ID: 969488866

View in Genome Browser
Species Human (GRCh38)
Location 4:7487373-7487395
Sequence ATAAGGCTGTGACTCCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969488862_969488866 3 Left 969488862 4:7487347-7487369 CCTACAGCAGAAGGGGTGGCTCC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 969488866 4:7487373-7487395 ATAAGGCTGTGACTCCCTGTTGG 0: 1
1: 0
2: 2
3: 11
4: 152
969488860_969488866 7 Left 969488860 4:7487343-7487365 CCATCCTACAGCAGAAGGGGTGG 0: 1
1: 1
2: 0
3: 34
4: 188
Right 969488866 4:7487373-7487395 ATAAGGCTGTGACTCCCTGTTGG 0: 1
1: 0
2: 2
3: 11
4: 152
969488859_969488866 8 Left 969488859 4:7487342-7487364 CCCATCCTACAGCAGAAGGGGTG 0: 1
1: 0
2: 0
3: 15
4: 142
Right 969488866 4:7487373-7487395 ATAAGGCTGTGACTCCCTGTTGG 0: 1
1: 0
2: 2
3: 11
4: 152
969488858_969488866 9 Left 969488858 4:7487341-7487363 CCCCATCCTACAGCAGAAGGGGT 0: 1
1: 0
2: 3
3: 8
4: 138
Right 969488866 4:7487373-7487395 ATAAGGCTGTGACTCCCTGTTGG 0: 1
1: 0
2: 2
3: 11
4: 152
969488854_969488866 29 Left 969488854 4:7487321-7487343 CCTGAAGTGGGCTGTGTTATCCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 969488866 4:7487373-7487395 ATAAGGCTGTGACTCCCTGTTGG 0: 1
1: 0
2: 2
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969488866 Original CRISPR ATAAGGCTGTGACTCCCTGT TGG Intronic
900075353 1:811649-811671 ACATGGCTGTGGCTCCCTGGGGG + Intergenic
900572243 1:3364397-3364419 AAGAGGCTGTGGCTCCTTGTCGG - Intronic
901808843 1:11754460-11754482 AGAAGGCAGTGACCTCCTGTGGG - Intronic
901965784 1:12864603-12864625 CCAGGGCTGTGACTCCCTTTTGG + Intronic
901981184 1:13034980-13035002 CCAGGGCTGTGACTCCCTTTTGG + Intronic
902000902 1:13193949-13193971 CCAGGGCTGTGACTCCCTTTTGG - Intergenic
902020133 1:13339653-13339675 CCAGGGCTGTGACTCCCTTTTGG - Intergenic
902559761 1:17270193-17270215 GGGTGGCTGTGACTCCCTGTGGG - Intronic
902891027 1:19443816-19443838 AGAAGGCTTTGAGTCCCTCTTGG - Intronic
904285233 1:29449679-29449701 ATGGGGCGGTGAATCCCTGTTGG + Intergenic
912644875 1:111383219-111383241 ATAAGGTGGGGAGTCCCTGTGGG - Intergenic
917437713 1:175038020-175038042 ATCAGGCTGTGACTCCCACTTGG + Intergenic
918737223 1:188080134-188080156 ATAAGGCAGTGACTGCCGGATGG + Intergenic
919806130 1:201381995-201382017 ACAGGGCTCTGACTCCTTGTGGG - Intronic
920023593 1:202975333-202975355 TTAAGACAGTGACTCCCTCTGGG - Intergenic
920447291 1:206028069-206028091 AAAAGGTTATGACTCCCTGAAGG + Intergenic
922271194 1:224036526-224036548 ACATGGCTGTGGCTCCCTGGGGG + Intergenic
1065469071 10:26057899-26057921 AGAAGGCTGTGCCTACCTGGGGG - Intronic
1068016389 10:51521874-51521896 ATAAGGCTGTGAAATCCTTTAGG + Intronic
1068546831 10:58356685-58356707 ATAAGCATGTCACTCACTGTTGG - Intronic
1070939101 10:80327524-80327546 ATAATGCTGGGAATGCCTGTAGG - Intergenic
1071263761 10:83945432-83945454 ATGAGGCTGTGTCTTCCTGCTGG - Intergenic
1071488134 10:86116779-86116801 ATAAGGCTTGGGTTCCCTGTTGG - Intronic
1071630725 10:87216452-87216474 ACAAGCCTGTCCCTCCCTGTTGG + Intergenic
1078884774 11:15489450-15489472 ATGATGCTGTGACTCCCTCTTGG - Intergenic
1081165743 11:39807706-39807728 ATAAGGTTGTGAACCCCTGATGG + Intergenic
1081592257 11:44432435-44432457 CAAAGGCTGTTACTCTCTGTAGG + Intergenic
1083780395 11:64914546-64914568 ATAAGGCTGTGCCAGCCTGTGGG - Intronic
1084506868 11:69573981-69574003 AAAAGACTGTGAATCGCTGTTGG - Intergenic
1086524739 11:87711881-87711903 ATAAAGCTGTGGCATCCTGTGGG + Intergenic
1087987121 11:104696412-104696434 AGAAGGCTAGGTCTCCCTGTAGG - Intergenic
1090175181 11:124642606-124642628 ATAAGGATGCGGCTCCCTGTGGG - Intronic
1092238230 12:6822652-6822674 ATAAGGTGCTGACTCCCCGTGGG - Intronic
1096608493 12:52785080-52785102 CTAATGCTGTGACTCTCAGTGGG - Intergenic
1096828007 12:54294278-54294300 AAAAGGCTTTGACTTCCTGAAGG - Intronic
1097238204 12:57554126-57554148 ATAAGGCTCTGACACAGTGTTGG + Intronic
1097866907 12:64566734-64566756 TTAAGGCTGAGTCTCACTGTGGG - Intergenic
1098494047 12:71114362-71114384 ATCAGGCTCTGACTCCTTGCCGG - Intronic
1099734688 12:86551638-86551660 ATAAGGCTGTTACTCTGGGTGGG - Intronic
1101433509 12:104645855-104645877 ATTAGGGTGTGGCTCCCAGTGGG + Intronic
1101480879 12:105095726-105095748 ATAAGGTTCTGACTGCCTGTGGG - Intergenic
1104420592 12:128631408-128631430 AAGAGACTGTGACTCCCTGCAGG - Intronic
1107985579 13:45773344-45773366 ATAAGGCTGTGTATTGCTGTTGG + Intergenic
1108549982 13:51534298-51534320 AAAAGGTGGTGACTTCCTGTGGG - Intergenic
1111128874 13:83948589-83948611 ATAAGGCTTTGTCTCCCTTGGGG + Intergenic
1112913820 13:104522402-104522424 ATCAGGCGGGGACTCTCTGTGGG - Intergenic
1113026634 13:105948023-105948045 ATACAGCTATGACTCACTGTGGG - Intergenic
1115276736 14:31617881-31617903 ATTAGGCTGTGAATCCATCTGGG + Intronic
1119718227 14:76873716-76873738 ATACAGCTGTGGCTCCCTGAGGG + Intergenic
1121284445 14:92724373-92724395 ATCAGGCTGTGACTCTCTTCTGG + Intronic
1122757523 14:103994080-103994102 ACACAGCAGTGACTCCCTGTGGG - Intronic
1124424447 15:29551964-29551986 AAAATGCTGTGACTCCCTGCTGG + Intronic
1125305837 15:38312436-38312458 ATATGGCTCTGACTCCTGGTAGG - Intronic
1126306669 15:47266508-47266530 ATAAGGCAGTGGTTCCATGTTGG - Intronic
1129665995 15:77579657-77579679 ATCAGGCTGTGGCTGCCTCTGGG + Intergenic
1130333410 15:82938786-82938808 CTGAGACTGAGACTCCCTGTGGG - Intronic
1133369552 16:5237710-5237732 AAAAGGCTGTGTATTCCTGTGGG + Intergenic
1138893833 16:61178662-61178684 ACAAGTCTGTGACTCACTGGGGG + Intergenic
1140697355 16:77548350-77548372 ATTGGGCTGTGAGTCCCTGGGGG - Intergenic
1144044491 17:11442726-11442748 ATAAAGCTCTCACTACCTGTGGG + Intronic
1144390053 17:14784882-14784904 ACAGGGCTGTGACACCCTTTTGG + Intergenic
1144957954 17:19028994-19029016 AGAAGGCCCTGACTCCCTGTTGG + Intronic
1144977204 17:19145526-19145548 AGAAGGCCCTGACTCCCTGTTGG - Intronic
1147154924 17:38539639-38539661 AGGAGGCTGTGACTCCCTGGGGG - Intronic
1148846324 17:50532310-50532332 AGAAGGATCTGACTCCGTGTGGG + Intergenic
1152310641 17:79547837-79547859 CTAAGGCTGTGAATCGGTGTGGG - Intergenic
1154127411 18:11704159-11704181 AGAAGGCTGTGACTCACTGTGGG - Intronic
1155431972 18:25769001-25769023 ATAGGTCTGTTTCTCCCTGTAGG + Intergenic
1156428968 18:37049734-37049756 ATAAGGCTGTGATTCACCTTGGG + Intronic
1157191043 18:45581827-45581849 ATCAGGCTGTGATTCTCTTTGGG - Intronic
1158373428 18:56834355-56834377 ATAACGATGTGACTCACTGGGGG + Intronic
1163929154 19:20372081-20372103 TTAAGGTTTAGACTCCCTGTTGG - Intergenic
1164779543 19:30881410-30881432 ATAAGGGTGTGACTCCCTTTGGG + Intergenic
1167390174 19:49189741-49189763 ATGAGGATGGGACTTCCTGTTGG - Intronic
1168681394 19:58318491-58318513 AGATGGCTGTGGCTGCCTGTGGG - Intergenic
925109721 2:1323496-1323518 ACATGGCTGAGACCCCCTGTAGG + Intronic
925109740 2:1323583-1323605 ACATGGCTGAGACCCCCTGTAGG + Intronic
928210782 2:29322103-29322125 AGAAGCCTGTGTCTCCATGTGGG + Intronic
930705114 2:54497435-54497457 ATAAAGAGGTGACTCCCTGGTGG - Intronic
933957430 2:87382974-87382996 AGAAGGCTGTAAGTCCCTTTGGG - Intergenic
934241547 2:90274870-90274892 AGAAGGCTGTAAGTCCCTTTGGG - Intergenic
934271627 2:91541814-91541836 AGAAGGCTGTAAGTCCCTTTGGG + Intergenic
935938726 2:108216072-108216094 ACAAGGATGTGTCTCCCTGGAGG - Intergenic
937087572 2:119181522-119181544 AGAAGGGAGTGACTCCCAGTTGG - Intergenic
937572052 2:123375944-123375966 AAAAAGCTGTCACTACCTGTAGG + Intergenic
938679302 2:133673116-133673138 ATAAGGCTGTGACCTCATGTGGG - Intergenic
938839486 2:135145491-135145513 ATCATGCTGTGACTCCTTATAGG - Intronic
940500672 2:154489787-154489809 ATTCTGCTCTGACTCCCTGTTGG + Intergenic
941001221 2:160205455-160205477 AGGGGGCTGTGACTCCATGTGGG + Intronic
942307035 2:174618772-174618794 CTCAGTCTGTGCCTCCCTGTGGG + Intronic
947367785 2:229414708-229414730 ACAAGGGTGTGACTCCCTAGGGG - Intronic
947461447 2:230307464-230307486 CCAGGGCTGTGACTCCCTTTTGG + Intronic
948671044 2:239569129-239569151 CCAAGGCTGAGACTCCCAGTGGG - Intergenic
949082369 2:242113146-242113168 ACATGGCTGTGGCTCCCTGGGGG - Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1172480945 20:35271093-35271115 GTGAGGCTAGGACTCCCTGTTGG + Intronic
1174914138 20:54637591-54637613 ACATGGCTGTGACTGACTGTGGG - Intronic
1175375228 20:58519505-58519527 ATGAAGCTGTGCCACCCTGTAGG + Intergenic
1175405460 20:58723090-58723112 GTAAGCCTGTGGCTCTCTGTGGG - Intergenic
1176901944 21:14452947-14452969 AGAAGGCTGTGATTCTCTCTCGG + Intergenic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1178565989 21:33685785-33685807 ATAAAGCTGTCAGTTCCTGTTGG + Intronic
1178750719 21:35300431-35300453 ATAAGACTGTGACTGCCAGAAGG - Intronic
1180902779 22:19386677-19386699 GTCAGGCTGGGACTCCATGTTGG - Intronic
1181758466 22:25041436-25041458 GTAAGGCTGGGCCTCCCTTTGGG - Exonic
1181934927 22:26431350-26431372 AAAAGGCTATGACTCACTGGAGG - Intronic
1183557710 22:38544020-38544042 AAAAGGGTGTGACTCACTGATGG - Intronic
1184477235 22:44728427-44728449 ATTGGGCTGTGAGTCCCTGAAGG - Intronic
1185136529 22:49076526-49076548 TTAAGGCTCTGAGTCTCTGTGGG + Intergenic
950302662 3:11894870-11894892 ATTTGGCCGTGACTCCCAGTAGG + Intergenic
951917154 3:27813706-27813728 AGAAGGCTGGGACTGCCTGCAGG + Intergenic
954013109 3:47660752-47660774 ATAAGTATGTGACTTCCTATTGG + Intronic
956803234 3:72782630-72782652 TTAAGGCAGCAACTCCCTGTTGG + Intronic
960302088 3:116015453-116015475 ATAATCCTGTGACTCCCAGAGGG - Intronic
960587243 3:119331477-119331499 ATAAAACTCTGACTCCATGTTGG + Intronic
962896412 3:139718823-139718845 CTAAGGCTGTGGTTCTCTGTGGG - Intergenic
968519959 4:1030750-1030772 CCAAGGCTGGGGCTCCCTGTGGG + Intergenic
968798023 4:2722090-2722112 CTAGGGCTGTGACTACCTCTTGG + Intronic
969423784 4:7112042-7112064 TTACAGCTGTGACTCCCTGCTGG - Intergenic
969488866 4:7487373-7487395 ATAAGGCTGTGACTCCCTGTTGG + Intronic
973243966 4:47990188-47990210 ATAAAGGTCTGACTGCCTGTGGG + Intronic
974816814 4:67015495-67015517 AAAAGACTGTGACTCACTGAAGG - Intergenic
976220921 4:82756341-82756363 ACACGGCTGTGAGTCCCAGTTGG + Intronic
977261584 4:94803167-94803189 ATCTGGCTGTGACTCCCATTTGG + Intronic
978343340 4:107739982-107740004 TTGTGGCTGTGGCTCCCTGTGGG + Intergenic
980290423 4:130843485-130843507 CACAGGCTTTGACTCCCTGTCGG + Intergenic
983343495 4:166497308-166497330 AAAAGCCTGTGAGTCCCTGAAGG - Intergenic
983415705 4:167450704-167450726 ATAAGCCTGTGACAGCCTATAGG - Intergenic
986360936 5:6977579-6977601 AAAAGGCTGTGTCTCAGTGTGGG + Intergenic
989549876 5:42722059-42722081 CTTAGGCTGTGACTCCCCATAGG + Intergenic
990049033 5:51472187-51472209 GTCAGACTGAGACTCCCTGTTGG - Intergenic
993883252 5:93387698-93387720 AGCAGGATGTGACTGCCTGTGGG - Intergenic
1000891920 5:166810929-166810951 CTAAGGCTGTGCCACTCTGTAGG + Intergenic
1004249820 6:14014662-14014684 AGAAGGCTGGGAGTCCCAGTGGG - Intergenic
1008495400 6:52128340-52128362 ACAAGGCTGTGAATACCTGAAGG + Intergenic
1010588934 6:77689988-77690010 TTAAGACTGTGACACACTGTTGG + Intergenic
1010767946 6:79797645-79797667 GGATGCCTGTGACTCCCTGTAGG + Intergenic
1012832522 6:104223133-104223155 TTAAAGCAGTGACTTCCTGTTGG - Intergenic
1016602956 6:145883483-145883505 ATAAGGCTTGAACTCCCTTTGGG + Intronic
1019895970 7:3983439-3983461 AAAAGACTGTGACTCACTGAAGG + Intronic
1021115995 7:16747320-16747342 ATCTGGCTTGGACTCCCTGTTGG + Intergenic
1021664876 7:22967165-22967187 ATTAGATTGTGAGTCCCTGTGGG - Intronic
1023682427 7:42701200-42701222 GTCTGGCTGTGACTCCCTTTGGG - Intergenic
1027779760 7:82507084-82507106 ACAGGGCTGTGACTCCTTTTGGG - Intergenic
1035540290 8:429872-429894 AGATGGCTGTGGCTCCCTGGGGG - Intronic
1038124142 8:24652433-24652455 AAATGGCTGTGACTTCATGTTGG - Intergenic
1038197589 8:25382455-25382477 GGAAGGCTGTGACTCCCTGAGGG - Intronic
1038901499 8:31849470-31849492 ATAAACCTGTGACTCACTCTTGG + Intronic
1046941369 8:119934556-119934578 ATAAGGCTGGGACCCACTGCTGG + Intronic
1047216272 8:122878646-122878668 ACATGGCTGAGAGTCCCTGTAGG + Intronic
1051515031 9:17920938-17920960 ATAATGCTGTGCCTTGCTGTGGG + Intergenic
1051585455 9:18722217-18722239 TCAAGGCTGTGACTCAATGTTGG - Intronic
1055572673 9:77632596-77632618 CCAGGGCTGTGACTCCCTTTGGG + Intronic
1057710467 9:97437567-97437589 ACAAGGCTGTGAATACCTGGAGG + Intronic
1058351035 9:104024351-104024373 ATAAGGCTATTTCTCCATGTTGG + Intergenic
1062280208 9:135748535-135748557 AGGAGGCTGTGACACCCAGTGGG - Intronic
1186644300 X:11490077-11490099 ATAAGGGTGTGATTCACTGGAGG - Intronic
1188378456 X:29462571-29462593 TAGAGGCTGTGACTCCCTGGAGG - Intronic
1188748474 X:33875837-33875859 AGAATGCTGTGAATCCCAGTGGG + Intergenic
1192370003 X:70505288-70505310 TTAAGGGTGTGTCTCCCTTTGGG - Exonic
1193725327 X:85031977-85031999 ATTAGGCTGTATCTCCCTGGTGG - Intronic
1195377670 X:104243748-104243770 GTGTGACTGTGACTCCCTGTTGG + Intergenic
1198666635 X:139031329-139031351 ATAATGCTGAGATTCTCTGTTGG - Intronic
1202243304 Y:22791892-22791914 AACAGGCTTTGACTACCTGTTGG - Intergenic
1202396291 Y:24425642-24425664 AACAGGCTTTGACTACCTGTTGG - Intergenic
1202474493 Y:25244450-25244472 AACAGGCTTTGACTACCTGTTGG + Intergenic