ID: 969488766

View in Genome Browser
Species Human (GRCh38)
Location 4:7486810-7486832
Sequence CTCGTGAGGACACATGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969488759_969488766 18 Left 969488759 4:7486769-7486791 CCCTCCCATGGTGTTTTCTTCCT 0: 1
1: 0
2: 5
3: 42
4: 494
Right 969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 102
969488760_969488766 17 Left 969488760 4:7486770-7486792 CCTCCCATGGTGTTTTCTTCCTG 0: 1
1: 0
2: 3
3: 31
4: 400
Right 969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 102
969488757_969488766 30 Left 969488757 4:7486757-7486779 CCTCTACAGCTGCCCTCCCATGG 0: 1
1: 0
2: 1
3: 24
4: 268
Right 969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 102
969488762_969488766 14 Left 969488762 4:7486773-7486795 CCCATGGTGTTTTCTTCCTGGAT 0: 1
1: 0
2: 2
3: 21
4: 269
Right 969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 102
969488764_969488766 -2 Left 969488764 4:7486789-7486811 CCTGGATCATCTCGTCTGTCTCT 0: 1
1: 0
2: 1
3: 13
4: 164
Right 969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 102
969488763_969488766 13 Left 969488763 4:7486774-7486796 CCATGGTGTTTTCTTCCTGGATC 0: 1
1: 1
2: 2
3: 29
4: 328
Right 969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969488766 Original CRISPR CTCGTGAGGACACATGTGCT TGG Intronic
900958543 1:5904597-5904619 CTGGTGAGTACTCATGTGCATGG - Exonic
901233432 1:7653962-7653984 CCCCTTAGGACACAGGTGCTGGG + Intronic
902260570 1:15221870-15221892 CTTGTGAGGACATTTGTGGTTGG - Intergenic
908798392 1:67853878-67853900 CTGGTGAGGACAGAGATGCTGGG - Intergenic
913108989 1:115641501-115641523 CTCGTGAGGGCAAATGGGCTCGG + Intergenic
915550592 1:156631113-156631135 CTCATAAGGACACATGTCGTTGG + Intergenic
922419069 1:225447357-225447379 CCCGTGAGGACACAGGAGCAGGG + Intergenic
1067552581 10:47246023-47246045 CAAGTGAGGGCACATGAGCTGGG + Intergenic
1069680095 10:70278065-70278087 CTGGTGAGGAGACAGATGCTGGG + Intronic
1073526279 10:104185132-104185154 CTATTGAGGAAACATTTGCTTGG - Exonic
1075406524 10:122199252-122199274 CTGGCGAGGACACTGGTGCTTGG - Intronic
1075710987 10:124530388-124530410 CTCGTGAGCACACGTGGGCCCGG - Intronic
1076584049 10:131533313-131533335 CTCATGAGGACACCTGTCATTGG - Intergenic
1076589693 10:131574627-131574649 CTCCAGAGGGCACATCTGCTGGG + Intergenic
1077233737 11:1470084-1470106 TGCGTGTGCACACATGTGCTGGG - Exonic
1081031809 11:38093906-38093928 CTCTTGAGTGTACATGTGCTGGG - Intergenic
1082809621 11:57471553-57471575 CAGGTGAGGAAACATGGGCTGGG + Intronic
1083539267 11:63500903-63500925 GTCCTGAGAACACATGTGCAAGG - Intergenic
1083539416 11:63502047-63502069 GTCCTGAGAACACATGTGCAAGG - Intergenic
1089225496 11:116917236-116917258 CTCATGAGGACACATGACCTTGG + Intronic
1090731041 11:129573691-129573713 CTCTTGGGGACACCTGGGCTTGG + Intergenic
1091728056 12:2859074-2859096 CTGGGGAGGACAGATTTGCTCGG + Exonic
1094466790 12:30762144-30762166 CTCATGAGGACACCAGTCCTTGG - Intergenic
1098851412 12:75600649-75600671 CACCTGATGAAACATGTGCTGGG + Intergenic
1108117369 13:47144365-47144387 CTCCTGTGGACTCATGTGCCTGG + Intergenic
1113749111 13:112766387-112766409 CTCCTTTGGACACCTGTGCTGGG + Intronic
1115799540 14:36976959-36976981 CTCCTGAGTACACCTGTGTTCGG - Intronic
1117775933 14:59184539-59184561 CTTGTGAAGACACATGTGGTGGG + Intergenic
1121981351 14:98457234-98457256 CACGTGCTGACACCTGTGCTGGG + Intergenic
1123033415 14:105461758-105461780 CTCCTGAGGACGCATCTGCTGGG + Intronic
1129264823 15:74387949-74387971 CTCGGGTGGACACATTTCCTTGG - Intergenic
1130130244 15:81134751-81134773 CAGGTGAGGACACAGGTTCTAGG + Intronic
1131770313 15:95729678-95729700 CAAGGGAGGACACATGAGCTTGG - Intergenic
1135826692 16:25734909-25734931 CTCCTGGGGACACCTGTGCCAGG + Intronic
1137666073 16:50249820-50249842 CTCCTGTGCACACATGGGCTGGG - Intronic
1145086773 17:19949090-19949112 ATCAAGAGGACACATATGCTGGG + Intronic
1146000362 17:29126932-29126954 CTCTTGAGGAGCCCTGTGCTTGG - Intronic
1150100112 17:62415847-62415869 CTCGTGAGGACGTGTGAGCTAGG - Intronic
1151999242 17:77635029-77635051 CTCATGAGGACACTTGTTATTGG + Intergenic
1152613100 17:81325177-81325199 CTTCTGAGGACACATGTCATTGG + Intronic
1152911056 17:83004925-83004947 CCCCAGCGGACACATGTGCTAGG - Intronic
1156269729 18:35519711-35519733 CTTGTGAGGTCAGATGGGCTGGG + Intergenic
1158488615 18:57890364-57890386 CTTGAGAGGATATATGTGCTTGG - Intergenic
1160179080 18:76618871-76618893 GTCGTGAGAACCCATGGGCTGGG + Intergenic
1160932723 19:1578258-1578280 CTGGTGAACACAGATGTGCTTGG - Intronic
1161226609 19:3149887-3149909 CTGCAGAGGGCACATGTGCTCGG - Intronic
1167680831 19:50919619-50919641 CACGTGAGGTCACATATGCACGG + Intergenic
926105000 2:10144539-10144561 ATCGTGAGGTCACATGTGTTTGG - Intronic
927667818 2:25044312-25044334 CTGGTGAGGACTCAACTGCTTGG + Intronic
928810571 2:35219471-35219493 CTCGTGTTGTCACCTGTGCTGGG + Intergenic
928854171 2:35784339-35784361 CTTGTTAGGACACTTGTGCTTGG + Intergenic
933788053 2:85859556-85859578 CACCTGAGGACACCTATGCTGGG + Intronic
936158880 2:110069319-110069341 CACATGTGGATACATGTGCTTGG - Intergenic
936185780 2:110302013-110302035 CACATGTGGATACATGTGCTTGG + Intergenic
936254096 2:110894622-110894644 CTCCTGAAGCCACAGGTGCTAGG - Intronic
938381588 2:130839224-130839246 CCCGTGAGGACACAGGTTGTGGG + Intronic
938900364 2:135794412-135794434 CCCATTAGGGCACATGTGCTTGG - Intronic
942209101 2:173652666-173652688 CTCCAGAGGATACATTTGCTGGG - Intergenic
947629534 2:231643098-231643120 CTCCGGAGCACACTTGTGCTCGG - Intergenic
1169035691 20:2450071-2450093 CTCAAGAATACACATGTGCTAGG - Intergenic
1169385641 20:5147098-5147120 CTCCTGAGGGGTCATGTGCTTGG + Intronic
1169530055 20:6475476-6475498 CTCATGAAGACACAGGAGCTGGG + Intergenic
1172432944 20:34907649-34907671 CATATGGGGACACATGTGCTTGG + Intronic
1173728253 20:45311784-45311806 CTCGGGAGGACGCAGGTGCCAGG - Intronic
1174270647 20:49365877-49365899 CTCATGAGGGCACAGGAGCTGGG + Exonic
1174659730 20:52201268-52201290 TTGTTGAGGACACATATGCTTGG + Intronic
1178521080 21:33289053-33289075 CTCGAGAGGCCACATGGGATTGG - Intronic
1181181646 22:21072848-21072870 CTCTAGAGGACAAATGTGCTTGG + Intergenic
1182355156 22:29719641-29719663 TTCTTGAGGACCCAGGTGCTTGG + Intergenic
1185227530 22:49661376-49661398 CTGGTGAGGAGGCATGTGCTCGG - Intergenic
950407402 3:12813251-12813273 CACGTGAGGACCCATTTCCTTGG - Exonic
955531326 3:59875893-59875915 ATCCTGAGGGCATATGTGCTTGG - Intronic
957447911 3:80338810-80338832 CCCCTGAGGACATATCTGCTGGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961644009 3:128382895-128382917 CTTGTGTGGACAAATGAGCTGGG - Intronic
962237410 3:133718332-133718354 CTGGTGAGGACATGTTTGCTGGG + Intergenic
965365005 3:167787420-167787442 CTCGTGGTGACGCATGTGATAGG - Intronic
967470933 3:189861196-189861218 GTAGTGAAGACACATGTGGTCGG - Intronic
969242331 4:5908166-5908188 CCCTTGAGGACACATGTGTCTGG - Intronic
969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG + Intronic
972846844 4:43001544-43001566 CTCGTAAAAACACATGTCCTCGG + Intronic
985532756 5:443486-443508 CTGGGGGGGACACATGTGCCGGG - Intronic
986622569 5:9691164-9691186 CTTATGAGGACACATGTGACCGG - Intronic
988861700 5:35287834-35287856 CTTTTGAGGACACATGTCATTGG + Intergenic
989183644 5:38602388-38602410 GTAGTGAGCACACATGTGCAAGG - Intronic
994200198 5:96965640-96965662 CTGGTGAGAGCATATGTGCTTGG + Intronic
1005392140 6:25344479-25344501 CCCATGAGGCCAAATGTGCTTGG + Intronic
1005947328 6:30603939-30603961 CTCCTGAGGGAACATGAGCTGGG - Intronic
1007916385 6:45565439-45565461 CCCTTGAGGTCACATGTTCTGGG + Intronic
1009240446 6:61179807-61179829 CTCCTGTGAACACATGTGCATGG - Intergenic
1012612031 6:101229249-101229271 CTCTTGGGGACACATGAGCCTGG + Intergenic
1014758630 6:125329835-125329857 ATCTAGTGGACACATGTGCTTGG + Intergenic
1017033823 6:150249340-150249362 CTCTTGAAAACACATGTGCTGGG - Exonic
1019207181 6:170371724-170371746 CTCCTGAAGACTCACGTGCTAGG - Intronic
1019430099 7:995135-995157 CACGTCGGGCCACATGTGCTGGG - Intergenic
1024198231 7:47081097-47081119 ATCATGATGACACATGAGCTTGG + Intergenic
1026601785 7:71783533-71783555 CACGTGTGGTCACATGTCCTGGG - Exonic
1029930155 7:104362380-104362402 GTTTTGAGGTCACATGTGCTAGG + Intronic
1031687140 7:124744905-124744927 CTCAAGAGGACACCTGAGCTAGG - Intergenic
1032029243 7:128468689-128468711 CTCGTGAGGACATGTGAGCTAGG - Intergenic
1042111245 8:65383359-65383381 CTTGAGAGGACATATGTGCCAGG - Intergenic
1042523003 8:69734123-69734145 CACTTGAGGACACTTGTGCCTGG - Intronic
1048327100 8:133448326-133448348 CTCCAGGGGACAGATGTGCTGGG - Intergenic
1050272953 9:3965619-3965641 CTCCTGACGAAACATGTGCATGG + Intronic
1053273149 9:36763663-36763685 CTCAGGGGGCCACATGTGCTGGG + Intergenic
1057393139 9:94655767-94655789 CTTGTGAGGACACTTGTAATTGG - Intergenic
1059653418 9:116335566-116335588 CTCATGAGGTCACAGGAGCTAGG - Intronic
1059699681 9:116763250-116763272 CTGTTTTGGACACATGTGCTAGG + Intronic
1060005232 9:119993647-119993669 CTGGTGAACACACATGTGCATGG - Intergenic
1062070994 9:134554903-134554925 CTCCTGAGGACAAGCGTGCTGGG + Intergenic
1185670148 X:1802486-1802508 CTTGTGAGGACACCTGTCATTGG - Intergenic
1188703691 X:33299522-33299544 CTAGTGAGGAAAGATGGGCTAGG + Intronic
1189774592 X:44459255-44459277 CTCTCGGGGACACATGTGGTGGG - Intergenic
1191217675 X:57950884-57950906 CTGGTGAGGACACATCTTCTTGG - Intergenic