ID: 969495339

View in Genome Browser
Species Human (GRCh38)
Location 4:7523116-7523138
Sequence CTGGAAGGAAGAAAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3641
Summary {0: 1, 1: 0, 2: 27, 3: 371, 4: 3242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969495339_969495346 -3 Left 969495339 4:7523116-7523138 CCTCCTCCCTTTCTTCCTTCCAG 0: 1
1: 0
2: 27
3: 371
4: 3242
Right 969495346 4:7523136-7523158 CAGACAGGCTGAGTTCTCCCAGG 0: 1
1: 0
2: 4
3: 20
4: 226
969495339_969495351 26 Left 969495339 4:7523116-7523138 CCTCCTCCCTTTCTTCCTTCCAG 0: 1
1: 0
2: 27
3: 371
4: 3242
Right 969495351 4:7523165-7523187 GACACCATCCACAGATTCTAGGG 0: 1
1: 0
2: 0
3: 12
4: 157
969495339_969495350 25 Left 969495339 4:7523116-7523138 CCTCCTCCCTTTCTTCCTTCCAG 0: 1
1: 0
2: 27
3: 371
4: 3242
Right 969495350 4:7523164-7523186 TGACACCATCCACAGATTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 189
969495339_969495347 -2 Left 969495339 4:7523116-7523138 CCTCCTCCCTTTCTTCCTTCCAG 0: 1
1: 0
2: 27
3: 371
4: 3242
Right 969495347 4:7523137-7523159 AGACAGGCTGAGTTCTCCCAGGG 0: 1
1: 0
2: 3
3: 19
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969495339 Original CRISPR CTGGAAGGAAGAAAGGGAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr