ID: 969484978

View in Genome Browser
Species Human (GRCh38)
Location 4:7467162-7467184
Sequence AAGTGGTCCCCTGGATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969484968_969484978 24 Left 969484968 4:7467115-7467137 CCCCCAGGCGTTTGGCAGCTGCA 0: 1
1: 0
2: 1
3: 16
4: 144
Right 969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
969484969_969484978 23 Left 969484969 4:7467116-7467138 CCCCAGGCGTTTGGCAGCTGCAG 0: 1
1: 0
2: 0
3: 19
4: 179
Right 969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
969484973_969484978 -4 Left 969484973 4:7467143-7467165 CCTGGCCAGAGCATGCCACAAGT 0: 1
1: 0
2: 3
3: 7
4: 113
Right 969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
969484967_969484978 25 Left 969484967 4:7467114-7467136 CCCCCCAGGCGTTTGGCAGCTGC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
969484971_969484978 21 Left 969484971 4:7467118-7467140 CCAGGCGTTTGGCAGCTGCAGTT 0: 1
1: 0
2: 1
3: 8
4: 145
Right 969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
969484975_969484978 -9 Left 969484975 4:7467148-7467170 CCAGAGCATGCCACAAGTGGTCC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
969484970_969484978 22 Left 969484970 4:7467117-7467139 CCCAGGCGTTTGGCAGCTGCAGT 0: 1
1: 1
2: 1
3: 29
4: 245
Right 969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969484978 Original CRISPR AAGTGGTCCCCTGGATGTCC AGG Intronic
900485271 1:2919844-2919866 AAAAAGTCCCCTGGGTGTCCGGG + Intergenic
900587630 1:3440770-3440792 AAGGGGTCCCCTGCGTGACCTGG - Intergenic
901807734 1:11748796-11748818 CAGGGGTCCCCTGGTTGTCCTGG + Intronic
903447930 1:23434350-23434372 CAGTGGTCACCTGGATGCCAAGG - Exonic
904317294 1:29673727-29673749 AGGTGGGCCCCAGGATGCCCAGG - Intergenic
905919938 1:41712725-41712747 AGCTGGTCCCCTGCATGGCCCGG + Intronic
905998057 1:42399271-42399293 AATTGGCCCCCTGGACATCCTGG - Intronic
906827128 1:48993494-48993516 AAGCACTCCCCTGGCTGTCCTGG + Intronic
907308774 1:53527811-53527833 AAGAGGTCCCCTGGAAGCCTGGG - Intronic
909809960 1:79921130-79921152 AAGTGGTCCCATGCCTTTCCTGG - Intergenic
910216931 1:84852545-84852567 ACGTGCACACCTGGATGTCCTGG - Intronic
915515812 1:156412034-156412056 AAGTGGTCCCCAGGTTCTGCTGG - Intronic
918142758 1:181732684-181732706 AAGGGGTCCTCTGGTTGTCCAGG - Exonic
921251923 1:213306267-213306289 ATGTGATCCTCTGTATGTCCAGG + Intergenic
924613559 1:245592954-245592976 TAGTTGTCCCCTGGATTTCCTGG + Intronic
1071230829 10:83582579-83582601 AAGTGATCACCTGTATGCCCTGG - Intergenic
1071374179 10:84985820-84985842 TAGTGGTCACCTGGATTCCCTGG - Intergenic
1071812731 10:89200748-89200770 AAATGGTCACCTGGATCTGCTGG + Intergenic
1081990168 11:47333304-47333326 AAGTCCTCCCCAGGATCTCCGGG - Exonic
1089398936 11:118153305-118153327 AAGCGGTCCCTTGGCGGTCCTGG - Intergenic
1089605386 11:119638513-119638535 AAGAGGTCCCCTGGGGGCCCTGG + Intronic
1090670081 11:128939958-128939980 GAGTGGCTCCCTGGATATCCCGG - Intronic
1091398914 12:171164-171186 AAGTGGAGCCCTGGTTGCCCAGG + Intronic
1092180988 12:6446704-6446726 AAGAGGTCCCCAAGAGGTCCAGG + Intronic
1097687970 12:62708883-62708905 TAGTAGTCCCCTATATGTCCTGG + Intronic
1098213272 12:68188355-68188377 GAGGGGTCACCTGGATGTCCTGG + Intergenic
1104038383 12:125114183-125114205 CCGTGGTGCCCTTGATGTCCTGG + Intronic
1108641387 13:52385605-52385627 ATGTGGTCCCCTGGCTTTTCTGG + Intronic
1108696910 13:52910379-52910401 CAGTGGTCCCGTGGAGGTCCTGG + Intergenic
1109959559 13:69613030-69613052 AAGTGGTCACCTGAAGGTCAAGG + Intergenic
1110350859 13:74505665-74505687 AAGAGATCCACTGGATCTCCAGG - Intergenic
1113008045 13:105730143-105730165 AAGAGGGACCCTGGCTGTCCAGG + Intergenic
1113984119 13:114300286-114300308 AAGTGGTCCAGTGGCTGTCCTGG - Intronic
1120682881 14:87501861-87501883 AAGTGTTCTCCTGGAAGTCTGGG + Intergenic
1124644430 15:31426990-31427012 TAGTGGTCCCCTGGATTCTCAGG + Intronic
1124885337 15:33680181-33680203 TAGTGCTCAGCTGGATGTCCTGG + Intronic
1126009382 15:44288644-44288666 AAATGGTCCCCTAGACGACCCGG + Intergenic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1139516120 16:67453322-67453344 AGGTGGTGGCCTGGAAGTCCAGG + Intronic
1140856338 16:78981176-78981198 ATGTGGTCTCCATGATGTCCTGG + Intronic
1142172667 16:88630965-88630987 AAGGGGCTCCCTGGATGGCCAGG - Intronic
1149135557 17:53359575-53359597 ATGGAGTCACCTGGATGTCCGGG + Intergenic
1149785053 17:59427575-59427597 AAGTGTTTCCCTGGATTTCCTGG + Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151086819 17:71389719-71389741 GAGTGGTTCCCTGGAAGGCCTGG + Intergenic
1151157060 17:72132517-72132539 AAGTGGTCTCCTTAATGACCTGG - Intergenic
1151478468 17:74356551-74356573 GCCTGGTCCCCTGGATGGCCAGG - Exonic
1157608017 18:48938451-48938473 AAGTGCTCCCATGGATCTCAAGG - Intronic
1160492266 18:79348218-79348240 AAGTCCTCCCCTGGATGAGCTGG - Intronic
1161981495 19:7632635-7632657 AAGTGGTCATCTGGAGGGCCTGG - Intronic
1163058654 19:14741996-14742018 AAGTGATCCCCAAGTTGTCCCGG + Intronic
1164720718 19:30429938-30429960 ATGTGGGCCCCAGGAGGTCCTGG + Intronic
1165159420 19:33807080-33807102 AAGTGGACCCCTGGTTGTCATGG + Intronic
1165347671 19:35259015-35259037 CATTGTTCCCCTGGAGGTCCTGG - Exonic
1168485491 19:56758862-56758884 AAGGGGTCGCCTGGAAGTCAGGG + Intergenic
926320032 2:11743277-11743299 AAGTGGGCCTCTGGATAGCCCGG + Intronic
937115063 2:119398995-119399017 CAGTGCTCGCCTGGATGTCCAGG + Intergenic
937715361 2:125025955-125025977 AGTTGGTACCCTGGATCTCCTGG - Intergenic
938717772 2:134036545-134036567 AAGTGGTTTTCTGGGTGTCCAGG - Intergenic
941567066 2:167122531-167122553 CAGTGTTCACTTGGATGTCCAGG + Intronic
943781228 2:191826063-191826085 AAGTGCCCTCCTTGATGTCCCGG + Intergenic
944272207 2:197796351-197796373 ATGTAAACCCCTGGATGTCCAGG - Intergenic
947144326 2:227050975-227050997 ACCTGGTCACCTGGAAGTCCTGG + Exonic
1170721703 20:18886545-18886567 AACTGGTCCCCTGAATATTCAGG - Intergenic
1173205790 20:40992006-40992028 AACTGGTCCTCTGAAGGTCCTGG - Intergenic
1175059214 20:56226612-56226634 TAGAGGTCACCTGGATTTCCTGG - Intergenic
1175677278 20:60957676-60957698 TAGAGGTACCCTGGAGGTCCAGG + Intergenic
1178901664 21:36604022-36604044 AAGAGGTCCCCTGGGTGTGGTGG - Intergenic
1181884401 22:26008739-26008761 AAGTGGTGCCTGGGCTGTCCAGG + Intronic
1182826032 22:33265563-33265585 AAGTGGTGCCCAGGATGTGATGG - Intronic
1184097638 22:42325227-42325249 CTGTGCTCCCCTGGATGTTCTGG + Intronic
1184332179 22:43834033-43834055 AAGTGGTCACCAGGAAGCCCTGG + Intronic
1185064253 22:48622845-48622867 AACAGGTCCCCTGGAGGTCTCGG + Intronic
950110972 3:10418546-10418568 CAGTGGTCACCTGGATGGCCTGG - Intronic
954793240 3:53148090-53148112 TTGTGGTCCCCTGGGTGTCTGGG - Intergenic
955161789 3:56470375-56470397 AATTGATCCCCTGAATGTCAAGG - Intergenic
956046393 3:65200492-65200514 ATGTGGTCCCCTCGTTGTCATGG + Intergenic
961454682 3:127018104-127018126 CAGTGGTGCCCTGGCTGGCCAGG + Intronic
969265547 4:6061930-6061952 AAGTGTTCTGGTGGATGTCCTGG + Intronic
969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG + Intronic
976482206 4:85557618-85557640 ATGTGTTCACCTGGATGTTCCGG + Intronic
976719820 4:88158823-88158845 AGCTCGTCCCCTGGATGTCCGGG - Exonic
980080569 4:128339899-128339921 TAGTGCTCCCCTGGGTGTCATGG + Intergenic
980442472 4:132867028-132867050 AAGTGCTCCCTTAGCTGTCCTGG - Intergenic
982343937 4:154335215-154335237 AACTGGGCCACAGGATGTCCAGG + Intronic
984158818 4:176226348-176226370 CAGTGGTCCCCTGGATTCTCAGG + Intronic
984431521 4:179655720-179655742 AAGTGGTCAACTAGTTGTCCCGG + Intergenic
984839946 4:184059079-184059101 ACGTGCTCCCCTGCATTTCCTGG + Intergenic
985995551 5:3595380-3595402 AAGATGTCCCCTGGAGGCCCCGG + Intergenic
989385621 5:40852278-40852300 AAGTGGACCCCTGAGAGTCCAGG + Exonic
989536917 5:42574595-42574617 AAGTGCTCCCCAGTATGACCTGG + Intronic
992509239 5:77416862-77416884 AAGTGGTCCCCAAGATGTTGGGG - Intronic
994161841 5:96565641-96565663 CAGTGGTCCCCTGGGTGAGCTGG + Intronic
996844448 5:127883988-127884010 AAAGGGTCCCTTGGCTGTCCAGG + Intergenic
997820203 5:137058759-137058781 GAGTGGCCCCATGGATGTCTGGG + Intronic
999308471 5:150535888-150535910 GAGTGGGCCCCTGGAAGCCCAGG + Intronic
1001822216 5:174719346-174719368 AGGTGTTCTCCTGGATGACCGGG + Intergenic
1007299225 6:40853781-40853803 AAGTGGCTCCCTGGTTGACCTGG + Intergenic
1008888393 6:56456597-56456619 AAGTGCCCCCATGGCTGTCCGGG - Intergenic
1010585089 6:77649246-77649268 AACTGGCCTCCTGGATGTGCTGG + Intergenic
1015379434 6:132549838-132549860 AAGTGGTCCCATAGATGTCGTGG - Intergenic
1015602917 6:134927968-134927990 CAGTGGTCTCCAGAATGTCCAGG - Intronic
1019481437 7:1268674-1268696 AAGAGGGCCACTGGGTGTCCTGG - Intergenic
1021217576 7:17936014-17936036 AAAAGGACCCCTGGATGTTCAGG + Intronic
1022536355 7:31101114-31101136 AAGTGGCCACCGGGATGCCCTGG + Intronic
1022654340 7:32305293-32305315 AAGCTGTGCCCTGGATGCCCAGG - Intergenic
1024119801 7:46225343-46225365 AATGGGTCCCCTGGATTCCCTGG - Intergenic
1032370352 7:131343772-131343794 AAGTGCTGCCCTGTATGCCCCGG - Intronic
1033824980 7:145178552-145178574 CTGTGGGCCCCTGGAGGTCCAGG + Intergenic
1035404665 7:158589123-158589145 AGGTGGTCCCCTGGGCGTCTGGG - Intergenic
1037888375 8:22607159-22607181 ATGGGGTCCCCTGAATTTCCTGG + Intronic
1040493092 8:47942686-47942708 CACTGGTCTCCAGGATGTCCTGG - Intronic
1042537178 8:69870627-69870649 AAGCTGTCCCCTGGTTGTCAGGG - Intergenic
1045560530 8:103257603-103257625 AAGTGGCCACCTGGATGACAGGG - Intergenic
1050339561 9:4622135-4622157 CAGTTGTCCCCTGGCTGTTCCGG - Intronic
1051778273 9:20659557-20659579 AAGTGGTCATCTGCATGTCAAGG + Intronic
1053168237 9:35859708-35859730 AAATGGTCCTCTGGGTTTCCAGG + Intergenic
1057177827 9:93012397-93012419 AAGTGGTCCCCGGCCTGCCCCGG + Intronic
1057624775 9:96667503-96667525 CAGTGGCCACCTGGATGTGCTGG - Intergenic
1060148045 9:121268567-121268589 TGGTGGTCCCCTGCATGCCCGGG - Intronic
1060999019 9:127891854-127891876 GAGTGGTGGCCTGGAAGTCCAGG + Intronic
1062123589 9:134847760-134847782 AAGTGCTCTCCTGGGTGACCAGG + Intergenic
1062393172 9:136342141-136342163 ATGTGCCCCCCAGGATGTCCAGG + Intronic
1186795587 X:13044236-13044258 CAGGGGTCCCCTGGGCGTCCAGG - Intronic
1188926528 X:36051052-36051074 ATGTAATCACCTGGATGTCCAGG + Intronic
1192788461 X:74355960-74355982 AATTGTTCCCCTGGATTTTCTGG - Intergenic
1197061484 X:122186402-122186424 AAGTGATTCCTAGGATGTCCTGG + Intergenic