ID: 969490967

View in Genome Browser
Species Human (GRCh38)
Location 4:7499002-7499024
Sequence GGGGGCAGCACCGTGGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969490957_969490967 4 Left 969490957 4:7498975-7498997 CCGGCTGAGGCTGGGGAAAGGGG 0: 1
1: 2
2: 4
3: 54
4: 560
Right 969490967 4:7499002-7499024 GGGGGCAGCACCGTGGAGACGGG 0: 1
1: 0
2: 0
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969490967 Original CRISPR GGGGGCAGCACCGTGGAGAC GGG Intronic
901079730 1:6577111-6577133 GGGGGCTGCACGGTGGAGGGAGG + Intronic
902214351 1:14924781-14924803 GGGGGCTGCACCGGGGGGCCAGG + Intronic
902323660 1:15684547-15684569 GGTGGCAGCGCCATGGAGCCGGG + Exonic
902698759 1:18157483-18157505 GTGGGCTGCAGCGTGGAGGCAGG - Intronic
905168378 1:36096834-36096856 GGGGGCAGCCCGGGAGAGACAGG + Exonic
905202682 1:36324449-36324471 TGGGGGGGCCCCGTGGAGACAGG - Intronic
907518486 1:55008222-55008244 GGGGGCAGGGCCCTGGGGACAGG - Exonic
907523519 1:55040223-55040245 GTGGGGAGCACGGTGGAGAGCGG + Intronic
908510465 1:64846770-64846792 GGGAGCAGCCCCCTGGAGGCTGG - Intronic
914984182 1:152442107-152442129 GGGGGCAGCACCTGGGGGCCAGG + Intergenic
915038531 1:152948647-152948669 GGGGGCAGCACTGTTGAGGCGGG - Intergenic
916056884 1:161074129-161074151 TGGGCCAGGACCGAGGAGACTGG - Intronic
918870932 1:189973622-189973644 GGTGGCAGCACCTTGGAAAATGG + Intergenic
920100341 1:203513447-203513469 TGGGGCTGCACTGTGGAGACTGG + Intergenic
920305363 1:205015024-205015046 TGGGGCAGCACTGTGGGGAGTGG + Intronic
920677994 1:208051607-208051629 GGAGGCAGCAAATTGGAGACGGG + Intronic
920758131 1:208755035-208755057 GGAGGCAGCAGCATGGAGTCGGG - Intergenic
922682785 1:227614694-227614716 TGAGGCAGCACCTTGCAGACTGG - Intronic
923818079 1:237402904-237402926 GGGGGAAGGAGGGTGGAGACAGG - Intronic
1066658137 10:37713334-37713356 TGGGGCAGCACCTTGGAAGCTGG + Intergenic
1067042623 10:42962993-42963015 TGGGGCAGCACCTTGGAAGCTGG + Intergenic
1067044046 10:42974616-42974638 GGAGGCAGCAGCAGGGAGACTGG + Intergenic
1067294449 10:44967238-44967260 TGGGTCACCACGGTGGAGACAGG + Intronic
1067706149 10:48607745-48607767 AGGGGCAGCACCGTGCAGGCAGG - Intronic
1069718272 10:70534412-70534434 GGGGGCAGCCCTGTCGAGGCAGG - Exonic
1069839625 10:71331281-71331303 GGGAGCAGCATCGTGGAGGATGG + Intronic
1070471941 10:76789327-76789349 TGGGGTAGCACAGTGGAGAAAGG + Intergenic
1070570928 10:77638659-77638681 GGGCGCAGCACCTTGGAGAGAGG - Intergenic
1070577894 10:77693576-77693598 TGGGGCAGGACAGTGGAGCCTGG + Intergenic
1072630292 10:97140718-97140740 GGGGGCAGCCCAGGGGAGAACGG + Intronic
1074912501 10:117924407-117924429 GGGGGCAGCCACATGGAGTCTGG + Intergenic
1075055522 10:119215536-119215558 GGGGGCTGCACCATGGAGGAGGG + Intronic
1075382591 10:122031306-122031328 GGGGGCACCTCCCTGGACACTGG - Intronic
1075388252 10:122073290-122073312 GGGGGTCTCACCATGGAGACGGG + Intronic
1075463212 10:122632337-122632359 AGGGGCTGCACAGTGGAGAATGG - Intronic
1076433996 10:130427150-130427172 ACGGGCAGCACAGTGGAGAAGGG + Intergenic
1076696602 10:132250199-132250221 GGGGACAGCACCCTGAGGACAGG + Intronic
1076797244 10:132804169-132804191 GGGGACAGGGCCGTGGGGACAGG - Intergenic
1076797272 10:132804239-132804261 GGGGACAGGGCCGTGGGGACAGG - Intergenic
1076843199 10:133056702-133056724 GGGGGCAGCCACGTGGCCACGGG + Intergenic
1077093180 11:788693-788715 CGGGGCAGCACAGGGGGGACTGG - Intronic
1077142600 11:1031072-1031094 GGGGTCAGCACCGTGGGGGCTGG + Intronic
1077317443 11:1925712-1925734 GGGGGCAGAACCCTGCAGCCTGG + Intronic
1078017939 11:7631221-7631243 GGAGGCAGCATGGTGGATACTGG + Intronic
1079083637 11:17430439-17430461 TGGGGCAGCCACGTGGGGACGGG + Intronic
1079117800 11:17651747-17651769 GTGGGCAGAACCGGGGAGCCAGG + Intergenic
1081567831 11:44270688-44270710 TGGGGCTGCACAGTGGAGACAGG - Intronic
1081867683 11:46368522-46368544 GGAGGCAGCACTGGGCAGACGGG + Intronic
1083197433 11:61096965-61096987 GGGGGGTGTTCCGTGGAGACTGG - Intergenic
1083772705 11:64877503-64877525 TGGGGCAGCCCCTTGGAGGCAGG - Intronic
1084548892 11:69828967-69828989 GGCCCCAGCACCCTGGAGACAGG - Intergenic
1084668780 11:70592899-70592921 GGGGGCAGGGCCGAGGAGGCTGG - Intronic
1084697747 11:70765911-70765933 GGGGTGAGCACCTTGGAAACGGG + Intronic
1084952989 11:72676959-72676981 GGGTTCAGCACCCTGGAGAGAGG - Intergenic
1090365398 11:126201109-126201131 GGGGTCACCACATTGGAGACTGG - Intergenic
1091398041 12:165968-165990 GGGGCCAGCTCCCTGGAGTCAGG - Intronic
1091404102 12:198159-198181 GAGGAGATCACCGTGGAGACCGG - Intronic
1092048090 12:5446967-5446989 GTGGGCAGCGGGGTGGAGACAGG + Intronic
1092291643 12:7162925-7162947 GACGCCAGCACCGTGGAGGCTGG - Intergenic
1094317577 12:29149733-29149755 GGGGGCCGCGCCTTGGGGACTGG + Intronic
1095249168 12:39958543-39958565 GGTGGCAGCAATGTGGAGGCGGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096200683 12:49680166-49680188 GGGGGCAGCACCCAGTACACTGG + Intronic
1099046427 12:77726528-77726550 GTGGGCATGACAGTGGAGACAGG + Intergenic
1099047236 12:77736875-77736897 TTGGGCAGCACTGTGGAGAATGG + Intergenic
1101237603 12:102805226-102805248 GGGTGCAGAACCCTAGAGACAGG - Intergenic
1101302225 12:103494885-103494907 GGGGGCAGCACAGTTGTCACAGG + Intronic
1101661331 12:106768103-106768125 GGAGGGAGCACGGAGGAGACTGG + Intronic
1101999630 12:109548854-109548876 AGGGGCAGCTCAGTGGAGGCAGG + Intergenic
1102226982 12:111235778-111235800 AGGAGCAGCAAAGTGGAGACAGG + Intronic
1102458661 12:113086980-113087002 CGGGGCAGCCACGTGCAGACAGG - Intronic
1103911512 12:124354860-124354882 AGGGGCAGCCCCATGGTGACAGG + Exonic
1103972228 12:124679422-124679444 GGAGGCTGCACAGGGGAGACAGG + Intergenic
1104639366 12:130457622-130457644 GCGGTCAGCACAGTGGAGAAAGG - Intronic
1105302756 13:19150742-19150764 GGGGCCAGCACTGTGCAGTCTGG + Intergenic
1106580504 13:31014089-31014111 GGGGCCACCACCTTGGAGACTGG + Intergenic
1107151809 13:37120368-37120390 GGGGGCATCATAGTGGAAACTGG - Intergenic
1108112617 13:47092246-47092268 TGGGGCAGCATGGTGAAGACAGG + Intergenic
1118445900 14:65851065-65851087 GGTGGGAGCACAGAGGAGACAGG + Intergenic
1118822594 14:69354875-69354897 GAGGGCAGCTCCGAGGGGACAGG - Exonic
1121492297 14:94369209-94369231 GGGGGCAGGAAGGTGGGGACCGG + Intergenic
1122066910 14:99180141-99180163 GGAGGCTGCACTGTGGAGAGGGG + Intronic
1122602744 14:102929616-102929638 GGGGTCAGCGCCGTGGATCCGGG - Intronic
1124135856 15:27035797-27035819 TTGGGCAGCACTGTGGAGAATGG + Intronic
1124361318 15:29038460-29038482 TGGTTCAGCACTGTGGAGACAGG - Intronic
1130027257 15:80280584-80280606 GGGGGCAGCAGGGTGGTGACGGG - Intergenic
1130321974 15:82849142-82849164 GGGGGCAGTAGCGTGGATGCAGG + Exonic
1132086856 15:98915598-98915620 GAGTGCAGCACTGTGGAGAATGG + Intronic
1132390462 15:101434740-101434762 GGGGGCTTCTCCGTGGAGACGGG + Intronic
1132880618 16:2160274-2160296 TGGGTCAGCACCGTGCAGAGGGG - Intronic
1136657074 16:31715977-31715999 GGTGGCAGCACAGTGGGGGCAGG - Intronic
1137612474 16:49828106-49828128 GGGGTCAGGACCCTGGAGATGGG - Intronic
1138581199 16:57941401-57941423 TGGGGCAGGAAGGTGGAGACGGG + Intronic
1140907139 16:79418512-79418534 GGAGGCAGCCCCGTGGTGAGGGG + Intergenic
1141627607 16:85269588-85269610 GGAGGCAGCACCGGGGAGTCAGG - Intergenic
1141679780 16:85537333-85537355 GAGGGCGGGACAGTGGAGACAGG + Intergenic
1141831320 16:86511299-86511321 GTGGGCAGCAGCGGGGAGGCGGG - Exonic
1142052086 16:87965416-87965438 GAGGGCAGCACCGTGGGGGAAGG + Intronic
1142198089 16:88748061-88748083 GGGGGCGTGACTGTGGAGACAGG - Intronic
1142240788 16:88943950-88943972 GGGGGCAGAGCCGTGGAGGAGGG + Intronic
1142264853 16:89058910-89058932 GGTGGCAGGATGGTGGAGACAGG + Intergenic
1142278423 16:89135244-89135266 GGGGGCTGCAGCGTGCAGGCGGG + Intronic
1142293058 16:89201489-89201511 GGGGGCAACAGCGTGGGGTCCGG + Exonic
1142672139 17:1492148-1492170 GTGGGCAGAACCGTGAATACTGG - Intronic
1142711788 17:1727507-1727529 GGGGGCAGGCCCTGGGAGACAGG - Exonic
1143467515 17:7147628-7147650 GGAGGCAGCACCTTGCAGCCCGG + Intergenic
1143599016 17:7931974-7931996 GGGCGGAGCTCCGTGGAAACCGG - Intronic
1143729045 17:8869967-8869989 GGGGGCTGCTCTTTGGAGACTGG - Intergenic
1143766560 17:9141560-9141582 GGAGGCAGCACCATGGAAGCTGG + Intronic
1144576968 17:16435531-16435553 GGAGGCAGCAGGGTGGGGACAGG - Intronic
1147156108 17:38545204-38545226 GGGGGCAGCTCTGAAGAGACTGG - Intronic
1148163959 17:45469286-45469308 GGAAGCAGCACGGAGGAGACAGG - Intronic
1148910937 17:50942395-50942417 GGGAGCAGGAGCGTGGAGACAGG - Intergenic
1149496729 17:57123006-57123028 TGGGGCATCACCATGGAGGCTGG + Intergenic
1150395191 17:64815940-64815962 GGAAGCAGCACGGAGGAGACAGG - Intergenic
1151313652 17:73309510-73309532 GGCAGCAGCACAGTGGAGGCAGG + Intronic
1151987599 17:77554095-77554117 AGGGGCAGAACCGTGGAGGGGGG - Intergenic
1152209787 17:78996991-78997013 GGCGACGGCACCGTGGAGAAAGG - Exonic
1152257180 17:79246869-79246891 GGGGGGAGAACGGCGGAGACAGG + Intronic
1152288228 17:79424558-79424580 GTGGGCACCACCCTGGAGACAGG - Intronic
1152493436 17:80653669-80653691 GGCCGCAGCACGGCGGAGACCGG - Intronic
1152799495 17:82324214-82324236 GGGGGCTGCACCCTGCAGCCAGG - Intronic
1152926131 17:83088577-83088599 GGCAGCAGCATCGTGGACACAGG + Intronic
1154502058 18:15001968-15001990 GGGGGCTGCACGGTGGAGCTGGG + Intergenic
1157605405 18:48923086-48923108 TGTGGCAGCAGGGTGGAGACCGG + Intronic
1161087703 19:2342870-2342892 GGGGCCAGGACGGTGGACACGGG - Intronic
1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG + Intronic
1161499360 19:4605030-4605052 GGGGGCAGCACCCAGGAGCCGGG + Intergenic
1162284438 19:9727654-9727676 GGGTGGTGCTCCGTGGAGACTGG + Intergenic
1163223715 19:15939883-15939905 GGGTGCAGAACTGAGGAGACAGG + Intergenic
1163673348 19:18642252-18642274 GGGGCCAGAACCTTGGAGAGTGG - Intronic
1163747424 19:19056725-19056747 GGGGGCTGCACGGAGGAGTCTGG - Intronic
1164788851 19:30959191-30959213 GGGGTCAGCTCCGAGGAGCCCGG + Intergenic
1165365710 19:35363484-35363506 CGGGGCAGCAGGGAGGAGACGGG - Intergenic
1165450155 19:35877774-35877796 GGGGGCAGCAGCGAGGACAAGGG + Exonic
1165771276 19:38381778-38381800 GGGTGCAGCACCCTGGTGATGGG + Intronic
1167357007 19:49010450-49010472 GGGGGAAGAACGGCGGAGACAGG - Intronic
1167473538 19:49688036-49688058 GGGGTCTGCAGCGTGGAGATGGG + Intronic
925342981 2:3149539-3149561 GGGGGCCGGACCCTGCAGACTGG - Intergenic
926218800 2:10921708-10921730 GGGTGTAGCTCCGTGGAAACAGG - Intergenic
926779456 2:16454702-16454724 AGGGGAGGCACCCTGGAGACAGG - Intergenic
927572107 2:24168789-24168811 GGAGGCAGCACCCTGGACTCAGG + Intronic
929218114 2:39437104-39437126 GGCGGCCGCAGCGTGGAGCCGGG - Exonic
932765086 2:74464523-74464545 GGGGTCAGCACGGAGGGGACTGG - Exonic
933437013 2:82261070-82261092 GCGGGCAGCACAGCAGAGACAGG + Intergenic
935380534 2:102447057-102447079 AGGAGCACCACTGTGGAGACAGG - Exonic
935580351 2:104750747-104750769 GGGTGCAGCAGGGTGAAGACAGG - Intergenic
938501214 2:131832074-131832096 GGGGGCAGCACTGAGCAGCCAGG - Intergenic
943117946 2:183696463-183696485 GAGGTCAGCACTGTGGATACTGG - Intergenic
947103850 2:226648345-226648367 GGGATCAGCACCGTGGAGCAGGG - Intergenic
948112898 2:235471321-235471343 GTTGCCAGCACCTTGGAGACAGG + Intergenic
948357165 2:237387860-237387882 GGGGGCAGCCGCGTGGAGGAAGG - Exonic
948602246 2:239113971-239113993 GGGGGAAGCTCGGTGGAGAAGGG + Intronic
949053692 2:241912300-241912322 GAGGGCAACACCGGGGAGGCGGG + Intergenic
1172306230 20:33882639-33882661 GGGGGCAGCATGGAGGAGGCAGG - Intergenic
1173860797 20:46282301-46282323 GGGAGCAGCACTGGGGAGAAAGG + Intronic
1173862701 20:46294667-46294689 GGGGGGAGCCCTGTGGAGAAGGG - Intronic
1175667177 20:60870690-60870712 GGTGGCATCAGCGTGGAGAGTGG - Intergenic
1175818383 20:61895591-61895613 GGTGGGAACACGGTGGAGACAGG + Intronic
1175856450 20:62123091-62123113 GGGGGCGGCACCGCGGGGGCCGG - Intronic
1176297987 21:5084587-5084609 GGGGGCAGCAGGGTGGTGGCAGG + Intergenic
1179187714 21:39097406-39097428 GGAGGCAGCACAGAGGCGACGGG - Intergenic
1179640511 21:42744688-42744710 GGAGGTGGCATCGTGGAGACTGG - Intronic
1179859042 21:44177362-44177384 GGGGGCAGCAGGGTGGTGGCAGG - Intergenic
1180037261 21:45256343-45256365 CGGGGCGGCACCCTGCAGACAGG - Intergenic
1181562469 22:23713944-23713966 GAGAGCAGCACCGTGGGGAAGGG + Intergenic
1183735438 22:39642386-39642408 GGGTGCAGCTCGGTGGAGCCTGG - Intronic
1184636009 22:45832121-45832143 GTGGGCAGCTGCGTGGAGAGTGG - Intronic
950499171 3:13353113-13353135 GGGGGCAGCACTGGGGAGGCTGG - Intronic
961860942 3:129916571-129916593 GGGGGCAGCACTGGGGAGGCCGG - Intergenic
967841632 3:194009590-194009612 GGGGGCAGCACCACAGAGGCGGG - Intergenic
968221276 3:196942110-196942132 GGAGGCACAACCGTGGAAACGGG + Intronic
968504212 4:964508-964530 GGGGTCTGGTCCGTGGAGACAGG - Intronic
968563483 4:1296980-1297002 GAGGGCAGCAGTGTGGGGACAGG - Intronic
968904474 4:3445082-3445104 GGGGCCAGCTCCGTCCAGACAGG + Intronic
969490967 4:7499002-7499024 GGGGGCAGCACCGTGGAGACGGG + Intronic
970446306 4:16125910-16125932 GGGGCCAGCTCTGTGGAAACAGG + Intergenic
976758425 4:88523324-88523346 GCGGGCAGGACGGGGGAGACCGG - Intronic
978489096 4:109292124-109292146 GGGGCCAGCATCGGGGAGAGAGG + Intronic
979307361 4:119162403-119162425 TGGGGCAGCAGTGTGGAGGCTGG + Intronic
979669280 4:123345177-123345199 GGGGAAAGCTCCGTGGAGACAGG - Intergenic
985709369 5:1419743-1419765 AGGGGAAGCCCTGTGGAGACAGG - Intronic
985709915 5:1422401-1422423 GTGGGCAGCACCGTGGGCAGCGG - Intronic
990320869 5:54628606-54628628 GGGGGCAGCTGCCTGGAGAGGGG - Intergenic
993400245 5:87440672-87440694 GGATGCAGCATAGTGGAGACTGG - Intergenic
997357568 5:133273587-133273609 GGGTGCAGAACAGTGGATACTGG + Intronic
997660548 5:135586258-135586280 GGTGGCAGCAGCATGCAGACAGG - Intergenic
998164607 5:139835849-139835871 GGGATCAGCACCATGGAGAGTGG - Intronic
1000137323 5:158365374-158365396 TGGGGAAACACCGTGGAGGCTGG + Intergenic
1002402152 5:178996781-178996803 GGGGGCAGCAGCTGGGGGACTGG + Intergenic
1002471695 5:179439384-179439406 GGGGGCAGCTCCCTGGAGCCTGG + Intergenic
1006603778 6:35242610-35242632 GGGGGCACCACCTGGGAGAGAGG - Exonic
1007399169 6:41593992-41594014 GGGGGCAGCACAGCTGAGAGAGG + Intronic
1007620035 6:43206395-43206417 CGGGCCAGCAGCGTGGTGACAGG - Exonic
1007779826 6:44246423-44246445 GGGGGCGGGACCGCCGAGACAGG + Intronic
1018190111 6:161303100-161303122 GGAGACAGAACCGTGGAGAGAGG + Intergenic
1019011800 6:168848982-168849004 GGGGGCCTCTCCCTGGAGACCGG + Intergenic
1019128944 6:169859682-169859704 GGAGGCAGCACAGAGGAGAAGGG - Intergenic
1019151347 6:170008003-170008025 GGGGACAGAGCAGTGGAGACAGG - Intergenic
1019189635 6:170244240-170244262 GGGGCCGGCACCGTGGGAACAGG - Intergenic
1019498991 7:1355065-1355087 GGGGGCAGCCCCGAGGGGAGGGG - Intergenic
1019695202 7:2442039-2442061 GGGGGCGGCACAGTGGGGAATGG - Intergenic
1019733467 7:2639475-2639497 GGGGCCAGCACTGTGGGCACAGG + Intronic
1023023054 7:36028012-36028034 GGGGGCAGCACCGAGGCAGCTGG - Intergenic
1025227327 7:57177115-57177137 GAGAGCAGCACCGTGGGGAAAGG + Intergenic
1029459706 7:100687695-100687717 GGGGCCAGCGCTGAGGAGACAGG - Intronic
1033810396 7:145004939-145004961 GGGAGCAGCCCAGTGGAGAGGGG + Intergenic
1034468417 7:151243276-151243298 GGGGACAGCACAGTTGGGACAGG - Intronic
1034479364 7:151307873-151307895 GGAGTCAGCTCCGTGGAGGCAGG + Intergenic
1034489728 7:151386834-151386856 TGGGGCAGCAGTGTGGACACAGG - Intronic
1035284724 7:157798989-157799011 GGGGGCAGCACCCTAGTCACAGG - Intronic
1035730256 8:1849490-1849512 TGGGGCAGCCACGTGGACACAGG + Intronic
1035764602 8:2096137-2096159 GGAGGAAGCAACGTGGAGACGGG - Intronic
1039118998 8:34124978-34125000 TGGGGTAGCACAGTGGAGGCAGG + Intergenic
1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG + Intronic
1045459136 8:102411956-102411978 GGGGGGAGCGCGGTGTAGACGGG - Intronic
1046802935 8:118449035-118449057 TGGGGCAGCAGCATGGACACAGG + Intronic
1047037449 8:120955342-120955364 CGGGGCAGCATCCTGGGGACAGG - Intergenic
1048208623 8:132435926-132435948 TGGGGCAGGACCGTGGAAGCTGG - Intronic
1049021144 8:139958427-139958449 GGGGGCAGCCACCTGGAAACTGG - Intronic
1049163911 8:141115298-141115320 GGGGGTGGCACTGTGGTGACTGG + Intergenic
1049249274 8:141579580-141579602 GGGGGCAGCACCTAGGTGTCGGG + Intergenic
1049412579 8:142479834-142479856 GTGGGCATCACCGTGAGGACAGG - Intronic
1049655764 8:143796299-143796321 GGAGGCAGCACAGTGGACACAGG + Intronic
1049688946 8:143950378-143950400 GCGGGCATCACCATGGCGACGGG + Exonic
1050011236 9:1187595-1187617 GGGGGCAGGACAGTGGGGGCAGG - Intergenic
1054798682 9:69325568-69325590 GCGGGCAGCAGCGCGGAGCCCGG - Intronic
1059431954 9:114255619-114255641 GGGGGAAGCACTGAGGAGATGGG - Intronic
1060841126 9:126793862-126793884 AGGGGCAGCGCAGTGCAGACTGG + Intergenic
1060975766 9:127764136-127764158 AGGGGCAGAGCCTTGGAGACAGG + Intronic
1061626239 9:131842320-131842342 GGGGGCAGGAGGGTGGGGACGGG + Intergenic
1062084617 9:134642230-134642252 GGGGGCAGCAGCGGGGCGCCCGG - Exonic
1062248382 9:135581918-135581940 GGGTGAAGCACAGTGGAGATGGG + Intergenic
1062498422 9:136842378-136842400 GGGGGCTGCACCGTGGAGCTGGG - Intronic
1203793557 EBV:164128-164150 TGCGGCATCACCGTGGAGCCGGG - Intergenic
1185466651 X:358892-358914 CGGGGAAGCACCGTGGGGACGGG + Intronic
1187390749 X:18885138-18885160 GGATGCAGCACCGTGGACAGTGG - Intergenic
1187438459 X:19294523-19294545 GGGGGCAGCATGGTGGATACTGG - Intergenic
1189322700 X:40096294-40096316 GGGGGCAGCGTCGTGGAGGGAGG - Intronic
1192058447 X:67797886-67797908 GGGGGAAGCTCTGTGGAGACAGG + Intergenic
1195274944 X:103273030-103273052 GGGTGCAGGACCCTGGAGAGGGG + Intergenic
1196816149 X:119666903-119666925 GGGGCCAGCACCTTGGAGGTGGG + Intronic
1197130021 X:122994648-122994670 GGGAGCAGCTCAGTGGAGAGTGG - Intergenic
1197701189 X:129601164-129601186 GGAGGCAGCACCGTGGAGCATGG + Intergenic