ID: 969493034

View in Genome Browser
Species Human (GRCh38)
Location 4:7510674-7510696
Sequence CCGGGGCCGGCACCTTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969493024_969493034 14 Left 969493024 4:7510637-7510659 CCTTGTTCTGGGTGCGGCATGTC 0: 1
1: 1
2: 2
3: 6
4: 85
Right 969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG 0: 1
1: 1
2: 0
3: 5
4: 75
969493017_969493034 28 Left 969493017 4:7510623-7510645 CCCCGGGGCCGGCGCCTTGTTCT 0: 1
1: 1
2: 1
3: 6
4: 73
Right 969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG 0: 1
1: 1
2: 0
3: 5
4: 75
969493029_969493034 -8 Left 969493029 4:7510659-7510681 CCTGGAAATGCGACCCCGGGGCC 0: 3
1: 1
2: 0
3: 7
4: 84
Right 969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG 0: 1
1: 1
2: 0
3: 5
4: 75
969493018_969493034 27 Left 969493018 4:7510624-7510646 CCCGGGGCCGGCGCCTTGTTCTG 0: 1
1: 1
2: 1
3: 35
4: 107
Right 969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG 0: 1
1: 1
2: 0
3: 5
4: 75
969493022_969493034 20 Left 969493022 4:7510631-7510653 CCGGCGCCTTGTTCTGGGTGCGG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG 0: 1
1: 1
2: 0
3: 5
4: 75
969493019_969493034 26 Left 969493019 4:7510625-7510647 CCGGGGCCGGCGCCTTGTTCTGG 0: 1
1: 1
2: 0
3: 8
4: 105
Right 969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG 0: 1
1: 1
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969493034 Original CRISPR CCGGGGCCGGCACCTTGTTC TGG Intronic
900156398 1:1204987-1205009 CCTGGGGCTGCACCCTGTTCTGG - Intronic
907527718 1:55063542-55063564 CCGGAGCCGGCACCTGGCGCAGG + Exonic
912250815 1:108010898-108010920 GTGGGGCAGGCAGCTTGTTCAGG + Intergenic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
919830806 1:201539087-201539109 GAGGGGACGGCACTTTGTTCAGG + Intergenic
922422957 1:225471686-225471708 TGTGGACCGGCACCTTGTTCCGG + Intergenic
1062843983 10:690424-690446 CTGGGGCCTGCAGCCTGTTCCGG - Intergenic
1067742851 10:48909531-48909553 CAGGTGCCGGCACCTCCTTCTGG + Exonic
1080698750 11:34625767-34625789 CGGGGCCGGGCCCCTTGTTCTGG + Intronic
1084558879 11:69891626-69891648 CCTGGGCCGGCACCTTGAGTTGG - Intergenic
1085276517 11:75303598-75303620 CCGGGGCCTGTACCTTCTGCAGG - Intronic
1085324646 11:75597212-75597234 CTGGGGCCAGCCCCTAGTTCAGG + Intronic
1092508435 12:9127794-9127816 CCAGAGCCCGCACCTTGTCCAGG - Intergenic
1100464635 12:94834305-94834327 CCAGGGCGTGCACCTTGTCCAGG - Intergenic
1101760058 12:107651111-107651133 CCGAGGCCGGCACCGTGCTCAGG + Intronic
1102346477 12:112164110-112164132 CCGGGGCCGGCACATCCTTGTGG - Exonic
1105705346 13:22964738-22964760 CCCGGGCAGGCAGCTTGTGCTGG + Intergenic
1118820969 14:69345660-69345682 CTGGGGCCGGCAGCTTCCTCAGG + Intronic
1123087542 14:105723779-105723801 CCTGGGCCGGCCCCTTGATTGGG + Intergenic
1128845587 15:70891987-70892009 CCGGGGCGGGCACCCGGTGCAGG + Exonic
1130828619 15:87576596-87576618 CCTGGCCCGGCACCTGGTTGTGG + Intergenic
1132593552 16:737627-737649 CCGGGGCCAGCACCCCGTCCAGG - Intronic
1132747550 16:1443268-1443290 CCAGGGCCTGCATCTGGTTCTGG + Exonic
1132900566 16:2251740-2251762 CCGGGGCAGGCACCTGGATCTGG + Intronic
1136278219 16:29191973-29191995 CCTGGGCCGGCAACGTGGTCAGG + Intergenic
1138934070 16:61697268-61697290 CCAGGGCCAGCATCTTGTACAGG + Intronic
1139853758 16:69965389-69965411 CCGGGACCCGCCCCTTGTCCGGG + Intergenic
1142082596 16:88158007-88158029 CCTGGGCCGGCAACGTGGTCAGG + Intergenic
1144560341 17:16315984-16316006 CCGCGCCCGGCTCCTTTTTCAGG + Intronic
1144621617 17:16822087-16822109 CCAGGGCACGCACCTTGTCCAGG + Intergenic
1144626185 17:16845497-16845519 CCAGGGCACGCACCTTGTCCAGG + Intergenic
1144777196 17:17790914-17790936 CTGGGGACGGCACTTGGTTCTGG - Intronic
1144880248 17:18427223-18427245 CCAGGGCACGCACCTTGTCCAGG - Intergenic
1145147423 17:20493750-20493772 CCAGGGCACGCACCTTGTCCAGG + Intergenic
1145151985 17:20517164-20517186 CCAGGGCACGCACCTTGTCCAGG + Intergenic
1146794976 17:35774395-35774417 CCTGGGCAGGCCCCTTGTCCTGG - Intronic
1147564473 17:41527944-41527966 CCAGGGCGCGCACCTTGTCCAGG + Exonic
1147580328 17:41624194-41624216 CCAGGGCACGCACCTTGTCCAGG + Exonic
1147721611 17:42543128-42543150 CCGTGGCCGCCTCCTGGTTCTGG + Exonic
1153782648 18:8507611-8507633 CCGTGCCCGGCACGTTGTCCAGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1161713804 19:5864420-5864442 CCACTGCCGGCACCTTCTTCAGG + Intergenic
1161716246 19:5877661-5877683 CCACTGCCGGCACCTTCTTCAGG + Intronic
1162533370 19:11248598-11248620 CCTGGGCAGGCACCTCTTTCGGG + Intronic
1165798509 19:38533084-38533106 CTGGGTCAGGCACCTTGTTTGGG - Intronic
1167383626 19:49151954-49151976 CTGGGCCCGGCACCTTCCTCAGG + Intronic
1168339888 19:55616764-55616786 CAGGGGCGGGCACCTTGGCCGGG + Exonic
926278162 2:11421667-11421689 CAGGGGCCGGCACCTGGTATGGG + Intergenic
948593444 2:239065291-239065313 CTGGGACCAGCACCTTGGTCTGG + Intronic
948982646 2:241502331-241502353 ACGGGGCTGGCATGTTGTTCGGG - Intronic
1175709514 20:61208033-61208055 CCGGGGCCCTCACTTGGTTCAGG - Intergenic
1176123365 20:63464216-63464238 CCAGGGCCAGCAGCTTGTGCTGG - Intronic
1176251312 20:64121738-64121760 ACGGTGCCGGCACCTGCTTCTGG + Intergenic
1185386114 22:50531949-50531971 CCGGGGCCTGCCCCTTCTACCGG + Exonic
949254198 3:2025600-2025622 CTTGGGCTGGCGCCTTGTTCAGG - Intergenic
953031877 3:39185002-39185024 CCAGGGCTTGCACCTGGTTCAGG + Exonic
953369685 3:42376730-42376752 CCAGGGCAGGCACCCTGTTGAGG - Intergenic
962962336 3:140322062-140322084 CTGGGACAGGCACCTTGCTCAGG + Intronic
969493020 4:7510625-7510647 CCGGGGCCGGCGCCTTGTTCTGG + Intronic
969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG + Intronic
972162565 4:36244458-36244480 CCGGCGCCCGCGCCTTGCTCAGG + Exonic
985569275 5:635705-635727 ACGGTGCCGGCACCTGGTGCTGG + Intronic
986649166 5:9946854-9946876 ACGGGGCCGGCTCCTTGTGGAGG - Intergenic
992200259 5:74376505-74376527 CCAGGACTGGCACCTTGTTCTGG + Intergenic
992769802 5:80035959-80035981 CCGGGTCCTGCACCCTGTGCCGG + Intronic
1001304644 5:170562832-170562854 CCAGGGCCTGAACCTTATTCTGG - Intronic
1003958698 6:11190029-11190051 CAGGGGCCTGCTCCTTGCTCAGG + Exonic
1021622215 7:22560065-22560087 CCGGTGCTGCCACCTTGTGCTGG - Intronic
1027219085 7:76202487-76202509 CCTGGGCCGGCACCTCCTGCTGG - Intronic
1031919131 7:127588589-127588611 CCGGGGCCGGCGCCCCGGTCCGG - Intronic
1033141713 7:138833118-138833140 CTGGCGCTGGCACCTTGCTCCGG + Intronic
1034449093 7:151127915-151127937 CCGGGGCAGGCTCCTTGTTGTGG + Intronic
1034479851 7:151311222-151311244 CCGTGGCAGGGACCTTCTTCTGG - Intergenic
1035161038 7:156950047-156950069 CCCAGGCCGGGACCCTGTTCGGG - Exonic
1039422342 8:37453676-37453698 CCGGAGCAGGCTCCTTGTGCGGG + Intergenic
1044873806 8:96645193-96645215 CCGGGGCGGGCGCCGGGTTCGGG - Intergenic
1049529355 8:143146746-143146768 CCTGGGCAGGCACCTTTCTCTGG - Intergenic
1062212841 9:135373860-135373882 TCTGGGCCGGCACCTGGTTCGGG + Intergenic
1062651179 9:137578612-137578634 GCGGCGCGCGCACCTTGTTCTGG + Exonic
1203770241 EBV:46281-46303 CCGGGGTCGGCACCAGTTTCTGG + Intergenic
1189035775 X:37492467-37492489 CCGGGGCCCCCATCTTGTGCAGG - Intronic
1197753447 X:129980553-129980575 CCGAGGCCGGCACCTGGACCCGG + Intergenic