + Intergenic
1007367980 6:41407963-41407985 CTCTGAGCCTGGCAGGAAGGAGG - Intergenic
1012243164 6:96897440-96897462 CTCTGGGTCTCGGAAGTAGGCGG + Intronic
1015415176 6:132940125-132940147 CTCTGGGTCTGGGATGGAAGGGG - Intergenic
1015582265 6:134738511-134738533 CTCTGGGCTTGGCACTTAGGAGG - Intergenic
1015941977 6:138461954-138461976 CTCAGGGCCTGGCACACAGTAGG - Intronic
1016124135 6:140378949-140378971 CTCTGGGTATATCAGGCAGGAGG - Intergenic
1016912737 6:149215180-149215202 GTCTGGCTCTGTCACCCAGGTGG + Intergenic
1018395565 6:163375599-163375621 CCCTGGAGCTGGCACCCAGGGGG + Intergenic
1018931500 6:168243020-168243042 CTCTGTGACCGGCAAGCAGGAGG + Intergenic
1019101269 6:169632157-169632179 CTCTCGCTCTGTCACCCAGGCGG - Intronic
1019597855 7:1866645-1866667 CTCTGGGGCTGGCCGGCAAGAGG - Intronic
1021942348 7:25690092-25690114 CTCTGGATCAGGTACTCAGGAGG + Intergenic
1022404141 7:30070829-30070851 CTCTGGGCCAGGCACGGTGGTGG - Intronic
1022970425 7:35511848-35511870 CTCCTGGTCTGGCACGCACCAGG - Intergenic
1023741227 7:43282488-43282510 CTCTGGGCCTGGCATGTAGTGGG - Intronic
1024566659 7:50687005-50687027 CCCTGAGTCTGGCACACAGCAGG + Intronic
1026984770 7:74547828-74547850 CTTTGGGTCTGGCAGGCCTGGGG - Intronic
1029288578 7:99484210-99484232 CTCAGCGTCTGGCACACAGAAGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1029596724 7:101541789-101541811 CTCAGTGTCTGGCAACCAGGAGG - Intronic
1030663779 7:112251158-112251180 CTCTGGGTCTGACAAGTAGAGGG - Intronic
1031029206 7:116716222-116716244 CTCTGGCTCTGTCACCCAGGCGG - Intronic
1032765791 7:134991659-134991681 CACTGGGTCTGGCACATAGTAGG + Intronic
1034270542 7:149801628-149801650 CTCTGGGCATGGGATGCAGGAGG + Intergenic
1034338473 7:150338184-150338206 CTCTGGCTCTGGAGCACAGGAGG + Intergenic
1034420410 7:150987591-150987613 CACTGGGTCTGTCAGCCAGGAGG - Intergenic
1037916874 8:22778244-22778266 CTTTGGGTCTGGGAGGAAGGAGG - Intronic
1038488010 8:27950182-27950204 CCCTGGGGCTGGCATGCAGTTGG - Intronic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1039242148 8:35568658-35568680 CTCTCGTTCTGTCACCCAGGTGG - Intronic
1039508304 8:38068565-38068587 CTCTTGCTCTGTCACCCAGGCGG + Intergenic
1045002779 8:97892964-97892986 CGCTGGGTCTGCCAGACAGGTGG + Intronic
1049225446 8:141448566-141448588 CTCTGTGGCTGGCACACAGCAGG + Intergenic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1049582043 8:143417198-143417220 TTCTGGGCCTGGCACACAGGTGG - Intergenic
1053004844 9:34597584-34597606 CTCTAGGCCTGGCACACAGTAGG - Intergenic
1053459386 9:38256995-38257017 GTCTGGCTCTGTCACCCAGGTGG + Intergenic
1056931584 9:90882494-90882516 CTCTGGGTTTGGGATTCAGGGGG - Intronic
1057311611 9:93946566-93946588 CACAGTGTCTGGCACGCAGAGGG + Intergenic
1058827242 9:108786006-108786028 CTCTTGGTCTGGGACTCAAGAGG - Intergenic
1059491427 9:114670831-114670853 CTCAGGGTCTGGCACAGAGTAGG - Intergenic
1059536611 9:115086670-115086692 CCCTGGGTGTGGCAGGCATGTGG + Exonic
1060615282 9:125007619-125007641 ATCTGGCTCTGTCATGCAGGTGG - Intronic
1060969573 9:127730464-127730486 CTCAGGGTCTGGGTCGCTGGGGG + Intronic
1061042900 9:128150010-128150032 TTCTGAGTCTGGCAGGGAGGAGG - Intronic
1061895922 9:133647692-133647714 CTCTTGGTCTGCCTAGCAGGTGG + Intronic
1062027477 9:134347149-134347171 CTATGGGGGTGGCAGGCAGGTGG + Intronic
1062064429 9:134518477-134518499 CTCTGGGCCTGGCCTGCGGGCGG + Intergenic
1062519746 9:136952711-136952733 CTCTGGGTCTGGCAGGGACATGG - Intronic
1062737061 9:138143421-138143443 CTCTGGGTGTGGACCTCAGGAGG + Intergenic
1185550856 X:981395-981417 CTCTGGGGCTGGGATGGAGGAGG + Intergenic
1186461500 X:9751968-9751990 CTCTGGGGCTGGCCCCCAGCAGG - Intronic
1187286267 X:17906813-17906835 CTATGGGTCAGGCCCGGAGGTGG - Intergenic
1189487293 X:41443390-41443412 GCCTGGGTTTGGCACACAGGCGG - Intergenic
1198478572 X:137019081-137019103 CTCTGGGGGTGTCACCCAGGTGG + Intergenic
1198517970 X:137427696-137427718 CACTGGGTCTGGCACACAGTAGG - Intergenic
1199638133 X:149832956-149832978 CTCAGGGGCTGGCCCACAGGGGG - Intergenic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic
1200399248 X:156009682-156009704 CTCTGGGTGTGGACCTCAGGAGG + Intronic
1201266349 Y:12210814-12210836 CTCTGTGCATGGCATGCAGGAGG + Intergenic
1202298476 Y:23384925-23384947 GTCTCGCTCTGTCACGCAGGAGG - Intergenic
1202572332 Y:26285674-26285696 GTCTCGCTCTGTCACGCAGGAGG + Intergenic