ID: 969492791

View in Genome Browser
Species Human (GRCh38)
Location 4:7509603-7509625
Sequence GGTTCACCCCAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 178}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969492791_969492803 11 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492803 4:7509637-7509659 GGGGCCTTGTGGGGCGAGGAAGG 0: 1
1: 0
2: 3
3: 53
4: 578
969492791_969492806 25 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492806 4:7509651-7509673 CGAGGAAGGCCACGTAGAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 89
969492791_969492805 24 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492805 4:7509650-7509672 GCGAGGAAGGCCACGTAGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 116
969492791_969492798 0 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492798 4:7509626-7509648 ACCAGGAAGAAGGGGCCTTGTGG 0: 1
1: 1
2: 5
3: 40
4: 317
969492791_969492794 -10 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492794 4:7509616-7509638 GGGGTGAACCACCAGGAAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 198
969492791_969492800 1 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492800 4:7509627-7509649 CCAGGAAGAAGGGGCCTTGTGGG 0: 1
1: 0
2: 3
3: 31
4: 332
969492791_969492801 2 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492801 4:7509628-7509650 CAGGAAGAAGGGGCCTTGTGGGG 0: 1
1: 0
2: 6
3: 35
4: 363
969492791_969492807 29 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492807 4:7509655-7509677 GAAGGCCACGTAGAGTGGGATGG 0: 1
1: 0
2: 0
3: 18
4: 166
969492791_969492795 -9 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492795 4:7509617-7509639 GGGTGAACCACCAGGAAGAAGGG No data
969492791_969492802 7 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492802 4:7509633-7509655 AGAAGGGGCCTTGTGGGGCGAGG 0: 1
1: 0
2: 0
3: 38
4: 356
969492791_969492796 -8 Left 969492791 4:7509603-7509625 CCCACAGGGGGCTGGGGTGAACC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 969492796 4:7509618-7509640 GGTGAACCACCAGGAAGAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969492791 Original CRISPR GGTTCACCCCAGCCCCCTGT GGG (reversed) Intronic
901441237 1:9279746-9279768 GGTTCAACACAGCCCTCGGTGGG - Intergenic
903277076 1:22229057-22229079 GCTTCAGCACAGCCCCCTCTGGG - Intergenic
903749397 1:25611390-25611412 GGCTCACCCCAGCAGGCTGTGGG - Intergenic
903771471 1:25767042-25767064 GGTGCACCCCTGCCCACTCTGGG - Intronic
905403308 1:37717994-37718016 GGTAGGCCCCAGCCCCCAGTGGG + Exonic
905522144 1:38608445-38608467 GATGCAGCCCTGCCCCCTGTTGG - Intergenic
909487447 1:76189421-76189443 GGTTCAGCCCAGACCAATGTGGG - Intronic
922792138 1:228316479-228316501 CCTTCAACCCAGCCTCCTGTGGG - Intronic
923417228 1:233775329-233775351 GTTTAACACCATCCCCCTGTTGG - Intergenic
1067085200 10:43234520-43234542 GGTCCTCATCAGCCCCCTGTGGG - Intronic
1071928742 10:90441123-90441145 GGTGATCCCCAGGCCCCTGTTGG - Intergenic
1072289678 10:93952537-93952559 GCCTCACCCCACCCCCATGTCGG - Intronic
1072832291 10:98671607-98671629 TCTTCACCCCCGCCCCTTGTGGG + Intronic
1075383783 10:122039973-122039995 GCCTCAGCCCAGCCCCTTGTGGG + Intronic
1076131992 10:128019706-128019728 GGTTCTCCCCAGGCCTCTGTTGG + Intronic
1076163754 10:128266031-128266053 GGTCCTCACCAGCCCCCTGGCGG - Intergenic
1076322668 10:129595005-129595027 GGTTCACCCCTGCCGTCTCTCGG + Intronic
1076626658 10:131825018-131825040 AGCTCACCCCATCCCCCTGCGGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077320599 11:1939190-1939212 GGTGCACCCCAGGCCCTGGTCGG + Intergenic
1083890203 11:65592191-65592213 CGTTCTCCCCAGCGCCCTGGAGG + Exonic
1084767680 11:71323278-71323300 TGGTCACCCCAGCCCACTCTTGG + Intergenic
1090225682 11:125070857-125070879 GGTGCACGCCAGTCCACTGTAGG - Intronic
1092528787 12:9327170-9327192 GGTGCACCCCCGCCCCCAGAAGG - Intergenic
1092907050 12:13110724-13110746 GGGACACACCAGCCCCCTGAAGG + Intronic
1096627649 12:52905145-52905167 GGTTAGGCCCAGCCCCCTCTGGG - Intronic
1099223395 12:79940380-79940402 GGTTCACCCAAGCCATCTTTGGG + Intergenic
1101732732 12:107440117-107440139 GGTTCACCCCTGACACATGTGGG + Intronic
1103914378 12:124368974-124368996 GCTGCACTCCAGCCCCCTCTTGG + Intronic
1104929829 12:132332814-132332836 GGTTCATCTCTGCACCCTGTGGG - Intergenic
1104929846 12:132332901-132332923 GGTTCATCTCTGCACCCTGTGGG - Intergenic
1104929863 12:132332988-132333010 GGTTCATCTCTGCACCCTGTGGG - Intergenic
1109155707 13:58906497-58906519 GGTAAACCCCAGGCCCCTGGTGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1119861016 14:77936108-77936130 AGATCACCCCAGCCTCCTCTAGG - Intergenic
1121507015 14:94485306-94485328 TGTTCCCTCCAGCCCCCTGTGGG - Intergenic
1121845822 14:97171253-97171275 GTCTGACCCCAGCCCCCTGTGGG - Intergenic
1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG + Exonic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1123458586 15:20447187-20447209 GGTCCACCCCAGCCCACCTTTGG - Intergenic
1123659477 15:22553222-22553244 GGTCCACCCCAGCCCACCTTTGG + Intergenic
1124313338 15:28647717-28647739 GGTCCACCCCAGCCCACCTTTGG + Intergenic
1125927034 15:43571470-43571492 ACTTCACCCCAGCCTCCTGAGGG - Exonic
1125940178 15:43671035-43671057 ACTTCACCCCAGCCTCCTGAGGG - Intergenic
1126770518 15:52051378-52051400 GGTTCCCCCCAACCCCCAGACGG + Intronic
1129966820 15:79743402-79743424 GGAACACCCTAGCCCTCTGTTGG + Intergenic
1133648090 16:7783304-7783326 GGCTCCCCCCACCCCCATGTTGG + Intergenic
1133988917 16:10689905-10689927 GGTTCTGCCCAGCCCCCTGAAGG - Intronic
1136621183 16:31429449-31429471 GGTTCACACCAGCCCTGTCTAGG - Intergenic
1141443272 16:84042841-84042863 GCCTCTCCCCAGCCCCCTGCAGG + Intergenic
1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG + Intergenic
1142285128 16:89168561-89168583 GCCTCACCCCAGCGCCCTGGCGG + Intergenic
1142713508 17:1736047-1736069 GGTTCAGCCCACCGCCCAGTCGG - Exonic
1142899306 17:3002532-3002554 GCTTCACCCAGGCCCCCTGGGGG - Intronic
1143535136 17:7533946-7533968 GGTTGAACCCAGCACCATGTTGG - Intergenic
1143756590 17:9072198-9072220 GCTTCACACCAGCCCCCTCCCGG + Intronic
1144785174 17:17827437-17827459 GGTGCAGCCCAGCTCCCTGGAGG - Intronic
1145942453 17:28749742-28749764 GCTTCAGCCCTGGCCCCTGTGGG + Exonic
1146277675 17:31525540-31525562 GGTTCTCCCCTGACCCCTGGTGG + Intronic
1146400196 17:32495478-32495500 GGTTCCCTGCAGCCCCCGGTGGG - Intronic
1146889392 17:36496248-36496270 GGATCACCCCAGCCCAGTGAAGG + Exonic
1148667044 17:49382684-49382706 GATCCTCCCCAGCCCCCTGAGGG - Intronic
1151698429 17:75730131-75730153 GCTTAAGCCCAGCCCCATGTTGG + Intronic
1152091649 17:78250773-78250795 AGTGCACTCCAGCCCTCTGTGGG + Intergenic
1152507745 17:80762359-80762381 CCCTCACCCCAGCCCCCAGTGGG - Intronic
1153671331 18:7415181-7415203 GTTTCCCCCCATCCCCCTGGGGG - Intergenic
1160982617 19:1823306-1823328 GGTTCAGCCCAGTCCCCAGCAGG + Intronic
1161554489 19:4932941-4932963 GGCTCACCCCAGCACCACGTTGG - Exonic
1167768657 19:51500449-51500471 GCTCCTCTCCAGCCCCCTGTGGG - Intronic
925191818 2:1891352-1891374 GGTTCTCCCCAGCCGCCTGGTGG + Intronic
928451365 2:31381357-31381379 GGCTCACCACAGCCTGCTGTTGG - Intronic
935262963 2:101370848-101370870 GGGTCACCCCAGGGCCCTCTTGG + Intronic
937065561 2:119014263-119014285 CGTGCACTCCAGCCCTCTGTAGG + Intergenic
937376039 2:121336274-121336296 GCTCCACCCCTGCCCCCCGTGGG - Intergenic
940639160 2:156329757-156329779 GGTGCAGCACAGCCCCATGTGGG - Exonic
941618778 2:167753756-167753778 GCTTCACCACAGCCCAGTGTGGG + Intergenic
943383007 2:187173666-187173688 GGTCCAGCCCAGCAGCCTGTAGG - Intergenic
947918427 2:233849446-233849468 GGTTCACAACACCACCCTGTAGG + Intronic
1169046961 20:2540900-2540922 ATTTCAACCCAGCTCCCTGTGGG + Intronic
1169277855 20:4245686-4245708 GGTTCACACTGGGCCCCTGTAGG - Intronic
1171493501 20:25538455-25538477 AGCTCACCCCAGCCTCCTCTGGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172025435 20:31945287-31945309 GGCTCACCACAGCCATCTGTGGG - Exonic
1176236707 20:64056826-64056848 GTTTCTCCCCAGACGCCTGTTGG + Intronic
1179209652 21:39313977-39313999 GATTCACCGCCGCCCCCCGTGGG + Intronic
1179723109 21:43326661-43326683 GGTTCACCCCTCCCCAGTGTGGG - Intergenic
1179960698 21:44765750-44765772 TCTTCACCCCAGCCCCCGGGGGG + Intergenic
1179984563 21:44913414-44913436 GGTGCACCCCCTCTCCCTGTGGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180744513 22:18078408-18078430 GGGTCCCCCGAGCCCCCTGAGGG - Exonic
1182257828 22:29050778-29050800 GGTTGCTCCCAGGCCCCTGTGGG - Exonic
1183406456 22:37632830-37632852 GCTTCTCCCCACACCCCTGTAGG + Exonic
1184251321 22:43261987-43262009 GGGTCACCCCATTCCCCAGTAGG - Intronic
950582683 3:13872778-13872800 GCTCCACCCCAGACCTCTGTGGG + Intronic
954128840 3:48549453-48549475 CGCTCACCCCAGCGCCCCGTGGG - Intronic
954519162 3:51207849-51207871 GGTTCTACCCCGTCCCCTGTTGG - Intronic
956557411 3:70539013-70539035 GGTCCAGCCCAGCAGCCTGTAGG - Intergenic
956595289 3:70960419-70960441 TGATCACCCCAGTCCCCTTTGGG - Intronic
960617916 3:119613113-119613135 AGGTCACCCCAGCTCACTGTCGG - Exonic
963239832 3:142992197-142992219 GGTTAACACAAGCCGCCTGTAGG - Intronic
963642875 3:147880368-147880390 GGTCCAGCCCAGCAGCCTGTAGG - Intergenic
964491148 3:157237653-157237675 GCTTCACCCCAGCTCCATGGAGG + Intergenic
965656352 3:170989345-170989367 GGTGTGCCCCAGCCCCCTGCTGG + Intergenic
968607493 4:1542396-1542418 GGGTCACCCCAGGGCCCTGGGGG - Intergenic
969492791 4:7509603-7509625 GGTTCACCCCAGCCCCCTGTGGG - Intronic
970124615 4:12795188-12795210 TGTTCACCCTATCCCCATGTAGG - Intergenic
972345060 4:38185728-38185750 TGTTCAATCCAGCTCCCTGTGGG + Intergenic
978491689 4:109317098-109317120 GGTCCAGCCCAGCAGCCTGTAGG + Intergenic
982826641 4:160010881-160010903 GGTTCACCCCAGCACTCTGGGGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985932449 5:3069125-3069147 GGTACACACCACCCCCTTGTTGG - Intergenic
989821353 5:45798220-45798242 GGTCCAGCCCAGCAGCCTGTAGG + Intergenic
992813016 5:80408205-80408227 CGGTCACCCCGCCCCCCTGTGGG - Intronic
993939442 5:94040827-94040849 GGTTCAAACTTGCCCCCTGTTGG - Intronic
998096455 5:139398238-139398260 GGTCCTCCCCAGACCACTGTGGG - Intronic
999404359 5:151293889-151293911 GATCCTGCCCAGCCCCCTGTAGG + Intronic
1002662927 5:180803271-180803293 GTTTCCCCCCGGCCCCCCGTCGG - Intronic
1002709658 5:181187616-181187638 GATTCGCCCCAACTCCCTGTTGG + Intergenic
1003480929 6:6532392-6532414 CCTTCACACCAGCCCCCTCTAGG + Intergenic
1005844792 6:29768971-29768993 AGTGCACCCCAGGCCCCTATGGG - Intergenic
1006832735 6:36978371-36978393 GCTTCACTCCAGCCCCATGGGGG - Intronic
1007407176 6:41641839-41641861 GGTTCCCCCCTACTCCCTGTTGG + Intronic
1009626315 6:66142243-66142265 GGTCCAGCCCAGCAGCCTGTAGG - Intergenic
1009690995 6:67031672-67031694 CGTCCACCCCCTCCCCCTGTGGG - Intergenic
1012912712 6:105136533-105136555 GGTTCCTCCTCGCCCCCTGTAGG - Intronic
1013456088 6:110330738-110330760 AGTTCCCACCAGCCTCCTGTGGG - Intronic
1014027610 6:116668226-116668248 AGTTCTCCCGAGCCCCCAGTGGG + Intronic
1014314105 6:119842360-119842382 GGTTCACCCCAACCCCAGGCTGG - Intergenic
1015377378 6:132526393-132526415 GGTTCAAACTTGCCCCCTGTTGG - Intergenic
1018560846 6:165099536-165099558 GGTCCAGCCCAGCAGCCTGTAGG + Intergenic
1018739153 6:166714154-166714176 GGTTACCCCCAGCACGCTGTGGG + Intronic
1018744739 6:166753180-166753202 GTTTCACCCCAGTCCCCAGCTGG + Intronic
1019003559 6:168777508-168777530 ATTCCACCCCAGCACCCTGTTGG + Intergenic
1029314228 7:99696825-99696847 GTTTCACACCAACCCCCTTTGGG + Intronic
1032128091 7:129209171-129209193 AGTTCACCCCAGCCCCAGCTGGG + Intronic
1032128335 7:129210655-129210677 GGTTCACCGCTGCCCCCTGGTGG + Intronic
1032164209 7:129533028-129533050 AGTTGACCTCAGCCCTCTGTAGG + Intergenic
1039877807 8:41602478-41602500 GGAGCACCCCAGGCCCCTGCAGG - Intronic
1049297934 8:141853164-141853186 GGCCCACCCCAGCACCCTGGAGG + Intergenic
1051748942 9:20321713-20321735 GCTTCACACCAGTCCCCTGTAGG + Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1055673971 9:78636194-78636216 GGTTAACCCCATTCCCCTCTTGG - Intergenic
1056163581 9:83921377-83921399 GGGACAGCCCAGGCCCCTGTCGG + Exonic
1057932937 9:99211943-99211965 GGTGCTCCCCAGACCCCTGGTGG + Intergenic
1058331178 9:103762619-103762641 GGTTCACCGCAGCCTTATGTTGG - Intergenic
1058979635 9:110157199-110157221 GGTTCATGCCAACCTCCTGTGGG + Intronic
1059423470 9:114206665-114206687 GGTTCCCCCCAGCCCTCATTTGG - Intronic
1060658231 9:125387586-125387608 TGGTCACCCGAGCCCTCTGTGGG + Intergenic
1061870051 9:133515698-133515720 GGCTCACCCCAGCCCTCTCCCGG + Intronic
1062502232 9:136856502-136856524 TGTCCACCCCAGCTCCCTGCTGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185774887 X:2794241-2794263 GCTTCACCCCAGCTCACGGTTGG + Intronic
1186378472 X:9033403-9033425 GGATCTCCCCAGCCACCTCTAGG + Intronic
1191251939 X:58263961-58263983 GGTGCCCACCAGCCCCCCGTGGG - Intergenic
1194123750 X:89989915-89989937 GGTCCAGCCCAGCATCCTGTAGG - Intergenic
1195256753 X:103098145-103098167 GATTCCCCCCCGCCCCCTATTGG - Intergenic
1195721669 X:107874490-107874512 GGTCCAGCCCAGCAGCCTGTAGG - Intronic
1200476636 Y:3647536-3647558 GGTCCAGCCCAGCATCCTGTAGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic