ID: 969486773

View in Genome Browser
Species Human (GRCh38)
Location 4:7476730-7476752
Sequence CACCTCTCTAAGCAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969486762_969486773 27 Left 969486762 4:7476680-7476702 CCATGCCTCCTGCTAGGAGTCCC 0: 1
1: 0
2: 0
3: 20
4: 229
Right 969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 177
969486765_969486773 7 Left 969486765 4:7476700-7476722 CCCTCTCCAATCATGAACCCTCT 0: 1
1: 0
2: 0
3: 18
4: 186
Right 969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 177
969486766_969486773 6 Left 969486766 4:7476701-7476723 CCTCTCCAATCATGAACCCTCTC 0: 1
1: 0
2: 0
3: 20
4: 163
Right 969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 177
969486764_969486773 19 Left 969486764 4:7476688-7476710 CCTGCTAGGAGTCCCTCTCCAAT 0: 1
1: 0
2: 1
3: 8
4: 111
Right 969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 177
969486767_969486773 1 Left 969486767 4:7476706-7476728 CCAATCATGAACCCTCTCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 172
Right 969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 177
969486768_969486773 -10 Left 969486768 4:7476717-7476739 CCCTCTCTTGCCACACCTCTCTA 0: 1
1: 0
2: 5
3: 36
4: 432
Right 969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 177
969486763_969486773 22 Left 969486763 4:7476685-7476707 CCTCCTGCTAGGAGTCCCTCTCC 0: 1
1: 0
2: 1
3: 11
4: 211
Right 969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969486773 Original CRISPR CACCTCTCTAAGCAGGGACA TGG Intronic
903309504 1:22443391-22443413 AACATCTCAAAGCAGGGGCAAGG + Intergenic
904829620 1:33298460-33298482 CTCCTCTGTAAGCAGGCATAGGG - Intronic
905314529 1:37073525-37073547 CACCTTTATAAGTGGGGACAGGG - Intergenic
906546945 1:46626580-46626602 CACATCTGTTAGGAGGGACATGG + Intergenic
906848956 1:49226940-49226962 CACAGCTATAAGCAGGGAAAGGG - Intronic
907645140 1:56234949-56234971 CAGCTGTCTAAGAAGGGGCAGGG - Intergenic
909112941 1:71503104-71503126 CTACTCTCAAACCAGGGACAAGG + Intronic
913256688 1:116960517-116960539 CACCCTTCTCTGCAGGGACATGG + Intronic
913323890 1:117609751-117609773 CAGCTCTATAAGCAGGCACTGGG - Intronic
920300268 1:204984177-204984199 CAGCTCACTAACCAGGGCCAGGG + Intronic
921690982 1:218149941-218149963 CACCTATCAAAGGAGGGACCTGG - Intergenic
922892298 1:229071450-229071472 CACCGCTCTCAGCAGGGACCAGG - Intergenic
923617927 1:235553085-235553107 CACCTCTCTCCGCAGGGAAGTGG - Intronic
924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG + Intergenic
924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG + Intergenic
1063882507 10:10545457-10545479 CATTTCTCTAAGCAAGGAAAAGG + Intergenic
1067878922 10:50027016-50027038 CATCTCTCTTAGCAGGCTCATGG - Intergenic
1068703217 10:60042749-60042771 CTCCTTTCAAAGCAGGGAGAAGG - Exonic
1070787813 10:79172219-79172241 CACCTGACCAAGCAGGAACATGG + Intronic
1072728927 10:97831705-97831727 CACCTCTCTGAGCGGGGACATGG + Intergenic
1073209396 10:101786919-101786941 CACCACTCTTAGTAGAGACAGGG + Intronic
1074715720 10:116216815-116216837 GACCTAACTAACCAGGGACAAGG + Intronic
1075063802 10:119275270-119275292 CTCCTCTCCAAGCAGTGACCTGG + Intronic
1076117323 10:127909241-127909263 CACCTCTCTTCTCAGGGGCAAGG - Intronic
1076231786 10:128825792-128825814 AACCTCTCTAGGCATGGATATGG + Intergenic
1076303112 10:129442671-129442693 CTCCTCTCTGAGCTGGAACAAGG + Intergenic
1080723725 11:34874378-34874400 CCCCTCTGTAGGCAGGGAAATGG + Intronic
1082744912 11:56950873-56950895 CAACCCTCAAACCAGGGACAAGG + Intergenic
1083013016 11:59422134-59422156 CTACTCCCTAAACAGGGACAAGG - Exonic
1086060264 11:82693093-82693115 CACCTTTGGAAGCAGAGACAAGG - Intergenic
1088830669 11:113533547-113533569 CACCTCTCTCAGGAGGCAGAAGG - Intergenic
1091556113 12:1574544-1574566 CACCTCGGGAGGCAGGGACAAGG + Intronic
1093366837 12:18312438-18312460 CACCTCCCATAGCAGGAACAGGG + Intronic
1100941761 12:99730733-99730755 CATCTCACTAAGCTGGGAAAGGG + Intronic
1101302245 12:103495039-103495061 CAGCTCTAGAAGTAGGGACAGGG + Intronic
1102548480 12:113673978-113674000 CGCCTCCCTAACCAGGGAGAGGG - Intergenic
1102678676 12:114675420-114675442 CATCTCTCTCTGCAGGGACTGGG - Intronic
1106502747 13:30345187-30345209 AACCACTCTAATCAGGGACATGG + Intergenic
1113520067 13:110934284-110934306 CAACCCTCAAACCAGGGACAAGG + Intergenic
1121046632 14:90792988-90793010 CACCTGTCAAAGGAGGGACCTGG + Intronic
1121956065 14:98214594-98214616 CAGGTCTCTAAGCAAGGAAAAGG - Intergenic
1123766564 15:23484924-23484946 CAGGTCTTTAAGCTGGGACATGG - Intergenic
1124136892 15:27042832-27042854 CATCACTCTTAGCAGGGCCAGGG + Intronic
1125500204 15:40235067-40235089 CACCTGTAGAAGGAGGGACAGGG + Intergenic
1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG + Intronic
1129405572 15:75314978-75315000 CCCTTCTCTTAGCAGGGAAAGGG - Intergenic
1131768619 15:95709764-95709786 CACCTGTCTAAGAATGCACAGGG + Intergenic
1132362915 15:101232986-101233008 CACCTCCCAAGGCAGGGAGACGG + Intronic
1134371528 16:13630343-13630365 CTCTTCTCCAAGCAGGGATAAGG - Intergenic
1135193527 16:20375365-20375387 CACCTCTCAAAGAAGTAACAAGG + Intronic
1135682749 16:24472300-24472322 CAGATCTCTAAGGAGGGACGGGG - Intergenic
1137553066 16:49453618-49453640 TACCTCTGTCAGCAGAGACAAGG - Intergenic
1139287870 16:65831615-65831637 CCCCTGGTTAAGCAGGGACAGGG + Intergenic
1141912611 16:87070381-87070403 TCTCTCTCTAACCAGGGACAGGG - Intergenic
1145357186 17:22169556-22169578 CACCTGTCAAAGGAGAGACAAGG - Intergenic
1146449963 17:32965079-32965101 CAACTCTCGAACCAGGGACAAGG + Intergenic
1146626555 17:34439577-34439599 CACCCCTCTCTGCAGGGAAAGGG + Intergenic
1148684579 17:49494539-49494561 CACCTCTCCAGGCATGCACACGG - Intergenic
1151485186 17:74394578-74394600 ACCCTCTCTAAGCAGGGTCTGGG - Intergenic
1152097213 17:78279083-78279105 CACGTCTGAAAGCTGGGACATGG + Intergenic
1152605405 17:81287155-81287177 CACCTCTCCAGGCTGGCACATGG + Intronic
1153824779 18:8865371-8865393 CGCCTCTCTAAGCTTGGAGATGG + Intergenic
1154465162 18:14637280-14637302 CACCTCTTGCAGGAGGGACAAGG + Intergenic
1157209385 18:45728348-45728370 CAACTCCCAAAGCAGGAACATGG - Intronic
1158422096 18:57304253-57304275 CACCTGTCTAACCAGGGAATGGG - Intergenic
1158899648 18:61950739-61950761 CACCTGACTGAGCATGGACAAGG - Intergenic
1160272991 18:77404261-77404283 CACCTCTCAAAACAAGGAAAGGG + Intergenic
1160716470 19:579106-579128 CACGTCCCTGAGCAGGGACCAGG - Intronic
1160845065 19:1162630-1162652 CACCTCACAAAGCTGGGAGAAGG - Intronic
1161216231 19:3096175-3096197 CACCTCTGTAACCCGGGACACGG - Intronic
1164303524 19:23983016-23983038 CACCCCTGTAAGCAGGAACCAGG + Intergenic
1165849337 19:38840297-38840319 CACCTCACTACGAAGGGAGAAGG - Exonic
1166177117 19:41082028-41082050 CACCTGGCCAAGGAGGGACAGGG - Intergenic
1167068715 19:47206597-47206619 CACCTCTCTTACCATAGACAGGG - Intronic
925045762 2:771905-771927 CACCTCTCTGAGCTGGCTCATGG - Intergenic
928369562 2:30731366-30731388 AACCTCTCTAAGGATGGAAAAGG - Exonic
928656609 2:33458592-33458614 CCACTATCTAAACAGGGACAAGG - Intronic
933941582 2:87249447-87249469 CAACTCTCTAGACAGGAACACGG - Intergenic
937614848 2:123909559-123909581 CACCTCTCCCACCAGGGACTAGG + Intergenic
939569777 2:143827097-143827119 CAACCCTCTAAGCAGGGACTTGG - Intergenic
942113661 2:172706925-172706947 CACCTCACCCAGCAGGAACAAGG - Intergenic
943803232 2:192088839-192088861 GACTTCTGTAAGAAGGGACAAGG - Intronic
946188464 2:217994802-217994824 GGCCTCTCTAAGCAGCCACAGGG + Intronic
946451647 2:219785042-219785064 CACGGCCCTAAACAGGGACAGGG - Intergenic
948014218 2:234674569-234674591 CAACTCTCTAAGCAGGAGGAGGG + Intergenic
1171064785 20:22004179-22004201 CACTTCTTCAGGCAGGGACAGGG - Intergenic
1171503488 20:25613441-25613463 CACCTCTGTAAGCAGTGTTAGGG + Exonic
1172225594 20:33303172-33303194 CTCATCACTTAGCAGGGACAGGG + Intronic
1173563413 20:44022169-44022191 CCCCCCTCTCAGCAGGGCCATGG - Intronic
1175300764 20:57941211-57941233 CAACTCATTTAGCAGGGACAAGG - Intergenic
1175371420 20:58495607-58495629 CACCTCACTCAGAAGGGGCAGGG - Intronic
1175436984 20:58959924-58959946 CACCAAGTTAAGCAGGGACAAGG + Intergenic
1175524229 20:59622578-59622600 CACCCCTCGCAGCAGGCACACGG - Intronic
1176809376 21:13521106-13521128 CACCTCTTGCAGGAGGGACAAGG - Intergenic
1178580222 21:33831940-33831962 CACAACTCTAAGCAGGGAGTGGG - Intronic
1180117948 21:45724491-45724513 CACCTCGCTTGGCAGGGGCAGGG - Intronic
1180211602 21:46298112-46298134 CACCGCTCTAGCCAGGGCCACGG + Intergenic
1181349445 22:22244722-22244744 CACCTCTCAGAGCAGGGAGGAGG + Exonic
1182223817 22:28780005-28780027 AACCTCCCTAAGAAGGTACAGGG + Intronic
1183137742 22:35905883-35905905 AACATATCTAAGCATGGACAAGG - Intronic
1183581272 22:38728011-38728033 CACCATTCTGAGCATGGACAAGG + Exonic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1184978857 22:48081856-48081878 TTCCTCTCCAAGCAGGGAGAGGG + Intergenic
1185045104 22:48524806-48524828 CACGTTTCCCAGCAGGGACAGGG - Intronic
950318515 3:12027309-12027331 AAGCTCTCTAGGCAGGGAGATGG - Intronic
951087513 3:18531020-18531042 CACCTCACTATGCAAGGACAGGG - Intergenic
952189631 3:31009096-31009118 CACCTCACTACACAGGGAGATGG - Intergenic
952690079 3:36195172-36195194 CACTTCTATTAGCAGGGGCATGG - Intergenic
953218405 3:40944520-40944542 CACCTCAGTAAGGAGGGAGAGGG + Intergenic
954490039 3:50895472-50895494 TACCTCCCTAAGCATGCACATGG - Intronic
954676131 3:52316385-52316407 CACAGCTCTTAGAAGGGACAAGG - Exonic
955609297 3:60740019-60740041 CACCTCTCTAATCAGATAGAAGG - Intronic
957279618 3:78133725-78133747 AACCTCTCGAAGCATGGAAATGG - Intergenic
961336662 3:126184433-126184455 CACCTCTGAGGGCAGGGACAGGG + Intronic
963938167 3:151075642-151075664 CAGCTCTCTAGGCTGGGACCTGG - Intergenic
967631035 3:191743122-191743144 CAACCCTCAAACCAGGGACAAGG - Intergenic
969122191 4:4918889-4918911 CACCTCTGTGAGCAGAGAGACGG + Intergenic
969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG + Intronic
969601896 4:8181783-8181805 CTCCTCTCTGAGCAGGGAACAGG + Intergenic
969713517 4:8857820-8857842 CACTTCTCTGGGCAGGGGCAAGG - Intronic
970517237 4:16845074-16845096 CACATCTCTAATCTGGGACTGGG - Intronic
971503835 4:27344871-27344893 CAGCATTCTAAGCAGGGAGAGGG - Intergenic
978043726 4:104100481-104100503 CACCTCTCTTGGAAGGGACCTGG + Intergenic
981944921 4:150330494-150330516 CACCCCTCCAAGCAGGTCCATGG - Intronic
983032800 4:162824378-162824400 GACCTCACAAAACAGGGACAAGG - Intergenic
983754310 4:171314986-171315008 CACCTCTCTGAGCAGGTATTTGG + Intergenic
984762617 4:183376252-183376274 CACGTTTATTAGCAGGGACAAGG + Intergenic
985044026 4:185922092-185922114 CACAGCTCTAATCAGGCACATGG + Intronic
985421076 4:189785730-189785752 CACCTCTGTCAGCTGAGACATGG + Intergenic
989686191 5:44090026-44090048 CATTTCTCCAAGCAGGGAAAAGG - Intergenic
990712365 5:58599338-58599360 CACATTTCTGAGCAGGGACCAGG + Intronic
992354249 5:75964452-75964474 CACCTCTGTGTGCAGGGATAGGG + Intergenic
996086479 5:119310441-119310463 CACCTCTCACGGTAGGGACAAGG + Intronic
996273704 5:121639493-121639515 CACTGCTCTAAGGAGGGAGAGGG + Intergenic
996653909 5:125915585-125915607 CAACCCTCAAATCAGGGACACGG + Intergenic
998107517 5:139477707-139477729 CAACTCTGAAATCAGGGACACGG + Intronic
1000102967 5:158034459-158034481 CACATGTCTAGGCAGGGACCTGG + Intergenic
1001541531 5:172543043-172543065 CAGCTCACTCCGCAGGGACAGGG - Intergenic
1002925728 6:1604861-1604883 CACCTCTCAGGACAGGGACAAGG - Intergenic
1003512122 6:6790387-6790409 AACCTCTCTCATCAGGGAGAGGG - Intergenic
1004278517 6:14258987-14259009 CACAGCTCTAAGCAGTGCCAGGG + Intergenic
1008148337 6:47919578-47919600 CCCCTCTCTAAGCACGCTCATGG - Intronic
1011515804 6:88151321-88151343 CATCTCTCTAAGCTAAGACAGGG + Intronic
1014315947 6:119864848-119864870 GACATCTTTAAGCAGGGAGAGGG - Intergenic
1015870291 6:137769353-137769375 CAACTTTCTAAGCAGGGAATAGG + Intergenic
1017128220 6:151085829-151085851 CCCCTCTACAAGCAGGGACCAGG + Intronic
1018616896 6:165695384-165695406 CACCTCCCTGAGCTGGGAGAAGG - Intronic
1018706986 6:166470425-166470447 CACCTGTCTGAGCAGGCTCAGGG - Intronic
1024175934 7:46841233-46841255 CCCATCACTAAGCAGGGGCAGGG - Intergenic
1025787560 7:64657576-64657598 CACCTCTGTTAGCAGGAAGAAGG - Intergenic
1026035134 7:66825169-66825191 CTGCTCTCTGGGCAGGGACAAGG - Intergenic
1026036917 7:66836610-66836632 CTGCTCTCTGGGCAGGGACAAGG - Intergenic
1029205357 7:98866498-98866520 CCCCTCCCTTAGCAGGTACATGG + Intronic
1029445783 7:100612292-100612314 CCCCTCCCTAAGCTCGGACACGG - Intronic
1029601685 7:101567447-101567469 CACCTCAGTAAGCTGAGACATGG - Intergenic
1030740471 7:113103266-113103288 CACCTCTACAACCAGGGAGAGGG - Intergenic
1031033031 7:116755371-116755393 CACCCCTTGAAGGAGGGACAAGG + Exonic
1033034010 7:137854101-137854123 CTCCTCTCTAAGCATGAAGAAGG - Intergenic
1037831225 8:22190796-22190818 TAACTCTCTAAGAAGGTACAAGG + Intronic
1037946495 8:22992906-22992928 CACCTCTGCCAGCAGGGACTAGG + Intronic
1037982140 8:23261808-23261830 CACCTCAGGCAGCAGGGACAGGG - Exonic
1038709437 8:29928011-29928033 GACCCCTCTAAGGAGAGACAGGG + Intergenic
1039546341 8:38413842-38413864 CACCTCCCTGAGCAGGGAGGAGG - Intronic
1040895370 8:52362889-52362911 CACCTCTCTAGTCACTGACAGGG - Intronic
1045489165 8:102656019-102656041 CGCCTCTCTAGGCAGGGGCGGGG - Intergenic
1046913606 8:119656615-119656637 AAGCTCTCTGAGCAGGGACTTGG - Intronic
1047474403 8:125212785-125212807 CACCTCACTAAGGAGGCAGAGGG + Intronic
1049261810 8:141643122-141643144 CAGCTCTCTATGCAGTGACATGG - Intergenic
1053328709 9:37182990-37183012 CCCAACTCTAAGCAGGGTCAGGG + Intronic
1056313421 9:85365919-85365941 AACCTCTGTAAGCAGGAAAATGG - Intergenic
1057233658 9:93341367-93341389 CATCTTTCTCAGAAGGGACACGG + Intronic
1057252185 9:93512624-93512646 CATCTTTCTCAGAAGGGACACGG - Intronic
1057719227 9:97518724-97518746 CAGCTCTCTCAGGAGGGACAGGG + Intronic
1060361244 9:122959651-122959673 CATCTCTCTCAGCTGGGATAGGG - Intronic
1060896439 9:127221125-127221147 CAGCTCTCTAAGCAGGGGCTCGG + Exonic
1062287542 9:135779721-135779743 CATCTCCCTGAGCAGGGACCAGG + Intronic
1062369009 9:136227120-136227142 CACATCACGGAGCAGGGACAAGG + Intronic
1062495923 9:136831653-136831675 CACCTTTCCAGGGAGGGACAGGG + Intronic
1185625702 X:1480508-1480530 CTCCTGTGTAAGCTGGGACATGG + Intronic
1189275897 X:39785954-39785976 CAACTCTCTGAGCAGGGGTAGGG - Intergenic
1191846590 X:65551661-65551683 CACCTCTGTAAGCGGGGCCAGGG - Intergenic
1191951378 X:66597454-66597476 CACCACCCTCAGCAGGGAGAAGG - Exonic
1193633894 X:83924927-83924949 CACCACTCTCAGCAGAGACCTGG - Intergenic
1193649082 X:84108774-84108796 CACCTCACTAGGCAGGGAGCAGG + Intronic
1194785341 X:98077240-98077262 CATCTGTCTAAACAGGGAAAAGG - Intergenic
1197843858 X:130779761-130779783 CAACTCTCTTAGCAGAGATATGG - Intronic
1199201449 X:145094777-145094799 CTACTCTCTTAGCAGAGACAAGG - Intergenic
1199790086 X:151145502-151145524 AACCTCACTAATCAGAGACATGG + Intergenic
1200076782 X:153555160-153555182 CCCCACTCTAAGCTGTGACAGGG - Intronic